ID: 1003109611

View in Genome Browser
Species Human (GRCh38)
Location 6:3242528-3242550
Sequence CATAAGAAGGAGAAAGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003109611 Original CRISPR CATAAGAAGGAGAAAGGGTC AGG (reversed) Intronic
901757499 1:11450251-11450273 AAGAAGAAGGAGACAGGGACAGG + Intergenic
904066196 1:27753282-27753304 CACAAGAAGCAGGAAGGGTAGGG + Intronic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
906506202 1:46381666-46381688 TTTGAGAAGGAGAGAGGGTCTGG + Intergenic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
909961354 1:81847681-81847703 AATATTAGGGAGAAAGGGTCAGG - Intronic
910725691 1:90336320-90336342 CAGAAGAAGTAGGCAGGGTCAGG + Intergenic
911189797 1:94936405-94936427 CATGAGAAAGAGAAAGTGGCAGG - Intergenic
911697672 1:100910683-100910705 AAAAAGTAGAAGAAAGGGTCTGG - Intronic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
913667030 1:121058032-121058054 CAAAAGAAAGAGAAAGGGCCGGG + Intergenic
915555306 1:156657834-156657856 AAAAAGAAGGGGACAGGGTCGGG - Intronic
916685391 1:167140425-167140447 CATAGGTAGGAGAGAGGGTCAGG - Intergenic
917175128 1:172225428-172225450 CATTAGAAGGAGGGACGGTCGGG - Intronic
919415760 1:197306962-197306984 TATAAGAGGGAAAAATGGTCAGG - Intronic
919463654 1:197907945-197907967 CATAAGAAGCAGACAAGGTGTGG - Intergenic
920394863 1:205637557-205637579 CATAGGAAGAAAAAAGGGTCAGG - Intergenic
921049241 1:211499350-211499372 CATATGCAGAAGAAAGGGTTTGG + Intergenic
922798587 1:228353568-228353590 CAGGAGAAGGAGCAAGTGTCAGG + Intronic
922865785 1:228860512-228860534 CATAAACAGAAGAAAAGGTCGGG - Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923852178 1:237808363-237808385 CATAAAATGAAGAAAGGGCCGGG + Intronic
1063216289 10:3928976-3928998 CAGGAGAAGGAGAAAGGGAGGGG + Intergenic
1063985923 10:11501798-11501820 GAAAAGAAGGAGAAAGGGCAGGG - Intronic
1064708475 10:18097327-18097349 CATAACAAAGAGAAAGGATTTGG + Intergenic
1065655659 10:27946738-27946760 CATAAGAAGGAGGAGGTGTGTGG - Intronic
1066497545 10:35956788-35956810 CAGAAGAGGGAGAAAGGGAGGGG - Intergenic
1067587642 10:47485738-47485760 CATGAGAAGGAGAGAGGGCCAGG + Intergenic
1067634763 10:47993843-47993865 GAGAAGAAAGAGAGAGGGTCAGG + Intergenic
1067763566 10:49069023-49069045 GAAAAGAAGAAGAAAGGGTGGGG - Intronic
1068368746 10:56086615-56086637 CAAAAGGAGGAAAAATGGTCAGG + Intergenic
1068419504 10:56771645-56771667 AATAAGAATGAGGAAGGGGCAGG + Intergenic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1070239584 10:74665299-74665321 CATAAGAATGTGAAGGGTTCTGG + Intronic
1070841372 10:79490314-79490336 CACAAGATGGAGAAAGGGGAAGG + Intergenic
1071423013 10:85520244-85520266 CATCAGAAGAGGAAAGTGTCAGG - Intergenic
1071763892 10:88639963-88639985 CATAAGAAAGAGAAAGGAGAAGG + Intergenic
1072699651 10:97631636-97631658 CATAAAGAGGAAAAAGGGCCAGG + Intronic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1075763486 10:124874452-124874474 CATAAAGATCAGAAAGGGTCCGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1077021604 11:419491-419513 CATTCCCAGGAGAAAGGGTCTGG + Intronic
1079262006 11:18891499-18891521 CAGAAGAAGGAGGAAAGGTAAGG - Intergenic
1079795918 11:24802895-24802917 TAGAAGAAGGAGAAAGGATGAGG - Intronic
1080304347 11:30820427-30820449 CATAAAAAAGTGAAAGTGTCAGG - Intergenic
