ID: 1003113165

View in Genome Browser
Species Human (GRCh38)
Location 6:3265574-3265596
Sequence ACACCCTGCCCTATATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003113165_1003113169 7 Left 1003113165 6:3265574-3265596 CCCTGGGATATAGGGCAGGGTGT 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1003113169 6:3265604-3265626 AGGCTCCTCCTAGGCAGCCTTGG 0: 1
1: 0
2: 0
3: 21
4: 195
1003113165_1003113168 -2 Left 1003113165 6:3265574-3265596 CCCTGGGATATAGGGCAGGGTGT 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1003113168 6:3265595-3265617 GTGACTTACAGGCTCCTCCTAGG 0: 1
1: 0
2: 2
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003113165 Original CRISPR ACACCCTGCCCTATATCCCA GGG (reversed) Intronic
900595301 1:3477633-3477655 AGACCCTGCCCGATAGCCCAGGG - Intronic
901081639 1:6587120-6587142 AGTTCCTGCCCTATAGCCCAAGG + Intronic
904298476 1:29539214-29539236 ATTCCCTGCCCCAAATCCCATGG + Intergenic
904402817 1:30267870-30267892 ACATCCTGCCCCATTTCTCAGGG + Intergenic
907544387 1:55246785-55246807 GTACCCTGCGCTATGTCCCAAGG - Intergenic
908181495 1:61610655-61610677 TCACCATGCCCTCTATCTCAGGG + Intergenic
910139625 1:84012723-84012745 ACACCCTGTTTTCTATCCCAGGG + Intergenic
910507050 1:87961209-87961231 ACACCCTCCTCTGTCTCCCAGGG + Intergenic
917950820 1:180033624-180033646 AAACCCTGCCCTAAATACAATGG - Intronic
918586218 1:186192045-186192067 CCACCCTGCCGTGTATCCTAAGG - Intergenic
920386720 1:205575100-205575122 CCAGCCTGCCCTAGCTCCCAGGG + Intronic
920611060 1:207438379-207438401 CTAGCCTGCCCCATATCCCAGGG - Intergenic
921196160 1:212760006-212760028 TCACCCTGCCCTATCTGTCATGG + Intronic
923260164 1:232260891-232260913 ACCCCCTGCCTTATATTCTATGG - Intergenic
923641978 1:235772664-235772686 AAGCCTTGCCCTATATACCATGG + Intronic
924622627 1:245675347-245675369 AGCCCCTGCCCTAAATCACATGG + Intronic
1064761606 10:18627355-18627377 ACACCCTTTTCTAAATCCCATGG + Intronic
1066957653 10:42188344-42188366 CCACCCTGCCTTCTCTCCCACGG + Intergenic
1067144393 10:43683622-43683644 ACCCCCAGCCCTCTAGCCCAGGG + Intergenic
1068031958 10:51715719-51715741 TCACCCTGCCTTATATCTAAGGG + Intronic
1069718873 10:70537790-70537812 ACACCCTGTCCTCTCTCTCAGGG + Exonic
1070751020 10:78963988-78964010 CCACCCTGCCCTGCCTCCCAGGG + Intergenic
1074199395 10:111221267-111221289 AAGCTCTGCCCTGTATCCCAGGG - Intergenic
1074261939 10:111862957-111862979 TTGCCCTGACCTATATCCCATGG + Intergenic
1077867976 11:6238987-6239009 GCACTCTGCCCTGTCTCCCAGGG - Intronic
1078156936 11:8807459-8807481 ACACCCCGCCCTTCATTCCAGGG + Intronic
1078902926 11:15658359-15658381 ACCCCTTGCCCTACACCCCAAGG + Intergenic
1079127310 11:17727000-17727022 ACAGCCAGGCCTAGATCCCAGGG - Intergenic
1080173166 11:29330582-29330604 ACACCATTCCCAATATCTCATGG - Intergenic
1081449868 11:43160919-43160941 ACATCATGCCCAATATCGCAGGG + Intergenic
1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG + Intergenic
1083881621 11:65551755-65551777 ACAGCCTGACCTGTAACCCAAGG - Intronic
1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG + Intronic
1092408732 12:8238497-8238519 CCACCCTGCACTGTCTCCCATGG + Intergenic
1094474569 12:30831517-30831539 CCACACTGCCCTATATCGTATGG - Intergenic
1094525628 12:31229003-31229025 ACAGCCTGCCCAAGCTCCCATGG - Intergenic
1099375682 12:81894223-81894245 CCACCCTGCCTTCTCTCCCACGG + Intergenic
1099875040 12:88393364-88393386 AGACCCTGCCCTTTATCTCCAGG - Intergenic
