ID: 1003110910

View in Genome Browser
Species Human (GRCh38)
Location 6:3251490-3251512
Sequence CTGCAATTGCAGATGAAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003110910_1003110912 18 Left 1003110910 6:3251490-3251512 CCGTGCTTCATCTGCAATTGCAG 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1003110912 6:3251531-3251553 GTCCTGCCCGAGTGATCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003110910 Original CRISPR CTGCAATTGCAGATGAAGCA CGG (reversed) Intronic
902737487 1:18410769-18410791 GGGCAACTGCAGATGAAGAAAGG - Intergenic
905439759 1:37987668-37987690 CTGAAATTGCAGATTACGAAAGG - Exonic
906546937 1:46626537-46626559 CTGCCATGGCAGATGTAGAAGGG + Intergenic
911666543 1:100559283-100559305 CTTTATTTGCAGATGAAGCCTGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912882449 1:113429745-113429767 CTGCAACTGCAGAAAAAGTAGGG + Intronic
913181231 1:116324026-116324048 CTGGCATTGCAGCTCAAGCAGGG - Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
916423242 1:164656010-164656032 CTTCAATTGCAGGTGGAGAATGG + Intronic
917103195 1:171466288-171466310 GTGCAATTGCTGCTGAGGCAAGG - Intergenic
917293024 1:173491007-173491029 TTGGCATTGCAGATCAAGCAGGG - Intergenic
918394515 1:184100053-184100075 AAGCAATTACAAATGAAGCAGGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920631685 1:207659069-207659091 CTGCAATTGTAGCTGGAGCTGGG - Intronic
1063579161 10:7290165-7290187 CTGCAATTTCAGGTGGAGGAAGG + Intronic
1063912763 10:10848996-10849018 TTGCAATTTCAGAAGAAGGACGG - Intergenic
1065252341 10:23828315-23828337 CAGCAATAGCAGATGGAGTAGGG + Intronic
1065598861 10:27347998-27348020 TTGCACTTGCAGATGCAGAACGG + Intergenic
1066554146 10:36592827-36592849 ATGCAATAGAAGAGGAAGCAGGG + Intergenic
1067283503 10:44890876-44890898 CAGCAATTGCAGGTTCAGCAAGG + Intergenic
1068428736 10:56904543-56904565 CTCCACATGCAGATGAATCAGGG + Intergenic
1069072949 10:64008877-64008899 CTGGCATTGCAGATCAAGTAGGG - Intergenic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1070564891 10:77596188-77596210 CTCGAATTGCCGAAGAAGCAGGG + Intronic
1074919852 10:117996627-117996649 CTGCAATTCCAAGTGAAGAATGG + Intergenic
1075066296 10:119291227-119291249 CTGCCATTGGAGGTGAAGCAGGG + Intronic
1076600071 10:131651671-131651693 TTGCTAATGCAGATGAAGGAGGG - Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1080566663 11:33515906-33515928 ATTCAATTTCAGATGAAGCTAGG - Intergenic
1080981122 11:37407508-37407530 CTGTAATAGAAGATGAAACATGG + Intergenic
1081149572 11:39610271-39610293 GTGCAATTGCCTATGTAGCATGG + Intergenic
1082948371 11:58785271-58785293 CTGTAATAGAAGATGAAACATGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085835291 11:79949567-79949589 ATTGAATTGAAGATGAAGCAAGG - Intergenic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1086897188 11:92326760-92326782 CTCCAGTTTCTGATGAAGCAGGG - Intergenic
1087981391 11:104618342-104618364 CTGGAACTGCAGAGCAAGCATGG + Intergenic
1088126929 11:106437665-106437687 CTGCAACTGTACAAGAAGCATGG - Intergenic
1088680061 11:112232309-112232331 CTGGGATTGAAGATGAAGCAAGG + Intronic
1092057292 12:5518695-5518717 CTGGAATTGCAGACACAGCAGGG + Intronic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1097572801 12:61355388-61355410 CCGCACTTGCATATGGAGCATGG + Intergenic
1098045649 12:66397765-66397787 CTGAGAGTGGAGATGAAGCAAGG + Intronic
1098621462 12:72605595-72605617 ATGCTATTGCAGATGAAGTGTGG - Intronic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1101286969 12:103324802-103324824 CTGCAGTGGCAGATGATCCATGG + Intronic
1101869577 12:108553900-108553922 CTGGGATTGCACATGAGGCAGGG - Intronic