1080765961 11:35296951-35296973 AATAAGACAGAGAAAGGTTCTGG - Intronic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1083737366 11:64689113-64689135 CCTCAGAAAGAGAAAGGGTGGGG + Intronic
1086070837 11:82797310-82797332 GAGATGGAGGAGAAAGGGTCTGG - Intergenic
1088152329 11:106759636-106759658 TATAAAAAGGAGAAATGGCCAGG + Intronic
1089624089 11:119740397-119740419 GATCAGAAAGAGAAAGGGGCTGG - Intergenic
1089798956 11:121007804-121007826 TAACAGAAGGAGAAAGGGGCTGG + Intergenic
1090904059 11:131058358-131058380 CACAAGAAGGAGACAGAATCTGG - Intergenic
1091509394 12:1106871-1106893 GCTAAGAAGGAGAAAGATTCTGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092915831 12:13188305-13188327 CATGGGAAGGATAAAGGGTCTGG - Intergenic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093116614 12:15219901-15219923 CATAAGAAAGAGAAATTGTGTGG + Intronic
1093246975 12:16750831-16750853 CATAAGAAGGAGAAAAAGCAAGG - Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096231350 12:49898496-49898518 AAAAAGAATGAGCAAGGGTCAGG - Intronic
1096386478 12:51198101-51198123 CACAAGAAGGAGAGGGGGTTGGG + Intronic
1096408830 12:51362744-51362766 CATTAGAAGGAGAGAGGGAAAGG - Intronic
1096664631 12:53155078-53155100 CATAAAATAGAGACAGGGTCTGG - Intergenic
1096998437 12:55855432-55855454 AAAAAAAAGGAGACAGGGTCAGG - Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1097117494 12:56708438-56708460 CAAAAAAAGGAGAAAAGGCCAGG - Intergenic
1097316584 12:58177737-58177759 TATAAGAACAACAAAGGGTCAGG - Intergenic
1097740671 12:63238600-63238622 CAAAGGAGGGAGAAAGGGACTGG - Intergenic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1101256655 12:102984456-102984478 CAGGAGCAGGAGAAATGGTCTGG + Intergenic
1101851165 12:108403514-108403536 CAGAAGAAGGAAAAAAGGCCAGG - Intergenic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1103119647 12:118371235-118371257 CACAAGAAGTTGAAAGGGACAGG - Intronic
1103197025 12:119053137-119053159 CAAAAGAAGGAGCAGGTGTCAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1105892736 13:24693437-24693459 AATAAGAAAGAAAAAGAGTCAGG - Intronic
1106017793 13:25885449-25885471 CAAAAGAAGGAGAGAGGGCCAGG - Intronic
1107135640 13:36941032-36941054 CAAAAGACCGAGAAAGGGGCAGG - Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107469770 13:40681205-40681227 CATTAGAAGGAGAAAGTTTTTGG + Intergenic
1108026832 13:46186653-46186675 CATAAAAAGGAGTGAAGGTCAGG - Intronic
1108677001 13:52745718-52745740 CTTGAGAAGGAGAGAGAGTCAGG + Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1110230372 13:73161621-73161643 CATAAAAAGGAAACAAGGTCAGG - Intergenic
1110335302 13:74323289-74323311 AAAAAGAAGGAGAGAGGGTGGGG - Intergenic
1110342449 13:74408435-74408457 CATAAGCATGAGAAAGGCCCTGG - Intergenic
1111683025 13:91467301-91467323 CCACAGAGGGAGAAAGGGTCTGG + Intronic
1112493067 13:99884409-99884431 GCTAAGCAGGGGAAAGGGTCAGG - Intronic
1113190338 13:107738467-107738489 TAGAAGAATGAGAAAGTGTCTGG - Intronic
1113695378 13:112342400-112342422 CCTAAGAAGGAGACCGTGTCTGG + Intergenic
1115272697 14:31571748-31571770 CAAAAGATGAAGAAAGGGCCAGG - Intronic
1115506007 14:34094796-34094818 CATAAGAAACAGAAAAGGGCTGG + Intronic
1115917210 14:38329312-38329334 AAGAAGAAGGAGAAAGGATTTGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1117172751 14:53117350-53117372 CCCAGGAAGCAGAAAGGGTCAGG + Intronic
