ID: 1003098195

View in Genome Browser
Species Human (GRCh38)
Location 6:3157896-3157918
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098191_1003098195 -9 Left 1003098191 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098175_1003098195 8 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098167_1003098195 27 Left 1003098167 6:3157846-3157868 CCGCGATCCCCACCCCGAGCCGC No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098189_1003098195 -8 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098168_1003098195 20 Left 1003098168 6:3157853-3157875 CCCCACCCCGAGCCGCCCACTCT No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098179_1003098195 5 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098181_1003098195 4 Left 1003098181 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098186_1003098195 -6 Left 1003098186 6:3157879-3157901 CCCCCGAGGGGGGCTGGGGACCG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098173_1003098195 14 Left 1003098173 6:3157859-3157881 CCCGAGCCGCCCACTCTGGACCC No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098172_1003098195 15 Left 1003098172 6:3157858-3157880 CCCCGAGCCGCCCACTCTGGACC No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098174_1003098195 13 Left 1003098174 6:3157860-3157882 CCGAGCCGCCCACTCTGGACCCC No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098187_1003098195 -7 Left 1003098187 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098170_1003098195 18 Left 1003098170 6:3157855-3157877 CCACCCCGAGCCGCCCACTCTGG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data
1003098169_1003098195 19 Left 1003098169 6:3157854-3157876 CCCACCCCGAGCCGCCCACTCTG No data
Right 1003098195 6:3157896-3157918 GGACCGGGGGCCCCGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098195 Original CRISPR GGACCGGGGGCCCCGGAACC AGG Intergenic
No off target data available for this crispr