1104169227 12:126263750-126263772 CACCAATTGCAAATGAACCAAGG - Intergenic
1104218952 12:126763404-126763426 CTGCACCTGCAGGTGAGGCAAGG - Intergenic
1105594681 13:21826175-21826197 CTGTAATTCCACATGCAGCAAGG + Intergenic
1105669298 13:22594255-22594277 CTGCAATCCCACAGGAAGCAGGG + Intergenic
1106897693 13:34322561-34322583 CAGAAATAGCAGATGATGCAAGG + Intergenic
1107278288 13:38702947-38702969 CTTCAATAGCATATGAATCAAGG - Intronic
1109365322 13:61348282-61348304 CTGGCATTGAAGATGAAGGAAGG - Intergenic
1109573917 13:64228304-64228326 CTGTAATGGCAGATAAAGCATGG + Intergenic
1113012839 13:105790274-105790296 CTTCAATTGCAGAAGTACCATGG - Intergenic
1113731815 13:112647078-112647100 TTGCAATAGCAGATGAAGGCCGG - Exonic
1116168667 14:41369478-41369500 CTGTAATTTCAGAGCAAGCATGG + Intergenic
1116426894 14:44801455-44801477 CTGTAATGGTAGATGAAACATGG + Intergenic
1117228376 14:53687609-53687631 CTGAAATGGAAGATGAAACAAGG - Intergenic
1117238609 14:53804789-53804811 CTGCTATCACAGATAAAGCAAGG - Intergenic
1117993419 14:61457128-61457150 CAGAAATTGCAGCAGAAGCATGG - Intronic
1119090595 14:71777574-71777596 CTGAAAATGCCTATGAAGCAAGG + Intergenic
1122101559 14:99414475-99414497 CGGCAAATGCGGATCAAGCACGG + Intronic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1124688719 15:31804167-31804189 GTGCAATTTCAGTTGAAGAAAGG - Intronic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1128579475 15:68798760-68798782 CTGCAAGTGGAGAAGAGGCAGGG + Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1132028610 15:98422478-98422500 CTGCCATTGTAGGTGGAGCAGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1147332358 17:39706435-39706457 CTGGAGTTGCAGCTGAGGCATGG - Intronic
1148132592 17:45270956-45270978 CTGCGGTGGCAGATGGAGCAAGG - Intronic
1148858000 17:50589582-50589604 CTGGAATGGCAGATGAGACAGGG + Intronic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158274311 18:55749870-55749892 CTGTAAGTGCATATGAAGGAGGG - Intergenic
1158803801 18:60945593-60945615 CTGTGGTTGCAGATGAAACATGG + Intergenic
1159198393 18:65149057-65149079 TTGTAACTGGAGATGAAGCAGGG - Intergenic
1160128979 18:76207131-76207153 CTGAGATTGTAGATGAAGGAAGG + Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1166563680 19:43750221-43750243 CTGCAATTGATGAGGAAGGAGGG - Intronic
925860498 2:8170820-8170842 CTGCCAATGGAGAAGAAGCATGG - Intergenic
927151730 2:20200142-20200164 CTGCACCTGCTGATGGAGCAGGG - Intergenic
927477274 2:23423420-23423442 ATGCAAATGCAGACAAAGCAGGG - Intronic
935858661 2:107303111-107303133 CTGGAATTGCTGATGAAACCTGG + Intergenic
936663419 2:114567480-114567502 CTGATTTTGAAGATGAAGCAAGG + Intronic
937741078 2:125354868-125354890 CTGCAATTGCTAATGAAGTTGGG - Intergenic
938921315 2:135997705-135997727 TTGCAATTGCATAGCAAGCAAGG - Intergenic
939462432 2:142514104-142514126 CTGCCTTTGAAGATGAAGGAAGG - Intergenic
939535110 2:143417960-143417982 CTGCAACTGCTGATGGAGTAGGG + Intronic
939831760 2:147080873-147080895 CTTCAATGCCTGATGAAGCATGG + Intergenic
940071301 2:149691041-149691063 CTGGCTTTGAAGATGAAGCAAGG - Intergenic
940642143 2:156356285-156356307 CTGGAACTGAAAATGAAGCAAGG - Intergenic
940725151 2:157328544-157328566 CTGCAATTGTATTTGAAGTAAGG - Intergenic
940900981 2:159125968-159125990 CTGGCATTGAAGATGAAGGAAGG - Intronic
941707345 2:168673698-168673720 CTGCAATTACTGAAAAAGCAGGG - Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943336748 2:186624391-186624413 CAGCAATTGGAGGTGAAGGATGG + Intronic
944770344 2:202907907-202907929 CGGCAATTTCAGAGGCAGCAGGG + Exonic
947246659 2:228055998-228056020 CTGTCATTGAAGATGGAGCAAGG - Intronic