1117624143 14:57618417-57618439 CCCAAGAAGCAGAAGGGGTCGGG + Intronic
1117795029 14:59384091-59384113 GACAGGAAGGAAAAAGGGTCAGG - Intergenic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1120082540 14:80232050-80232072 CTTAAGAAGGAGAAATGGGTTGG - Intronic
1121931964 14:97980291-97980313 CATAAAGTGCAGAAAGGGTCAGG - Intergenic
1123458981 15:20451139-20451161 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1123659081 15:22549279-22549301 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124041506 15:26109788-26109810 CATAAGAAGAGGAAAGCGCCCGG - Intergenic
1124230917 15:27945508-27945530 CTCAGGAAGGAGGAAGGGTCCGG - Intronic
1124312945 15:28643771-28643793 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1124781303 15:32637751-32637773 CATCAGAAAGAGGAAGGGCCTGG + Exonic
1126673262 15:51135794-51135816 AATAGGGAGGAGAAAGGGACAGG - Intergenic
1127089418 15:55451948-55451970 CAAAAGAAGGAAAATAGGTCTGG + Intronic
1127402071 15:58598768-58598790 CATTGGAAGGAGAAAAGGACAGG - Intronic
1127601462 15:60541646-60541668 CATAAGGAGAAGAAATGCTCTGG + Intronic
1130669110 15:85894649-85894671 CTTAACTAGGAGAAAGAGTCAGG + Intergenic
1131817560 15:96236972-96236994 CAAAAGAAAGAGAAAGGATTCGG - Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1135199932 16:20428532-20428554 CAAAAGAGGGAGAACAGGTCAGG - Intronic
1136062523 16:27736523-27736545 CAGAAGAAGGAGCAAGGCTGTGG + Intronic
1136703408 16:32164418-32164440 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1136764291 16:32763181-32763203 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1136803807 16:33107205-33107227 TTTAAAAAGGAGAAAGGGGCTGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137744850 16:50812983-50813005 CATGCCAAGGAGAAAGGGACTGG - Intergenic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1138862377 16:60774308-60774330 CAAAAGAGGGAGAAAGCGGCCGG + Intergenic
1138999351 16:62490399-62490421 CAGAAGAAGAAGCAAGGCTCAGG - Intergenic
1139533038 16:67552794-67552816 CATTAGAAGAAGCAAGAGTCTGG + Intergenic
1140429220 16:74887386-74887408 CATGTGAAGGAGAAAGGATAAGG + Intronic
1141090230 16:81125128-81125150 CAAAAGAAGAAAAAAGGGCCAGG + Intergenic
1141258189 16:82423619-82423641 GATAAGAAAGAGAAGGCGTCAGG - Intergenic
1141363335 16:83418032-83418054 ATTAAAAAGGAGAAAGTGTCTGG - Intronic
1141760205 16:86023242-86023264 CACATGAAGGAGAAAGTCTCAGG + Intergenic
1203066648 16_KI270728v1_random:1025305-1025327 TTTAAAAAGGAGAAAGGGGCTGG - Intergenic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1143840796 17:9730222-9730244 CTTAAGAAGGAGAATGGGCTGGG + Intergenic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148005491 17:44425189-44425211 CAGAAGGATGAGAAAGGGACAGG + Intronic
1148169853 17:45509824-45509846 GATAGGAAGGAGAAAGGTTTTGG - Intergenic
1148279356 17:46335984-46336006 GATAGGAAGGAGAAAGGTTTTGG + Intronic
1148301573 17:46553839-46553861 GATAGGAAGGAGAAAGGTTTTGG + Intronic
1148365506 17:47052841-47052863 GATAGGAAGGAGAAAGGTTTTGG + Intergenic
1148443254 17:47722547-47722569 CCTTATAAGGAGAGAGGGTCAGG + Intergenic
1148806921 17:50268588-50268610 CCCAAGAATGAGAAAGGGGCTGG + Intergenic
