ID: 1003098211

View in Genome Browser
Species Human (GRCh38)
Location 6:3157936-3157958
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003098207_1003098211 -1 Left 1003098207 6:3157914-3157936 CCAGGGGGAGGGGCTGCCTCGGA No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data
1003098204_1003098211 6 Left 1003098204 6:3157907-3157929 CCCGGAACCAGGGGGAGGGGCTG No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data
1003098205_1003098211 5 Left 1003098205 6:3157908-3157930 CCGGAACCAGGGGGAGGGGCTGC No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data
1003098203_1003098211 7 Left 1003098203 6:3157906-3157928 CCCCGGAACCAGGGGGAGGGGCT No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data
1003098198_1003098211 14 Left 1003098198 6:3157899-3157921 CCGGGGGCCCCGGAACCAGGGGG No data
Right 1003098211 6:3157936-3157958 AACAGGGTCCTCGCCTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003098211 Original CRISPR AACAGGGTCCTCGCCTCCTA AGG Intergenic
No off target data available for this crispr