948198013 2:236109498-236109520 CTGCCATTACAGAGGATGCACGG - Intronic
948275890 2:236708391-236708413 CTGACATTTCAGATGAAGAAGGG - Intergenic
1168835679 20:875790-875812 CTGCACTGGCAGCTGAAGTAGGG + Intronic
1170152614 20:13241186-13241208 CTGCAGTTGCAGAGGCATCATGG + Intronic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1175283747 20:57822642-57822664 CTGGCATTGCAGATCAAGTAAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1177735991 21:25091095-25091117 CTGCAATTCAAGATGAAATATGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179074183 21:38103084-38103106 CTGCATTTGAGGATGTAGCAGGG + Intronic
1180792015 22:18580207-18580229 TTTCAAATGCAGATGAAACAAGG - Intergenic
1181229719 22:21415102-21415124 TTTCAAATGCAGATGAAACAAGG + Intergenic
1181248930 22:21519764-21519786 TTTCAAATGCAGATGAAACAAGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183657048 22:39192322-39192344 CTGCATTAGCAGGGGAAGCAAGG - Intergenic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1184866066 22:47202450-47202472 CTGCACTTGCACGTGGAGCATGG - Intergenic
950769659 3:15301413-15301435 CTGGCATTGCAGATCCAGCAAGG + Intronic
951677886 3:25262578-25262600 CTGGACTTGAAGATGAAGGAAGG - Intronic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
955463209 3:59208369-59208391 CTGCCTTTGAAGATGAAGGAAGG + Intergenic
956086840 3:65620432-65620454 CTGACAGTGCAGAAGAAGCAGGG + Intronic
956288204 3:67632720-67632742 CTCCAATTGCAGATGGAAAACGG + Intronic
957814275 3:85272856-85272878 CTGCAATGAAAGGTGAAGCAGGG - Intronic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
960713408 3:120553481-120553503 CTGCAATTACAGAACAATCAAGG + Intergenic
962266678 3:133948942-133948964 CTGCCACAGCAGATGAAGCAAGG - Exonic
963082274 3:141404919-141404941 CTGCAACTGCTGGAGAAGCAGGG - Intronic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
968267720 3:197375592-197375614 CTGCAAATGCATTTGAACCAGGG + Intergenic
971813170 4:31454030-31454052 CTGTCATTGCAGCTAAAGCATGG - Intergenic
971969622 4:33604762-33604784 CAGCTATTGCAGTTGCAGCATGG - Intergenic
972634360 4:40870255-40870277 CTGCCAGTGCAGATGAGGGAGGG + Intronic
972936953 4:44147835-44147857 CTGCTAGTGCAGATGATGCATGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974458469 4:62159115-62159137 CTACATTTGCAGATTAAGCATGG - Intergenic
977265447 4:94848434-94848456 CAGCAAGTGCAGATGACCCAAGG + Intronic
977481230 4:97578429-97578451 CTTCAATTGCATCTGAAGAAGGG + Intronic
980072221 4:128255403-128255425 CAGGAATTGGAGATGAGGCAGGG + Intergenic
980343617 4:131583810-131583832 CTGCAATTGCTGATGGAGAGAGG + Intergenic
980396180 4:132218594-132218616 GTGCAATTGCAGATGACTCAGGG + Intergenic
982759788 4:159267649-159267671 GTGTGATTGCAGATGAAACAAGG + Intronic
983743811 4:171169243-171169265 ATGCTAATGAAGATGAAGCAGGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985236842 4:187884398-187884420 CTTCAATTGCAGGGGAAGCTAGG + Intergenic
987077866 5:14401281-14401303 CTGAAAGGGCAAATGAAGCAAGG + Intronic
992752137 5:79871492-79871514 AGGACATTGCAGATGAAGCAGGG + Intergenic
993186047 5:84621342-84621364 CTGTAATTGCACCTGCAGCATGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
998199635 5:140108768-140108790 CTGACATCGCAGATGAAGCCGGG + Intronic
998500296 5:142626786-142626808 TTGCCATTGCAGATGAAGGGTGG + Intronic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
999297409 5:150468412-150468434 CAGCAGTGGCAGATGGAGCAGGG - Intergenic
999932820 5:156452154-156452176 GTGGAAATGCAGCTGAAGCACGG - Intronic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1002962696 6:1931225-1931247 GTTCTTTTGCAGATGAAGCAGGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1004733815 6:18384872-18384894 CTGCAGCTGCACAGGAAGCATGG - Intergenic