1150290169 17:63976570-63976592 AATAATAAGAAGCAAGGGTCAGG + Intergenic
1150400934 17:64855422-64855444 GATAGGAAGGAGAAAGGTTTTGG - Intronic
1150677721 17:67259250-67259272 CAAAAGAAAGAAAGAGGGTCAGG + Intergenic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151410819 17:73927221-73927243 AAGAAGAAGGAGAGAGGGACGGG + Intergenic
1151558269 17:74858216-74858238 CACATGAAGGAATAAGGGTCTGG + Intronic
1153021891 18:636921-636943 TTTAAAAAGGAGAAAGGGGCTGG - Intronic
1153433744 18:5047077-5047099 CAGAAGGAGGAAAGAGGGTCAGG + Intergenic
1155226692 18:23735519-23735541 CTTATGAAGGAGAAGGGATCAGG - Intronic
1158605797 18:58895033-58895055 GAAAAGAAGGAGAATGGCTCAGG - Intronic
1159044824 18:63359313-63359335 CCTAAGAAGTAGAAATGATCAGG - Intronic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1159662389 18:71114739-71114761 CACAGGAAGGAAAAAGAGTCAGG + Intergenic
1160063551 18:75553304-75553326 CTTCAGAAGGAGAAAGGGATGGG + Intergenic
1160097599 18:75889701-75889723 CCAAAGAAGGAGAGAGGGTCAGG - Intergenic
1161084132 19:2326294-2326316 CACAAAAAGCAGAAAGGGTTTGG - Intronic
1162090402 19:8276052-8276074 CTTAAAAAGGAAAAAGGGTTGGG - Intronic
1162092635 19:8290885-8290907 CTTAAAAAGGAAAAAGGGTTGGG - Intronic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1164598208 19:29543986-29544008 CATTAGAAGCAGAATGGCTCTGG - Intronic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1165807642 19:38591027-38591049 CATAAGAAAGAGAAGAGGCCGGG + Intronic
1166301400 19:41913767-41913789 CATAAGAGGGGGAAAGGTGCGGG - Intronic
1166867908 19:45852186-45852208 TATGAGAGAGAGAAAGGGTCTGG + Intronic
1166937822 19:46345570-46345592 CATAAGAAGGTGACAGAGCCAGG - Intergenic
1167345146 19:48940842-48940864 CACAAAAAGGAGACAGGGTCTGG - Intronic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
924988385 2:289983-290005 CCTCAGGAGGAGAAAGTGTCCGG + Intergenic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927302101 2:21526896-21526918 CATAGGAAGCACAAGGGGTCAGG - Intergenic
927871624 2:26627771-26627793 CAAAATAATGAGAAAGGGTGAGG - Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929429826 2:41877835-41877857 CATTAAAATGAGAAAGGATCAGG + Intergenic
929715618 2:44306407-44306429 CACCAGACGGAGAAAGGCTCTGG - Intronic
930031000 2:47057949-47057971 CACAAGGAGGAGAAAGAGTGGGG - Intronic
930189386 2:48441672-48441694 CATAAACACGAGAAAGGGGCAGG - Intronic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
930916697 2:56700007-56700029 CAAAAGAAGAAGAAAAGATCAGG - Intergenic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
932911607 2:75811944-75811966 CAAAAAAAGGAGAAAAGGTAAGG - Intergenic
933627656 2:84619888-84619910 CACCAGAGGGAGAAAGGGTGAGG + Exonic
936147825 2:109993282-109993304 CATAAGAGGGAGAGAGGTACAGG + Intergenic
936196866 2:110378165-110378187 CATAAGAGGGAGAGAGGTACAGG - Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
938852075 2:135271465-135271487 CAAAGGAAGGAAAAAAGGTCAGG + Intronic
940262879 2:151801371-151801393 CATAAAAAGGACAAAAGGTGTGG + Exonic
941312338 2:163949861-163949883 TCTTAGAAGGAGAAAGGGTGTGG - Intergenic
942548178 2:177086502-177086524 CATAAGAAGAGGAAATGGTTGGG - Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
943004935 2:182377302-182377324 CAGGAGAAAGATAAAGGGTCAGG - Intronic
