ID: 1003112496

View in Genome Browser
Species Human (GRCh38)
Location 6:3261478-3261500
Sequence GGGTGACCAAAACCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003112496_1003112498 -10 Left 1003112496 6:3261478-3261500 CCTGTGGGTGGTTTTGGTCACCC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1003112498 6:3261491-3261513 TTGGTCACCCGACCCCATGGTGG 0: 1
1: 0
2: 0
3: 4
4: 64
1003112496_1003112507 25 Left 1003112496 6:3261478-3261500 CCTGTGGGTGGTTTTGGTCACCC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1003112507 6:3261526-3261548 GTGAGGTATATTTTCTCATCTGG 0: 1
1: 0
2: 1
3: 8
4: 126
1003112496_1003112504 8 Left 1003112496 6:3261478-3261500 CCTGTGGGTGGTTTTGGTCACCC 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1003112504 6:3261509-3261531 GGTGGTCACAGCTCCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003112496 Original CRISPR GGGTGACCAAAACCACCCAC AGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900771351 1:4547340-4547362 GAGTGGCCAAAACCAGACACCGG - Intergenic
901821428 1:11832607-11832629 GGGTCACACAAACCACCCCCTGG + Intronic
902211318 1:14906772-14906794 GGGGGAAAAAAACCACCCCCAGG + Intronic
905817326 1:40961702-40961724 GGGTTCCCAAGACCACCCTCAGG - Intergenic
906441369 1:45848656-45848678 GGGTCACCAAAACCATCCCCAGG - Intronic
907516211 1:54994935-54994957 GGGTCACCAAGCCCACCCAGCGG - Intergenic
912281413 1:108318716-108318738 GGGTCTGCAAAACCACCCCCAGG + Intergenic
924622579 1:245674978-245675000 GGGTTCCCAAAACGACCCTCAGG + Intronic
1064627746 10:17278663-17278685 GGGTCCCCAAGACCACCCTCAGG + Intergenic
1066107373 10:32167624-32167646 AGCTGACCAAAAACACACACGGG + Intergenic
1070741388 10:78905518-78905540 GGGTGAACAAAAACACACACTGG - Intergenic
1072024719 10:91443497-91443519 GGTTGACCAACACCACATACAGG - Intronic
1072024980 10:91446098-91446120 GGTTGACCAACACCACATACAGG + Intronic
1072316307 10:94206572-94206594 GTATGGCCCAAACCACCCACAGG - Intronic
1072573229 10:96676620-96676642 AGGTCACCAAAAACACACACGGG + Intronic
1073362971 10:102915248-102915270 AGATGAAGAAAACCACCCACAGG - Intergenic
1074816839 10:117148673-117148695 AGGTGACCACAGCCAGCCACAGG - Intergenic
1081656739 11:44862360-44862382 GGTTGACCAAAACCAAGCAAGGG - Intronic
1081702900 11:45163166-45163188 GGAAGACCAAGACCAGCCACAGG - Intronic
1083400937 11:62423205-62423227 AGGAGACCAAAACCACGCAGGGG - Intergenic
1083506710 11:63164602-63164624 GGGTTGCCAAAACCACACGCAGG + Exonic
1084674278 11:70625011-70625033 GGGTCTCCAAGACCACCCTCAGG + Intronic
1085211518 11:74784340-74784362 AGGTCTCCAAGACCACCCACAGG + Intronic
1086261383 11:84945455-84945477 GGATGACAAAAACAACCCTCTGG + Intronic
1087074902 11:94119885-94119907 GAAAGACAAAAACCACCCACGGG - Intergenic
1089201288 11:116726038-116726060 GGCTCACCAGACCCACCCACCGG - Intergenic
1090597085 11:128331466-128331488 GGGTGAGCTAAACAAACCACAGG - Intergenic
1092489745 12:8934382-8934404 GGGTGACTCAAAACCCCCACAGG + Exonic
1094633711 12:32203387-32203409 GGGAGAGAAAAACCACACACTGG + Intronic
1096946257 12:55412558-55412580 GGGTGACTCAAAACCCCCACAGG - Intergenic
