ID: 1003098179

View in Genome Browser
Species Human (GRCh38)
Location 6:3157868-3157890
Sequence CCCCCTCGGGGGTCCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098179_1003098193 -8 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098193 6:3157883-3157905 CGAGGGGGGCTGGGGACCGGGGG No data
1003098179_1003098199 8 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098199 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
1003098179_1003098196 6 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098196 6:3157897-3157919 GACCGGGGGCCCCGGAACCAGGG No data
1003098179_1003098209 29 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098179_1003098190 -10 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098190 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
1003098179_1003098192 -9 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098192 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
1003098179_1003098197 7 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098197 6:3157898-3157920 ACCGGGGGCCCCGGAACCAGGGG No data
1003098179_1003098200 11 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098200 6:3157902-3157924 GGGGCCCCGGAACCAGGGGGAGG No data
1003098179_1003098202 13 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098202 6:3157904-3157926 GGCCCCGGAACCAGGGGGAGGGG No data
1003098179_1003098194 -2 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098179_1003098195 5 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098179_1003098201 12 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG No data
1003098179_1003098208 28 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098208 6:3157919-3157941 GGGAGGGGCTGCCTCGGAACAGG No data
1003098179_1003098206 22 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098179 Original CRISPR CCCCCTCGGGGGTCCAGAGT GGG (reversed) Intergenic
No off target data available for this crispr