ID: 1003109746

View in Genome Browser
Species Human (GRCh38)
Location 6:3243563-3243585
Sequence AATTCCCTATAGTAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003109746 Original CRISPR AATTCCCTATAGTAGTTGGA GGG (reversed) Intronic
906143546 1:43547227-43547249 AATTCCCAGTAGTAATTGGTAGG + Intronic
908343928 1:63211775-63211797 CATTTTCCATAGTAGTTGGATGG - Intergenic
914979815 1:152404214-152404236 AAGTCCCTACAGGAGATGGAGGG + Intergenic
916305634 1:163327519-163327541 AATTCCATATACTATTTGTAAGG - Exonic
918733895 1:188034154-188034176 AATTCACTAGAGTAGTTCTATGG + Intergenic
919557135 1:199072171-199072193 AATTGTCTATAGTAGTTGCCTGG + Intergenic
919630407 1:199955069-199955091 AATTCCCTATATTATTTGCTTGG + Intergenic
924221256 1:241877495-241877517 AAATCCCTAGATTAGTTGTATGG - Intronic
1066472313 10:35711174-35711196 AATTCCATAAACTAGATGGAGGG - Intergenic
1072636417 10:97181340-97181362 AATTCCAAATAATAATTGGATGG - Intronic
1074156958 10:110807795-110807817 AATTCCCCATGGGAGTTGGATGG - Intronic
1074167249 10:110893315-110893337 AATATCTTATAGAAGTTGGAAGG + Intronic
1075341085 10:121647333-121647355 AATTCCAAGTAGTATTTGGATGG - Intergenic
1078884181 11:15483515-15483537 AATCCCCTATAGAAGTAGGGAGG + Intergenic
1085375605 11:76058175-76058197 AATTTACTATAGTTGTTGTAGGG + Intronic
1085697960 11:78721785-78721807 CATTCCCTAAAGGAGTTGGGAGG + Intronic
1088008131 11:104966867-104966889 ATTTCCATATTGTAGTTGAAGGG - Intronic
1088139317 11:106596377-106596399 AATTCCCTTGTGTTGTTGGAGGG + Intergenic
1091270247 11:134305864-134305886 AATTAAATATAGAAGTTGGAAGG + Intronic
1094109167 12:26842931-26842953 AATTCGCTACAGTTGATGGAAGG - Intergenic
1095585488 12:43844821-43844843 AATACCCTAGAGGAGTTGGCTGG + Exonic
1096361278 12:50989590-50989612 AATTCACTATAGAAGTTAGGGGG - Intronic
1096952948 12:55494216-55494238 AATTACCTATAGCAATAGGAAGG + Intergenic
1099819360 12:87690434-87690456 AATTCCCTCGAGTTGTGGGAGGG - Intergenic
1106405633 13:29470592-29470614 AAATCCCTCTGGTAGTTGCATGG - Intronic
1107672920 13:42765058-42765080 AATTGCCTATAGATTTTGGAAGG + Intergenic
1109706151 13:66095092-66095114 AATTCTCTCTAGTCTTTGGAAGG + Intergenic
1110463714 13:75777540-75777562 AATTCTCTGTAGGATTTGGAAGG + Intronic
1112966471 13:105202601-105202623 AATTCCCTCTAGTGGCTTGATGG + Intergenic
1118683333 14:68265854-68265876 AATTCACTCTAGTAGATGGTTGG + Intronic
1119128593 14:72151250-72151272 AATCCCCTATTGTCGTAGGAAGG - Intronic
1119142815 14:72283403-72283425 AATTCCCACAAGTAGTGGGAGGG + Intronic
1129180305 15:73869988-73870010 AATCCCCTAACCTAGTTGGAGGG - Intergenic
1129794293 15:78364257-78364279 AACTCCATATAGAAGATGGATGG - Intergenic
1131341183 15:91602609-91602631 AATTCCATAGAGAAGTGGGATGG - Intergenic
1134741651 16:16552371-16552393 AAGTCCTTACAGTATTTGGAAGG - Intergenic
