ID: 1003098176

View in Genome Browser
Species Human (GRCh38)
Location 6:3157865-3157887
Sequence CCGCCCACTCTGGACCCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098167_1003098176 -4 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098163_1003098176 22 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098162_1003098176 23 Left 1003098162 6:3157819-3157841 CCCCTGGCGCTGGGTCCTCCGCT No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098165_1003098176 8 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098166_1003098176 5 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
1003098164_1003098176 21 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098176 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098176 Original CRISPR CCGCCCACTCTGGACCCCCG AGG Intergenic
No off target data available for this crispr