1007206132 6:40152780-40152802 GTGCAATGGCATCTGAAGCAGGG + Intergenic
1007724962 6:43910091-43910113 CTGGACTTGCAGGTGAAGGAGGG - Intergenic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1008299682 6:49820332-49820354 ATGCATTGGCAGATGAAGCATGG - Intergenic
1008550020 6:52620030-52620052 CTACAATTGCAGGGGAAGGATGG + Intergenic
1010892286 6:81327978-81328000 ATGCATTTGTAGATCAAGCATGG - Intergenic
1013010167 6:106113249-106113271 CTGAAATTGAAAATGAGGCATGG + Intergenic
1014344121 6:120245914-120245936 GTTCAGTTGCAGATGAAGGATGG - Intergenic
1014371906 6:120620213-120620235 CTGCACTTGCAGAAGAATTAGGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1016375897 6:143420229-143420251 CAGCAATTGCATATGAAGTCAGG + Intergenic
1017253709 6:152309786-152309808 GAGCAATTGCTGATGAATCATGG - Intronic
1017673725 6:156793183-156793205 CTGTGATTGGAGAAGAAGCAAGG + Intronic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1020966337 7:14874087-14874109 CTCCAGTTGAAGATGAAGAAGGG + Intronic
1025170145 7:56749096-56749118 CTGCAATTGAAGATGAAATTTGG - Intergenic
1025701740 7:63826622-63826644 CTGCAATTGAAGATGAAATTTGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026572605 7:71544550-71544572 CTGCACTTGCAGAGGATGAAAGG - Intronic
1027376049 7:77550978-77551000 CTGTAATAGGAGATGAAACATGG - Intronic
1028509313 7:91605459-91605481 CTGTAACAGAAGATGAAGCATGG - Intergenic
1029270864 7:99375593-99375615 CTGCATTGGCAGAGGAGGCAGGG - Intronic
1030563582 7:111122431-111122453 CTGCAAATACTGAAGAAGCATGG + Exonic
1033930060 7:146509311-146509333 CTGCAATTGCTGATGGAGGGAGG + Intronic
1034842878 7:154415843-154415865 CAGGGATTTCAGATGAAGCAAGG + Intronic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1038410368 8:27353840-27353862 CTGCTATTGAAGATGAAGCAGGG + Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1041904681 8:63019475-63019497 CTGCCACTGCAGATAAAACACGG + Intronic
1045287142 8:100801668-100801690 CTGCAATTTCATATGAGGCTTGG - Intergenic
1045642913 8:104271639-104271661 CTGGCATTGCAGATTAAGTAGGG - Intergenic
1045756886 8:105554228-105554250 CTCAAAATGCAGATGAAACATGG + Intronic
1046489799 8:114936658-114936680 CTGCCCTTGAAGATGGAGCAAGG + Intergenic
1046983369 8:120360940-120360962 CTGGAGTTGCAGAGGAGGCAGGG - Intronic
1048695447 8:137023001-137023023 CTGCAGGTGCAGATCAAGTAAGG - Intergenic
1049581969 8:143416745-143416767 CTGCAATTCAAGATGAATTAGGG + Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1051577295 9:18631307-18631329 GTGCAATTACAGATAAACCAGGG + Intronic
1056202247 9:84288179-84288201 CTGCAATTTCAGAAGAAAGAAGG + Intronic
1059825813 9:118027618-118027640 CTGCAGCTGCACAGGAAGCAGGG - Intergenic
1185721339 X:2384292-2384314 CTGCACTTGCTGTGGAAGCAGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187431115 X:19225893-19225915 CTTCACTTCCAGGTGAAGCACGG - Intergenic
1190688538 X:52894976-52894998 CTCCTATTACAGATGAGGCACGG - Intronic
1190697445 X:52960816-52960838 CTCCTATTACAGATGAGGCACGG + Intronic
1190708180 X:53048158-53048180 CTACAAGTGCAGAGGAGGCAGGG - Intergenic
1190813337 X:53906320-53906342 CTGCAAGTGGAGATGAAAGAAGG + Intergenic
1191770543 X:64752717-64752739 GTGTAATTGAAGATGAAGTAGGG + Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197690946 X:129500741-129500763 CTGGCATTGCAGATCAAGTAGGG - Intronic
1198006518 X:132500014-132500036 CTGAAACTGGATATGAAGCAGGG - Intergenic
1200375589 X:155776353-155776375 CTGCCATTGCAGACAAAGCCAGG - Exonic
1201747509 Y:17394825-17394847 CTGGCATTGCAGATCAAGTAGGG - Intergenic