943626599 2:190208290-190208312 CGAAAGAGGGAGAAAGGGTAGGG + Intronic
944475890 2:200106044-200106066 CATAAGAATTAGAAAGGTTGAGG - Intergenic
944809956 2:203318285-203318307 CATAATAAAGAGAAAAGGCCGGG + Intergenic
946153416 2:217791287-217791309 AAAGAGAATGAGAAAGGGTCTGG - Intergenic
946334947 2:219030219-219030241 AAGCAGAAGGACAAAGGGTCAGG + Intronic
946439283 2:219681436-219681458 AATAAGAAGGAGATAGGGAACGG - Intergenic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
946740406 2:222795599-222795621 CATAAGAAAGAGAAAGAATGAGG - Intergenic
1169441000 20:5633835-5633857 CATAAAAAGTAGAAACTGTCTGG - Intergenic
1170428274 20:16256847-16256869 AATAGAAAGGAGAGAGGGTCTGG + Intergenic
1172165064 20:32893886-32893908 AATAAGAGGCAGAAAGGGTAAGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172453412 20:35045962-35045984 TATTAAAAGAAGAAAGGGTCAGG - Intronic
1173714157 20:45187766-45187788 CATAAGAAGGTGGAAGGGAAGGG - Intergenic
1173814073 20:45973762-45973784 ATTAATAAGGAGAAAAGGTCCGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1175168937 20:57066454-57066476 CTTAACAAGGAGAAAGGGTTTGG - Intergenic
1175200512 20:57273797-57273819 CAGAAGAAGGAGAAAAGGCAGGG - Intergenic
1178158375 21:29881691-29881713 CAGTAGAAGAAGAAAGGGACAGG - Intronic
1178164652 21:29959841-29959863 GCTAAGATGGAGAAAGGGTTTGG - Intergenic
1178554991 21:33582186-33582208 CATAAGAAGGAGACAGCATCTGG - Exonic
1180861872 22:19088018-19088040 AATAAGAAGCAGAGATGGTCTGG - Intronic
1182172152 22:28242211-28242233 CATTAGAAGGAGTAAAGGGCCGG - Intronic
1182334332 22:29573359-29573381 CATAAAAATGAGAAATGGGCCGG + Intronic
1182379828 22:29879054-29879076 CATAAGAAAGTGTAAAGGTCAGG - Intergenic
1182871863 22:33654602-33654624 CACAAGCAGGAGAGAGGGTCAGG + Intronic
1182970363 22:34568087-34568109 CTAAAGAAGGAGATAGGTTCAGG + Intergenic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183673510 22:39286952-39286974 CTTAAGAAGGAGAGAAGGTTTGG - Intergenic
1183772347 22:39938050-39938072 CATAAGAAGAAGGAAGTGGCTGG + Intronic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
949693395 3:6666719-6666741 CAAAAGCAGGAGAAAGGTACAGG - Intergenic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950842012 3:15976745-15976767 CATGTGAGGGAGACAGGGTCAGG - Intergenic
951025963 3:17830192-17830214 GACAAGAAGAAGAAATGGTCTGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
953631461 3:44621560-44621582 CAGCAGAAGGACCAAGGGTCGGG - Intronic
953708064 3:45246061-45246083 CCTAAGAAGGAAAATGGCTCCGG - Intergenic
954396973 3:50298179-50298201 CATAGGGAGAAGAAAGGGACAGG - Intronic
954727536 3:52626688-52626710 CGTGAGAAGGAGAAACGGTTAGG + Intronic
955645640 3:61134530-61134552 CAAAGGAAGGAGAAATGATCTGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
956268758 3:67427675-67427697 CCTGAGAAGCACAAAGGGTCAGG + Intronic
957030307 3:75233064-75233086 CAGAAGATGGAGATAAGGTCAGG + Intergenic
959921191 3:111870225-111870247 CATTGGAAGGAGAGAGGATCTGG + Intronic
960357719 3:116673970-116673992 TATAAAAAAGAGAAAGGGTTGGG + Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962966687 3:140361408-140361430 CATAAGATGGAGACAAGGTAAGG + Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965272348 3:166634802-166634824 CATACGAAAGAAAAAGGGGCTGG - Intergenic
