ID: 1003098175

View in Genome Browser
Species Human (GRCh38)
Location 6:3157865-3157887
Sequence CCTCGGGGGTCCAGAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098175_1003098194 1 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098175_1003098196 9 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098196 6:3157897-3157919 GACCGGGGGCCCCGGAACCAGGG No data
1003098175_1003098188 -8 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098188 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
1003098175_1003098195 8 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098175_1003098201 15 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG No data
1003098175_1003098202 16 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098202 6:3157904-3157926 GGCCCCGGAACCAGGGGGAGGGG No data
1003098175_1003098199 11 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098199 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
1003098175_1003098197 10 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098197 6:3157898-3157920 ACCGGGGGCCCCGGAACCAGGGG No data
1003098175_1003098190 -7 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098190 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
1003098175_1003098200 14 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098200 6:3157902-3157924 GGGGCCCCGGAACCAGGGGGAGG No data
1003098175_1003098206 25 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098175_1003098192 -6 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098192 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
1003098175_1003098193 -5 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098193 6:3157883-3157905 CGAGGGGGGCTGGGGACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098175 Original CRISPR CCTCGGGGGTCCAGAGTGGG CGG (reversed) Intergenic
No off target data available for this crispr