ID: 1003098189

View in Genome Browser
Species Human (GRCh38)
Location 6:3157881-3157903
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098189_1003098202 0 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098202 6:3157904-3157926 GGCCCCGGAACCAGGGGGAGGGG No data
1003098189_1003098206 9 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098189_1003098197 -6 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098197 6:3157898-3157920 ACCGGGGGCCCCGGAACCAGGGG No data
1003098189_1003098208 15 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098208 6:3157919-3157941 GGGAGGGGCTGCCTCGGAACAGG No data
1003098189_1003098201 -1 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG No data
1003098189_1003098195 -8 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098189_1003098199 -5 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098199 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
1003098189_1003098196 -7 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098196 6:3157897-3157919 GACCGGGGGCCCCGGAACCAGGG No data
1003098189_1003098200 -2 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098200 6:3157902-3157924 GGGGCCCCGGAACCAGGGGGAGG No data
1003098189_1003098209 16 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098189 Original CRISPR CCCGGTCCCCAGCCCCCCTC GGG (reversed) Intergenic
No off target data available for this crispr