965789792 3:172375094-172375116 CTTAAGAAGAGGAAAGGGTAGGG + Intronic
966524210 3:180903471-180903493 CAAAAAAAGGAAAAAGGGCCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967797548 3:193613866-193613888 CTTAAGAAGGAGGCAGGGTGTGG - Intronic
969543851 4:7811210-7811232 GAGATGAAGGGGAAAGGGTCGGG - Intronic
969695191 4:8730257-8730279 CATGAGAAGGAGCAGGGGTGGGG + Intergenic
970304002 4:14712093-14712115 GTTAAGTAAGAGAAAGGGTCTGG - Intergenic
970354239 4:15236407-15236429 CGTGAGAAGGGGAAAGGGGCTGG + Intergenic
970867220 4:20772928-20772950 AATAAGAAAGGGAAAGGGGCCGG - Intronic
970895756 4:21101976-21101998 CAAAAGAAGAGGACAGGGTCAGG + Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971611623 4:28732734-28732756 CCTAAGAAGGAGAAGAGGTTTGG - Intergenic
971902576 4:32681262-32681284 CACAAGAAGGAGCAAGGGTAGGG + Intergenic
972817274 4:42657522-42657544 CAGGCGAAGGCGAAAGGGTCTGG + Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
975071524 4:70145569-70145591 CCTAATAATGAAAAAGGGTCAGG + Intronic
975226957 4:71883826-71883848 CAAAAGAAAGAGAAAGGTACAGG - Intergenic
975905836 4:79210775-79210797 AAAAAGAAGAAGAAAGGCTCTGG + Intergenic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
978359958 4:107920957-107920979 CATTAGATGGAGAAAGGATTGGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
981332963 4:143533764-143533786 CCTAAGAATGGGCAAGGGTCGGG - Intronic
983464860 4:168074496-168074518 TAAAAGAATGAGAAAGGGTGGGG + Intergenic
983790704 4:171794032-171794054 CATAAGAAGCACAAAGTGACTGG + Intergenic
984438519 4:179734947-179734969 AAAAAGAAAAAGAAAGGGTCAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984691089 4:182726678-182726700 CCAAAGAAAGGGAAAGGGTCTGG + Intronic
985879835 5:2629944-2629966 TGTAAAAAGGAGAAAGGGCCAGG + Intergenic
986110271 5:4709513-4709535 CCTGAGAAGGACAAGGGGTCAGG + Intergenic
989192977 5:38689362-38689384 CATATCGAGGAGAAATGGTCTGG - Intergenic
989467650 5:41775623-41775645 TCTAGGAAGGAGAGAGGGTCTGG - Intronic
990151404 5:52822109-52822131 CATATAAAGGATAAAAGGTCAGG - Intronic
991223504 5:64242969-64242991 CCTGAGAAGCACAAAGGGTCAGG + Intronic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
992551506 5:77864913-77864935 CACAAGAAGGTGACAGGGTCAGG + Intronic
993238168 5:85343665-85343687 CATAAGCAGGTGATATGGTCTGG + Intergenic
993606713 5:90000040-90000062 CTTAGGAAGCAGAAAGGGTTGGG - Intergenic
993609690 5:90039145-90039167 CACAGGAAGAAGAAAGAGTCTGG + Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
995133232 5:108652815-108652837 TAAAAGAAGTAGAATGGGTCAGG - Intergenic
998113965 5:139522541-139522563 CATAAGAATAAGAAAGCATCTGG + Intergenic
998217814 5:140250521-140250543 CACAGGAAGGAGAAACTGTCTGG + Intronic
999039936 5:148397751-148397773 GGTAAGAGGGAGAAAGGGTCAGG - Intronic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1001235630 5:170026973-170026995 CATATGAATGGGAAAGTGTCAGG + Intronic
1001580547 5:172795214-172795236 CATCAAAAGAAGAAAGGTTCGGG - Intergenic
1001635310 5:173205956-173205978 CATAAAAAGGAGCAAGTGTCTGG + Intergenic
1001772140 5:174304570-174304592 TATAAGAAGAAGAGAGGGCCGGG - Intergenic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1002137559 5:177117225-177117247 TATCAGAAGGACACAGGGTCCGG - Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1005011613 6:21341182-21341204 GACAAGAAGAAGAAAGAGTCTGG + Intergenic
