ID: 1003098178

View in Genome Browser
Species Human (GRCh38)
Location 6:3157867-3157889
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098169_1003098178 -10 Left 1003098169 6:3157854-3157876 CCCACCCCGAGCCGCCCACTCTG No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098163_1003098178 24 Left 1003098163 6:3157820-3157842 CCCTGGCGCTGGGTCCTCCGCTC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098168_1003098178 -9 Left 1003098168 6:3157853-3157875 CCCCACCCCGAGCCGCCCACTCT No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098162_1003098178 25 Left 1003098162 6:3157819-3157841 CCCCTGGCGCTGGGTCCTCCGCT No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098164_1003098178 23 Left 1003098164 6:3157821-3157843 CCTGGCGCTGGGTCCTCCGCTCA No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098166_1003098178 7 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098165_1003098178 10 Left 1003098165 6:3157834-3157856 CCTCCGCTCACGCCGCGATCCCC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data
1003098167_1003098178 -2 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098178 6:3157867-3157889 GCCCACTCTGGACCCCCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098178 Original CRISPR GCCCACTCTGGACCCCCGAG GGG Intergenic