ID: 1003098194

View in Genome Browser
Species Human (GRCh38)
Location 6:3157889-3157911
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098173_1003098194 7 Left 1003098173 6:3157859-3157881 CCCGAGCCGCCCACTCTGGACCC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098172_1003098194 8 Left 1003098172 6:3157858-3157880 CCCCGAGCCGCCCACTCTGGACC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098179_1003098194 -2 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098181_1003098194 -3 Left 1003098181 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098168_1003098194 13 Left 1003098168 6:3157853-3157875 CCCCACCCCGAGCCGCCCACTCT No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098174_1003098194 6 Left 1003098174 6:3157860-3157882 CCGAGCCGCCCACTCTGGACCCC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098175_1003098194 1 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098170_1003098194 11 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098169_1003098194 12 Left 1003098169 6:3157854-3157876 CCCACCCCGAGCCGCCCACTCTG No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098167_1003098194 20 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data
1003098166_1003098194 29 Left 1003098166 6:3157837-3157859 CCGCTCACGCCGCGATCCCCACC No data
Right 1003098194 6:3157889-3157911 GGGCTGGGGACCGGGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098194 Original CRISPR GGGCTGGGGACCGGGGGCCC CGG Intergenic