1097302238 12:58031236-58031258 GGGTGACCAAAAGAAACCAGTGG - Intergenic
1099779654 12:87177374-87177396 GGGTGGCGAACATCACCCACCGG + Intergenic
1101958600 12:109231570-109231592 GGGTCCCCAAAAGCACCCCCAGG + Intronic
1103199743 12:119078049-119078071 GGGTCTTCAGAACCACCCACAGG - Intronic
1104077904 12:125406772-125406794 GGGTCCCCAAGACCACCCTCAGG + Intronic
1109403523 13:61867343-61867365 GGGAGAGCAAAATCACACACTGG - Intergenic
1112286882 13:98112294-98112316 GGGTCCCCAAGACCACCCCCAGG - Intergenic
1112454563 13:99547049-99547071 GGGTGCCCAGCAGCACCCACAGG - Exonic
1113487128 13:110662384-110662406 GGGGGTCCAAACCCAGCCACGGG - Intronic
1121551607 14:94807013-94807035 GGGTGACAACACCCACCCTCAGG + Intergenic
1121722256 14:96117650-96117672 GGGAGACGAAAACCACACACGGG + Intergenic
1122876688 14:104669769-104669791 GAGTGACCAAAACCAGACAGAGG + Intergenic
1123458533 15:20446912-20446934 GGGTCTCCAAGACCACCCCCAGG - Intergenic
1123659530 15:22553497-22553519 GGGTCTCCAAGACCACCCCCAGG + Intergenic
1123793726 15:23750532-23750554 GGGTTACCAAGACCATCCTCGGG - Intergenic
1124264822 15:28223082-28223104 GGGTCTCCAAGACCACCCCCAGG - Intronic
1124572487 15:30877695-30877717 GGGTTGCCAAGACCACCCTCAGG - Intergenic
1124791502 15:32731416-32731438 TGGTGTCTAAAAACACCCACAGG - Exonic
1125281696 15:38048367-38048389 GGGTTCCCAAAACCATCCTCAGG - Intergenic
1129739066 15:77981197-77981219 GGGTCACCAAAACCTCGCAGAGG - Intergenic
1129773507 15:78217956-78217978 TGGTAACCAAAACCACCAGCTGG - Intronic
1129846894 15:78771979-78772001 GGGTCACCAAAACCTCGCAGAGG + Intronic
1131571459 15:93541548-93541570 GTCTGAGCAAAACCACCAACTGG + Intergenic
1136140354 16:28284305-28284327 GGGTCAGCAAAACCAGCCCCAGG - Intergenic
1137395723 16:48115130-48115152 GGGTGCCCCAATCCACCCACAGG + Intronic
1140113180 16:72020936-72020958 TGCTGACCAAAACCACTCACTGG - Intronic
1141712112 16:85705735-85705757 GGGTCCCCAAGACCACCCTCAGG - Intronic
1143329426 17:6122292-6122314 AGATGCCCAAACCCACCCACTGG - Exonic
1145854065 17:28135231-28135253 GGGTTCCCAAGACCACCCTCAGG + Intronic
1146399890 17:32494212-32494234 GGGTGAGCAGAGTCACCCACAGG - Exonic
1148455363 17:47808345-47808367 GGGTGACCAACAATACCTACTGG - Exonic
1152872733 17:82766666-82766688 GGGTTCCCAAGACCACCCCCAGG + Intronic
1153066628 18:1052569-1052591 GATTGACCACAAGCACCCACAGG - Intergenic
1156706725 18:39891259-39891281 GGGTTCCCAAGACCACCCACAGG - Intergenic
1161777495 19:6271606-6271628 GGTTGGCCAAAACCACCAACAGG + Intronic
1162820345 19:13219434-13219456 GGGGTCCCAAAACCACCCACAGG - Intronic
1163813652 19:19450402-19450424 GGGTGAGCAACAGCCCCCACAGG - Intronic
1164120787 19:22262888-22262910 GGGTGCCGCATACCACCCACTGG - Intergenic
1164179235 19:22805678-22805700 GGGTGCCGCATACCACCCACTGG + Intergenic
1167537284 19:50062276-50062298 GGGGTCCCACAACCACCCACTGG - Intergenic
926456008 2:13069507-13069529 GGTTGACCAAAACTCCCCAGAGG + Intergenic
927088811 2:19694920-19694942 GGGTCAGTAAAGCCACCCACTGG + Intergenic
934912380 2:98271201-98271223 GAGTAACCAAAATCACACACAGG - Intronic
