ID: 1003098170

View in Genome Browser
Species Human (GRCh38)
Location 6:3157855-3157877
Sequence CCAGAGTGGGCGGCTCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098170_1003098202 26 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098202 6:3157904-3157926 GGCCCCGGAACCAGGGGGAGGGG No data
1003098170_1003098194 11 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098170_1003098192 4 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098192 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
1003098170_1003098185 -3 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098185 6:3157875-3157897 TGGACCCCCGAGGGGGGCTGGGG No data
1003098170_1003098183 -5 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098183 6:3157873-3157895 TCTGGACCCCCGAGGGGGGCTGG No data
1003098170_1003098199 21 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098199 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
1003098170_1003098180 -10 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098180 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
1003098170_1003098201 25 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG No data
1003098170_1003098193 5 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098193 6:3157883-3157905 CGAGGGGGGCTGGGGACCGGGGG No data
1003098170_1003098184 -4 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098184 6:3157874-3157896 CTGGACCCCCGAGGGGGGCTGGG No data
1003098170_1003098182 -9 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098182 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
1003098170_1003098196 19 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098196 6:3157897-3157919 GACCGGGGGCCCCGGAACCAGGG No data
1003098170_1003098200 24 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098200 6:3157902-3157924 GGGGCCCCGGAACCAGGGGGAGG No data
1003098170_1003098197 20 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098197 6:3157898-3157920 ACCGGGGGCCCCGGAACCAGGGG No data
1003098170_1003098188 2 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
1003098170_1003098190 3 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098190 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
1003098170_1003098195 18 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098170 Original CRISPR CCAGAGTGGGCGGCTCGGGG TGG (reversed) Intergenic
No off target data available for this crispr