ID: 1003112131

View in Genome Browser
Species Human (GRCh38)
Location 6:3259230-3259252
Sequence GGGCGGGGGCGCGGGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3559
Summary {0: 1, 1: 9, 2: 71, 3: 523, 4: 2955}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003112117_1003112131 3 Left 1003112117 6:3259204-3259226 CCTGGCGGCCGAGGGTGCGGGCG 0: 1
1: 0
2: 2
3: 31
4: 256
Right 1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG 0: 1
1: 9
2: 71
3: 523
4: 2955
1003112109_1003112131 27 Left 1003112109 6:3259180-3259202 CCATGTGCAGCCGCTACGTGAGT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG 0: 1
1: 9
2: 71
3: 523
4: 2955
1003112122_1003112131 -5 Left 1003112122 6:3259212-3259234 CCGAGGGTGCGGGCGGCGGGGCG 0: 1
1: 0
2: 2
3: 43
4: 331
Right 1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG 0: 1
1: 9
2: 71
3: 523
4: 2955
1003112112_1003112131 17 Left 1003112112 6:3259190-3259212 CCGCTACGTGAGTGCCTGGCGGC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG 0: 1
1: 9
2: 71
3: 523
4: 2955

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003112131 Original CRISPR GGGCGGGGGCGCGGGGGCGC CGG Intronic