938729098 2:134131983-134132005 GGGTTACCTGAATCACCCACTGG + Intronic
940012558 2:149070314-149070336 GGGTAACCAAAAACATCCTCAGG - Intronic
943952591 2:194149015-194149037 GGGAGAGGAAAAACACCCACGGG - Intergenic
946397418 2:219449907-219449929 TGATGACCAACACCACCAACAGG + Intronic
946832997 2:223744289-223744311 GGGTCCCCAATACCACCCTCAGG + Intergenic
948522078 2:238546125-238546147 GGGTGATCCAAACCACCTCCTGG + Intergenic
948721785 2:239905320-239905342 GGAGGACCAAGAACACCCACTGG - Intronic
948928932 2:241118414-241118436 GGGTGCCAAAAACCACTCAATGG + Intronic
1168908867 20:1429094-1429116 GGGTTCCTAAAACCACCCTCAGG + Intergenic
1169010091 20:2243297-2243319 GGGTCTCCAAGACCACCCCCAGG + Intergenic
1171185411 20:23120997-23121019 AGGTGAGCAAAACCAACCAGTGG - Intergenic
1172168326 20:32912669-32912691 GGATGACGAAAATCACCTACAGG - Intronic
1175877111 20:62235584-62235606 GGGTCATGAAATCCACCCACTGG + Intronic
1176109037 20:63402821-63402843 AGGTGCCCAACACCCCCCACCGG - Intergenic
1179175245 21:39003322-39003344 AGGTGACCAAAATCAACCTCGGG + Intergenic
1180790298 22:18572150-18572172 TGCTGACCAAAACCACACCCAGG + Intergenic
1181231440 22:21423165-21423187 TGCTGACCAAAACCACACCCAGG - Intronic
1181247210 22:21511703-21511725 TGCTGACCAAAACCACACCCAGG + Intergenic
1182398383 22:30054450-30054472 GAGTGCCCAAGACCACCCTCAGG + Intergenic
1183596607 22:38816435-38816457 GGGTCCCCAAGACCACCCACAGG - Intergenic
1184160084 22:42692722-42692744 GGGTGTCCACAGCCTCCCACTGG + Exonic
1184753012 22:46499940-46499962 GAGTGACCATCACCACCCAGCGG + Intronic
1184792359 22:46707888-46707910 GGTCGACCAGAACCACCCCCGGG - Exonic
1185018158 22:48357777-48357799 GGGTGACCGACATCACCCAGAGG - Intergenic
949117798 3:348975-348997 GGCTGCCCCAAACCACCCACTGG + Intronic
955148748 3:56346008-56346030 GGGAAGCCAAAACCACCCAAAGG + Intronic
960008966 3:112812548-112812570 GGGTGACAAAAAACATTCACAGG - Intronic
960954730 3:123024175-123024197 GGGTGACCAAGACTAAGCACGGG + Intronic
961323509 3:126095347-126095369 TGTTGAACACAACCACCCACCGG + Intronic
964050415 3:152385892-152385914 AGATGACCATAACCAGCCACAGG - Intronic
967290431 3:187914568-187914590 GGGTGAACAAAAATAACCACGGG - Intergenic
967317687 3:188164681-188164703 GGGTGACAATGACCACCTACTGG - Intronic
968410266 4:384388-384410 GGGAGATGAAAAACACCCACGGG + Intronic
969127790 4:4966481-4966503 GGCTGACGAAAACCTCTCACGGG + Intergenic
971231428 4:24802830-24802852 GTGCCACCAAAGCCACCCACCGG + Intergenic
971432700 4:26584688-26584710 GGGGGCCCAAGTCCACCCACAGG - Intronic
976077483 4:81316136-81316158 GGGTTCCCAAGACCACCCTCAGG + Intergenic
978546253 4:109875363-109875385 GGGTGACCAAAATGACCCTGTGG - Intergenic
979013193 4:115396723-115396745 GGGGAACCTAAACCACCCAAAGG - Intergenic
982931536 4:161413939-161413961 GGGTTAGCAAAACTACCTACTGG + Intronic
983529569 4:168795267-168795289 GGGTTACCAAAAACACTGACAGG - Intronic
986652614 5:9979525-9979547 TGGAGCCCAAAACCACCCACAGG + Intergenic
988370238 5:30359412-30359434 GGGTGATGAACACCACACACTGG - Intergenic
993016178 5:82536902-82536924 GGGGGACCACAACAACTCACTGG + Intergenic
