ID: 1003105298

View in Genome Browser
Species Human (GRCh38)
Location 6:3210691-3210713
Sequence TAGCTCAGCCTCCTACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003105298_1003105300 -6 Left 1003105298 6:3210691-3210713 CCAGTCTGTAGGAGGCTGAGCTA No data
Right 1003105300 6:3210708-3210730 GAGCTAGGATAAGAATCCTGTGG No data
1003105298_1003105303 17 Left 1003105298 6:3210691-3210713 CCAGTCTGTAGGAGGCTGAGCTA No data
Right 1003105303 6:3210731-3210753 CTTGGAAGTCCTTTGCTTCCAGG No data
1003105298_1003105301 -1 Left 1003105298 6:3210691-3210713 CCAGTCTGTAGGAGGCTGAGCTA No data
Right 1003105301 6:3210713-3210735 AGGATAAGAATCCTGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003105298 Original CRISPR TAGCTCAGCCTCCTACAGAC TGG (reversed) Intergenic
No off target data available for this crispr