ID: 1003098206

View in Genome Browser
Species Human (GRCh38)
Location 6:3157913-3157935
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098179_1003098206 22 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098191_1003098206 8 Left 1003098191 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098189_1003098206 9 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098175_1003098206 25 Left 1003098175 6:3157865-3157887 CCGCCCACTCTGGACCCCCGAGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098174_1003098206 30 Left 1003098174 6:3157860-3157882 CCGAGCCGCCCACTCTGGACCCC No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098186_1003098206 11 Left 1003098186 6:3157879-3157901 CCCCCGAGGGGGGCTGGGGACCG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098198_1003098206 -9 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098187_1003098206 10 Left 1003098187 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data
1003098181_1003098206 21 Left 1003098181 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
Right 1003098206 6:3157913-3157935 ACCAGGGGGAGGGGCTGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098206 Original CRISPR ACCAGGGGGAGGGGCTGCCT CGG Intergenic
No off target data available for this crispr