993178663 5:84520272-84520294 CAGTGACCAACACCAGCCACTGG - Intergenic
993605897 5:89990570-89990592 GGGTGAACAACAGCACCCACGGG - Intergenic
996857092 5:128020444-128020466 AGGTGACCAAAAGCACTCCCTGG - Intergenic
997352538 5:133241278-133241300 TGGTTCCCAAAACCACCCTCAGG - Intronic
1001343182 5:170865754-170865776 GGTTTCCCAAAACCACCCTCAGG + Intronic
1001984955 5:176066085-176066107 GGGTTCCCAAGACCACCCCCAGG + Intronic
1002231911 5:177772050-177772072 GGGTTCCCAAGACCACCCCCAGG - Intronic
1002263431 5:178011703-178011725 GGGTTCCCAAGACCACCCCCAGG + Intronic
1003112496 6:3261478-3261500 GGGTGACCAAAACCACCCACAGG - Intronic
1003128279 6:3373456-3373478 GGGTCCCCAAGACCACCCCCAGG - Intronic
1004813586 6:19287753-19287775 GGGAGACAAAAACCAACCAGTGG - Intergenic
1008471040 6:51885617-51885639 GGGTTGCCAAAAACACCCAATGG + Intronic
1008535060 6:52501229-52501251 GGGTAATCAAAAGCAACCACGGG + Exonic
1008558460 6:52698836-52698858 GGGTAACAAACACCACCCAAGGG - Intergenic
1015375484 6:132505178-132505200 TGGTAACCCAACCCACCCACAGG + Intronic
1017238966 6:152146515-152146537 AGCTGTCCAAAACCAGCCACTGG - Intronic
1019579859 7:1756209-1756231 GGGTGAACACAAGTACCCACAGG + Intergenic
1021252163 7:18343228-18343250 GTGTCACTAAAACTACCCACTGG + Intronic
1021832899 7:24634837-24634859 AGGTGCCCAAAACCACTCAATGG - Intronic
1023075956 7:36483014-36483036 GGGTGACCCCACCCACCCCCTGG - Intergenic
1024477234 7:49826046-49826068 GGTTGACAAAAACCCACCACAGG + Intronic
1025921752 7:65919915-65919937 AGGTGGCCAAAACCACCCCTTGG + Intronic
1031878654 7:127170860-127170882 GAGGGATAAAAACCACCCACTGG + Intronic
1035367432 7:158358174-158358196 GGCTGCCCCAAACCAACCACAGG + Intronic
1035937659 8:3859974-3859996 GGTTTCCCAAAACCACCCTCAGG - Intronic
1036560096 8:9894388-9894410 GAGTGACCAAAACCAACCCAGGG + Intergenic
1039790271 8:40870249-40870271 GGGAGGCCACAACCAGCCACTGG - Intronic
1039954272 8:42195229-42195251 GGGTGATCAGCACCTCCCACGGG - Intronic
1047245254 8:123137333-123137355 GGGTCCCCAAGACCACCCTCAGG + Intronic
1047475100 8:125220043-125220065 GGCAGACCAAACCCACCCATGGG + Intronic
1048453473 8:134554971-134554993 GGGTTACCAAGACCACCCTCAGG + Intronic
1048906376 8:139093152-139093174 AGGTGACCCAAACTTCCCACAGG - Intergenic
1049378268 8:142299299-142299321 GGGAGAGCAGAACCAGCCACAGG + Intronic
1050004653 9:1117606-1117628 GGTTAAACAAAGCCACCCACTGG - Intergenic
1057816962 9:98303073-98303095 GGGTGACATAAACCACACAGAGG - Intronic
1061855435 9:133439548-133439570 GGGTTCCCCAAACCACCCTCAGG + Intronic
1062368556 9:136224256-136224278 GTGTGCCCAATGCCACCCACAGG + Intronic
1203490976 Un_GL000224v1:104255-104277 GCCTGACCAAACCCTCCCACTGG + Intergenic
1203503600 Un_KI270741v1:46128-46150 GCCTGACCAAACCCTCCCACTGG + Intergenic
1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG + Intergenic
1193263288 X:79436551-79436573 GGCTGACCAAAACAAGCAACAGG + Intergenic
1199594645 X:149496836-149496858 GGGTTCCCAAAACCACCCTCAGG + Intronic
1199849210 X:151713566-151713588 GGGTGAGCAGAACCTTCCACTGG + Intergenic