1005220089 6:23576497-23576519 AATAAGAAAGACACAGGGTCAGG - Intergenic
1006070770 6:31496660-31496682 AAAAAAAAGGAAAAAGGGTCCGG - Intronic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006207586 6:32361993-32362015 CATAAGAAGAGGAACGGGCCGGG + Intronic
1007015923 6:38466587-38466609 TTTAAGAAGGAAAAAGGGCCGGG - Intronic
1008048841 6:46879472-46879494 CAGGAGAGGGAGAGAGGGTCTGG - Intronic
1008567434 6:52783079-52783101 CATAGGATTGAGAAAGGGTGAGG + Intergenic
1008570867 6:52815396-52815418 CATAGGATTGAGAAAGGGTGAGG + Intergenic
1008816124 6:55568902-55568924 CACAGAAAGAAGAAAGGGTCAGG + Intronic
1009957002 6:70467694-70467716 GAAAAGAAGGAGAAAGGGAGTGG - Intronic
1011137481 6:84115839-84115861 CCCAAGAAGCACAAAGGGTCAGG - Intergenic
1011149723 6:84257692-84257714 CATTATAAGGAGATAGGATCAGG - Intergenic
1013418545 6:109946056-109946078 CATAAGTAGGAAAAAGACTCAGG + Intergenic
1013680589 6:112521457-112521479 CCCAAGGAGGAGAAAGGGGCTGG - Intergenic
1014401762 6:120998465-120998487 TATAAGAATGGGAAAGGGGCCGG - Intergenic
1015004929 6:128268173-128268195 CATGAGAATGGGAAAGGTTCAGG - Intronic
1015339419 6:132080706-132080728 CAGAAGATTGAGAAAGGGTTGGG - Intergenic
1016093776 6:140011456-140011478 CTTAAGTAGGAGAAAGTGTGTGG - Intergenic
1017683144 6:156884288-156884310 CATTAGAAGGAAAAAGGGAGAGG - Intronic
1018813912 6:167316982-167317004 GACTAGAAGGAGAAAGGGCCAGG - Intergenic
1019027519 6:168981152-168981174 AATAAGAGAGAGAAAGGGACAGG + Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1020957185 7:14754868-14754890 GATAGGAAGGAGAAAGGTTAGGG - Intronic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1022476315 7:30712816-30712838 TATAGGGAGGAGAAAGGTTCTGG - Intronic
1022965286 7:35466443-35466465 ATTAAGAAGGAGAAAAGGTGAGG + Intergenic
1023710239 7:42984931-42984953 GATAAGAAAGTGAAAGGGCCTGG - Intergenic
1023882068 7:44326241-44326263 CATGAGAAAGTGAAAGGGTGGGG + Intronic
1026220440 7:68391972-68391994 CAAAAGAAAGAGAAAAGGCCAGG + Intergenic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028826608 7:95280951-95280973 CAATAGAAGCAGAAAGGGTTTGG - Intronic
1029724505 7:102393396-102393418 CAAAAGAAGGAAAAAGGGAAAGG - Intronic
1029933477 7:104398284-104398306 CAAAAGTAGGAGGAAGGGACAGG + Intronic
1030268275 7:107643165-107643187 GATTGGAAGGAGAGAGGGTCTGG - Intergenic
1032906836 7:136377891-136377913 CATAAGAGGAAGAAAGGGCAAGG + Intergenic
1034347445 7:150396314-150396336 CAAAAGAAGAAAAAAGAGTCGGG - Intronic
1034861069 7:154595253-154595275 CATAAGGGGAAGAAAGGGTAAGG - Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1035686799 8:1529387-1529409 CATAAGAAGGTGATATGGCCAGG - Intronic
1035865370 8:3076222-3076244 CACACAAAGGAGATAGGGTCAGG - Intronic
1037554727 8:20011170-20011192 ACTAAGAAGGATAAAGGGTAGGG + Intergenic
1038194521 8:25354627-25354649 CATAAGAAGGAAAAAAAGTGAGG + Intronic
1040957663 8:52995960-52995982 CAAAAGAAAGAGAAAGGGCCTGG - Intergenic
1041405244 8:57491750-57491772 CCTAAGAAGGAAAGAGGTTCCGG - Intergenic
1041620413 8:59961052-59961074 AATAAGAAGGAACAGGGGTCAGG - Intergenic
1041945194 8:63433066-63433088 GATAAGGAGGAGATAGGGCCTGG + Intergenic
