ID: 1003098209

View in Genome Browser
Species Human (GRCh38)
Location 6:3157920-3157942
Sequence GGAGGGGCTGCCTCGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098187_1003098209 17 Left 1003098187 6:3157880-3157902 CCCCGAGGGGGGCTGGGGACCGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098203_1003098209 -9 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098181_1003098209 28 Left 1003098181 6:3157869-3157891 CCACTCTGGACCCCCGAGGGGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098204_1003098209 -10 Left 1003098204 6:3157907-3157929 CCCGGAACCAGGGGGAGGGGCTG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098179_1003098209 29 Left 1003098179 6:3157868-3157890 CCCACTCTGGACCCCCGAGGGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098198_1003098209 -2 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098189_1003098209 16 Left 1003098189 6:3157881-3157903 CCCGAGGGGGGCTGGGGACCGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098191_1003098209 15 Left 1003098191 6:3157882-3157904 CCGAGGGGGGCTGGGGACCGGGG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data
1003098186_1003098209 18 Left 1003098186 6:3157879-3157901 CCCCCGAGGGGGGCTGGGGACCG No data
Right 1003098209 6:3157920-3157942 GGAGGGGCTGCCTCGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098209 Original CRISPR GGAGGGGCTGCCTCGGAACA GGG Intergenic
No off target data available for this crispr