1134925912 16:18160061-18160083 AAGTCCTTATAGTATTTGGAAGG + Intergenic
1137258459 16:46798902-46798924 AATACCCTTTAGTAGATTGAGGG - Intronic
1139130712 16:64141009-64141031 GATGCCCTATAATAGGTGGATGG + Intergenic
1139736142 16:68990485-68990507 AATTCCCAATTGTTGTGGGATGG - Intronic
1142875809 17:2851732-2851754 AATTCCCTGTTGTAGTTGTTTGG + Intronic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1155711691 18:28888254-28888276 AATCCCATGTAGTAGTTAGAAGG + Intergenic
927351444 2:22122169-22122191 AATTCAGTATAGCAGTTGTAAGG + Intergenic
941471295 2:165891126-165891148 AATTCCCTATAGAGGCTGTATGG + Intronic
941519428 2:166520880-166520902 AGTTCCACATAGCAGTTGGAAGG + Intergenic
941739494 2:169018425-169018447 ATTTTCCTCTAGTTGTTGGATGG + Intronic
943245863 2:185450569-185450591 AATTCCCTTGAGTTGTGGGAGGG - Intergenic
943327871 2:186523270-186523292 AATTCCATATAGTAATTTTAAGG + Intergenic
943459187 2:188149021-188149043 AATTGCTTATAGTAGATGTAAGG - Intergenic
944040514 2:195349089-195349111 AATTCCATAGAGCAGTTTGAAGG - Intergenic
947933988 2:233987721-233987743 AATTCCCTCAAGTTGTGGGAGGG + Intronic
1173663357 20:44749361-44749383 GATTCCCTATAGTAGTTGAAGGG + Intronic
951273623 3:20658276-20658298 ATTTCCCTTCAGTAATTGGAAGG + Intergenic
951942915 3:28101360-28101382 AATGGCCTATAGCATTTGGAAGG + Intergenic
953520937 3:43642675-43642697 AATTACCTATAGGAGGTGGGGGG - Intronic
953717961 3:45332209-45332231 CTTTCCCTTTAGTACTTGGAAGG - Intergenic
957838034 3:85624908-85624930 AAGTCCATATAGTAGATTGAAGG + Intronic
963541634 3:146598107-146598129 GATTCTCAATAGTAATTGGATGG + Intronic
965238000 3:166152690-166152712 AAATCACTTTAGTAGCTGGAGGG - Intergenic
965488482 3:169307771-169307793 GGTTCCCTATAGGAGTGGGAGGG - Intronic
969505382 4:7583515-7583537 AATTCCCTCAAGTTGTGGGAGGG + Intronic
975203898 4:71622991-71623013 AATCCCCTATTGTTGTGGGAGGG - Intergenic
975567787 4:75777933-75777955 AATGTCCTTTAGTAGTTGAATGG + Intronic
977330055 4:95626267-95626289 ATATCCCTATAATAATTGGAAGG - Intergenic
978177681 4:105753983-105754005 AAATGCTTATAGGAGTTGGAGGG + Intronic
980531031 4:134054779-134054801 GATACCCTATATGAGTTGGAAGG - Intergenic
981863025 4:149379877-149379899 AATTCCCTTGAGTTGTGGGAGGG + Intergenic
983112725 4:163772903-163772925 AAATCCCTGTAGTATATGGAAGG + Intronic
986314812 5:6579573-6579595 AATTCCCAAGAGTTGTGGGAGGG - Intergenic
987984136 5:25124227-25124249 AATTCCCTAGTGTTGTTGGAGGG + Intergenic
988037310 5:25843929-25843951 AATTCCCTCGTGTAGTGGGAGGG - Intergenic
989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG + Intronic
990047283 5:51448761-51448783 AATTGACTATAGTATTTGCAGGG - Intergenic
995237372 5:109844638-109844660 ATTTCCCTATAGCTTTTGGAGGG - Intronic
995478997 5:112576653-112576675 AATTTCCTGTAAGAGTTGGAAGG - Intergenic
996485403 5:124027662-124027684 CATGCCCTATATTAGTTGGCTGG - Intergenic
