ID: 1003098198

View in Genome Browser
Species Human (GRCh38)
Location 6:3157899-3157921
Sequence CCCCCTGGTTCCGGGGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098198_1003098211 14 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data
1003098198_1003098208 -3 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098208 6:3157919-3157941 GGGAGGGGCTGCCTCGGAACAGG No data
1003098198_1003098215 25 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098215 6:3157947-3157969 CGCCTCCTAAGGACGGGAAGAGG No data
1003098198_1003098213 19 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098213 6:3157941-3157963 GGTCCTCGCCTCCTAAGGACGGG No data
1003098198_1003098209 -2 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098198_1003098206 -9 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098198_1003098212 18 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098212 6:3157940-3157962 GGGTCCTCGCCTCCTAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098198 Original CRISPR CCCCCTGGTTCCGGGGCCCC CGG (reversed) Intergenic
No off target data available for this crispr