ID: 1003098203

View in Genome Browser
Species Human (GRCh38)
Location 6:3157906-3157928
Sequence AGCCCCTCCCCCTGGTTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098203_1003098211 7 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data
1003098203_1003098208 -10 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098208 6:3157919-3157941 GGGAGGGGCTGCCTCGGAACAGG No data
1003098203_1003098209 -9 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098203_1003098213 12 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098213 6:3157941-3157963 GGTCCTCGCCTCCTAAGGACGGG No data
1003098203_1003098215 18 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098215 6:3157947-3157969 CGCCTCCTAAGGACGGGAAGAGG No data
1003098203_1003098212 11 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098212 6:3157940-3157962 GGGTCCTCGCCTCCTAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098203 Original CRISPR AGCCCCTCCCCCTGGTTCCG GGG (reversed) Intergenic
No off target data available for this crispr