998486239 5:142504984-142505006 AATTCCCTTTATAAATTGGAGGG + Intergenic
1000139166 5:158384633-158384655 AAATCACAATAGTAGGTGGAAGG + Intergenic
1000399141 5:160806905-160806927 ATTTCCCTACAGTAACTGGAGGG - Intronic
1001550946 5:172602016-172602038 AATTCCCTATATTCCATGGAAGG - Intergenic
1003109746 6:3243563-3243585 AATTCCCTATAGTAGTTGGAGGG - Intronic
1004814645 6:19299908-19299930 AATTCCCTACAGTATTAGGTAGG + Intergenic
1004891859 6:20108588-20108610 AATTCCCTATAGCCGATGGAGGG - Intronic
1004963452 6:20820114-20820136 AATTCTCTAAAGTAAGTGGAGGG + Intronic
1005890765 6:30135992-30136014 AATTACCTAGGGTAGCTGGAAGG - Intergenic
1006223993 6:32520965-32520987 AATTCCCTATTGTATTTGGTAGG - Intronic
1006227998 6:32557013-32557035 AATTCCCTATTGTATTTGGTAGG - Intronic
1006230584 6:32583160-32583182 AATTCCCTATTGTATTTGGTAGG - Intronic
1008447008 6:51604043-51604065 ATTTGCCTACAGTAGGTGGAGGG + Intergenic
1009295333 6:61940420-61940442 AGTTCCCTATGTTAGTTGTAGGG - Intronic
1009932266 6:70190427-70190449 GATTCCCCATAGTAGGTGGGAGG - Intronic
1010046481 6:71449759-71449781 AATTCCATAAAGTAGTTCTAGGG - Intergenic
1012463136 6:99486451-99486473 ACTTCCCTTTAGTAGTTTTAAGG + Intronic
1013965883 6:115954720-115954742 AATTCTCTAAAGTACTTGAAAGG - Intronic
1014283476 6:119467318-119467340 AATTCCCAAGTGTAGTGGGAGGG - Intergenic
1021853536 7:24831875-24831897 AATTCTCTAGAGCAGCTGGATGG + Intronic
1021951560 7:25779876-25779898 AATTCCCTATCTTAGAGGGAAGG + Intergenic
1022419682 7:30208866-30208888 AAATGCCTATAGGAGTTGGTAGG - Intergenic
1031018103 7:116597352-116597374 AGTTTCCTATGGAAGTTGGAGGG + Intergenic
1032273701 7:130435832-130435854 AATGTCCTATACTAGTTGAATGG + Intronic
1035718869 8:1775739-1775761 AATCCTCTACAGTAGCTGGAAGG - Intronic
1036512366 8:9412598-9412620 ATTTCCCATTAGTATTTGGAGGG - Intergenic
1039986985 8:42455902-42455924 AATTACCAAGAGTAGTTGGGAGG + Intronic
1041548298 8:59071624-59071646 AATGCCCTATAGTATTAGGATGG + Intronic
1042170818 8:65989368-65989390 AAAGGCCTACAGTAGTTGGAAGG + Intergenic
1042567317 8:70125066-70125088 GATTCCCCTTAGTAGTTAGATGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1048107658 8:131428693-131428715 AATTCCCTCTTGTTGTGGGAGGG - Intergenic
1056473024 9:86924412-86924434 AATCCCCTGTATTAGTTGGCTGG + Intergenic
1059965723 9:119611606-119611628 AATTCCCCATAATAGTAGAATGG + Intergenic
1060094997 9:120780819-120780841 AATTCAGTATAGTAGCTGGCAGG + Intronic
1187757099 X:22539964-22539986 AATTCCTTATAGCTGTAGGATGG - Intergenic
1193233983 X:79084134-79084156 AGTTGCCTAAAGTAGTTGCAAGG + Intergenic
1193449045 X:81644209-81644231 AATTCCCTCATGTAGTTGGAGGG + Intergenic
1193449311 X:81646124-81646146 AATTCCCTTAAGTTGTGGGAGGG + Intergenic
1197626078 X:128803950-128803972 AATATCCTATTGGAGTTGGATGG + Intergenic