ID: 1003098167

View in Genome Browser
Species Human (GRCh38)
Location 6:3157846-3157868
Sequence GCGGCTCGGGGTGGGGATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098167_1003098183 4 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098183 6:3157873-3157895 TCTGGACCCCCGAGGGGGGCTGG No data
1003098167_1003098185 6 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098185 6:3157875-3157897 TGGACCCCCGAGGGGGGCTGGGG No data
1003098167_1003098176 -4 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098167_1003098178 -2 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098167_1003098190 12 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098190 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
1003098167_1003098196 28 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098196 6:3157897-3157919 GACCGGGGGCCCCGGAACCAGGG No data
1003098167_1003098188 11 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
1003098167_1003098180 -1 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098180 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
1003098167_1003098197 29 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098197 6:3157898-3157920 ACCGGGGGCCCCGGAACCAGGGG No data
1003098167_1003098192 13 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098192 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
1003098167_1003098184 5 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098184 6:3157874-3157896 CTGGACCCCCGAGGGGGGCTGGG No data
1003098167_1003098193 14 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098193 6:3157883-3157905 CGAGGGGGGCTGGGGACCGGGGG No data
1003098167_1003098177 -3 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098177 6:3157866-3157888 CGCCCACTCTGGACCCCCGAGGG No data
1003098167_1003098194 20 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098167_1003098182 0 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098182 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
1003098167_1003098199 30 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098199 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
1003098167_1003098195 27 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098167 Original CRISPR GCGGCTCGGGGTGGGGATCG CGG (reversed) Intergenic