ID: 1003106459

View in Genome Browser
Species Human (GRCh38)
Location 6:3220296-3220318
Sequence CGGGCCTCCCTATGTTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003106455_1003106459 21 Left 1003106455 6:3220252-3220274 CCACACCTGGTGAATTTTTTTAA 0: 3
1: 7
2: 230
3: 2889
4: 35874
Right 1003106459 6:3220296-3220318 CGGGCCTCCCTATGTTATCCAGG No data
1003106456_1003106459 16 Left 1003106456 6:3220257-3220279 CCTGGTGAATTTTTTTAAAAATT No data
Right 1003106459 6:3220296-3220318 CGGGCCTCCCTATGTTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003106459 Original CRISPR CGGGCCTCCCTATGTTATCC AGG Intergenic
No off target data available for this crispr