1043091702 8:75912735-75912757 AAGAAGAAAGAGGAAGGGTCTGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044721333 8:95151439-95151461 CATAAGAAGGGGTAAGGATAGGG - Intronic
1045182320 8:99797638-99797660 CATAAGGAGGCCAAAGGGGCAGG - Intronic
1045326589 8:101121949-101121971 AATAAGAAGGAGAAATGAGCTGG - Intergenic
1045462704 8:102440208-102440230 GAAAAGCAGGAGAAAGGGCCTGG - Intergenic
1046133765 8:109999496-109999518 CATAAGGAGGAGAAATAGTGGGG + Intergenic
1046281376 8:112037011-112037033 CATATGAAGAGGAAAGGGACAGG - Intergenic
1046888290 8:119393439-119393461 CATAAGATGCAGAAAGGGCCAGG + Intergenic
1046930417 8:119836409-119836431 TATAAGAAGGAGAAAGGAGAAGG + Intronic
1047357904 8:124140760-124140782 CACAGGAAGGAGGAAGGGCCAGG + Intergenic
1047706373 8:127503662-127503684 CCTAAGAAGGAGGAAGGGAGTGG + Intergenic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048418841 8:134257011-134257033 TATAAGAAGGAGGCAGGGTCAGG - Intergenic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1048879992 8:138864194-138864216 CTTTAGAAGGAGAATGGGCCAGG - Intronic
1049077361 8:140409784-140409806 AATAAGAAGAAGAAAAGGCCAGG + Intronic
1049085454 8:140474889-140474911 CATAAGATGGAGGAGGGGGCTGG + Intergenic
1049293565 8:141817501-141817523 GAGATGAAGGAGAAAGGGTGGGG - Intergenic
1050935910 9:11394091-11394113 CATAAGAAGGCTAGTGGGTCTGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051731320 9:20146244-20146266 CATCAGAAGCAGAGAGAGTCTGG + Intergenic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1052179504 9:25506677-25506699 AAGAAGAAAGAGAAAGGGTGGGG + Intergenic
1052313798 9:27095977-27095999 TATAAGAGTGAGAAAGGGTGTGG - Intergenic
1053190538 9:36062771-36062793 CAAAAGTAGGAGATAGGGCCAGG - Intronic
1055728586 9:79257863-79257885 AATACGAAAGAGAGAGGGTCGGG - Intergenic
1056071648 9:82993236-82993258 AATAAGAAGGTATAAGGGTCAGG + Intronic
1056194290 9:84214443-84214465 CACAAGAAGTAAAAAGGATCTGG - Intergenic
1057919406 9:99084575-99084597 CTTAAAAAGGAGAAATGGTCCGG + Intergenic
1058443506 9:105032023-105032045 TATAAGAAAGAGAAATGGCCGGG + Intergenic
1059343610 9:113613448-113613470 CATGAGGAGGAGGAAGGGTGTGG + Intergenic
1061889939 9:133613552-133613574 CAAGAGAAGGTGAGAGGGTCGGG + Intergenic
1062309153 9:135926653-135926675 CAGCTGAAGGAGAGAGGGTCCGG - Intergenic
1186176551 X:6931103-6931125 CCCAAGAAAGAGAAAGGTTCTGG + Intergenic
1186183780 X:6998902-6998924 AATAAGTAGGAGAAAGGGAGAGG + Intergenic
1188101840 X:26097492-26097514 CATAAAAAGTAGAAAGGGGTGGG + Intergenic
1188802008 X:34543911-34543933 TATAAGAAGAAGAAACGGGCCGG + Intergenic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1189384153 X:40523587-40523609 CAGAAGAAGGTCACAGGGTCAGG - Intergenic
1189512975 X:41682255-41682277 AAAAAGAAGGTGAAGGGGTCAGG + Intronic
1190227410 X:48556931-48556953 AAAAAGAAAGAGAAACGGTCAGG + Intronic
1192784970 X:74326292-74326314 GATAAGAAACAGAAAGGGGCTGG - Intergenic
1194864546 X:99049545-99049567 CATGAGCAGGAGAAAGGGAAGGG + Intergenic
1196348688 X:114700553-114700575 CTTAAGAATGAAAAAAGGTCTGG + Intronic
1196517315 X:116628760-116628782 CAAAAGAATGAGACAGGGACAGG + Intergenic
1197791250 X:130256226-130256248 CTTAAGAAGGAGAATGGCACAGG + Intronic
1199990081 X:152982676-152982698 CATGAGGAGGGGATAGGGTCTGG + Intergenic
1201412742 Y:13716981-13717003 GATAAGAAGGAGAAAGAGAATGG + Intergenic