1100368327 12:93942231-93942253 ACACCCTCTCCTAAATTCCAGGG + Intergenic
1104804110 12:131574114-131574136 ACACCCTCCCCAGGATCCCAAGG + Intergenic
1108136214 13:47365079-47365101 ACACTCTGCCAAATAACCCATGG - Intergenic
1110711245 13:78653328-78653350 ACACACTGCCCCATGTCCCTGGG + Intronic
1115197911 14:30821738-30821760 ACACCCTGCTCTTAAACCCAAGG + Intergenic
1117871654 14:60207395-60207417 AAACCCTGCCCTAGAGCCTAAGG - Intergenic
1119548547 14:75491500-75491522 AGCCCCTGCCCTAGATCCCACGG - Intergenic
1121021043 14:90580395-90580417 ACACCCTGCCCAAGTTCTCAGGG + Intronic
1121622667 14:95361146-95361168 ACGCCCAGCCCTGGATCCCAGGG + Intergenic
1123010727 14:105348374-105348396 ACACCCCGCCCTGCACCCCAGGG + Intronic
1124993749 15:34701879-34701901 ACACCCAGCCCTGGCTCCCATGG - Intergenic
1129761893 15:78133780-78133802 ACATCCTGCCTTCTTTCCCATGG - Intronic
1130081601 15:80738662-80738684 TCACCATGCCCTATATCTCATGG - Intronic
1131258824 15:90878037-90878059 ACACCCAGCCCTGCACCCCAGGG - Intronic
1131562698 15:93458225-93458247 ATACCCTGTCCAATATTCCATGG + Intergenic
1132299256 15:100766306-100766328 AAAACCTGCCCGATCTCCCACGG + Intergenic
1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG + Intronic
1133107332 16:3521015-3521037 ACACCCTGCCCACTGTCCCGAGG + Intronic
1134524416 16:14932998-14933020 CCACCCTGCCCAACCTCCCACGG - Intronic
1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG + Intronic
1134644579 16:15856276-15856298 ACAACCAGCCTTATCTCCCAGGG + Intronic
1134712004 16:16331485-16331507 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134719861 16:16374778-16374800 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG + Intergenic
1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG + Intergenic
1137920332 16:52480962-52480984 ACACCCTGGCCTTTATCCCCTGG - Intronic
1138336324 16:56256256-56256278 ACCCCCTGCCCTGTAGCCAAAGG - Intronic
1138560012 16:57795675-57795697 ACAGCCCGCCCTCTCTCCCATGG - Intronic
1141070566 16:80950749-80950771 ACACTCTGCCATTTAACCCAAGG + Intergenic
1141118182 16:81329793-81329815 TCACCCTGCACTGTCTCCCACGG + Intronic
1141812195 16:86383158-86383180 AGACCCTGCCCAAGATCCCCCGG + Intergenic
1148240974 17:45999098-45999120 ATACCCTGCCCTGTGTCCCATGG + Intronic
1150978629 17:70117877-70117899 ACACCCTGCTCTAAAGCCCAAGG - Intronic
1153066390 18:1050401-1050423 AAAGCCTGGCCTATACCCCATGG + Intergenic
1154112853 18:11585381-11585403 AAACCCTGCGCTATTTCCCTTGG + Intergenic
1155161658 18:23201217-23201239 ACACACTGTCCTAAATGCCAAGG - Intronic
1155341620 18:24819400-24819422 ACATCCTACCCTATTTCCAAGGG + Intergenic
1156791226 18:40976799-40976821 ACACACTGTCCTGTACCCCAGGG - Intergenic
1158759662 18:60369468-60369490 GCACCCTCCCCTATATGCCATGG - Intergenic
1160273354 18:77408384-77408406 AGACACTGCCCAATGTCCCAAGG - Intergenic
1162017608 19:7853824-7853846 ACACCCTGCCCTACACACCCTGG - Intronic
1163052545 19:14695357-14695379 ACACCCTCCCCTCTGCCCCAAGG - Intronic
1164079947 19:21853430-21853452 AGACACTGCACTATGTCCCAGGG - Intergenic
1164178866 19:22802296-22802318 CCACCCTCCCCTACACCCCAGGG + Intergenic
1164704987 19:30313450-30313472 ACACACAGCCCTGTTTCCCAGGG + Intronic
1165823562 19:38692788-38692810 ACACCCTTCCCTAGGACCCATGG + Intronic
1165888655 19:39097658-39097680 AGACCCTGCCCTATCTCAAAGGG - Intronic
1166876937 19:45903006-45903028 CCACCCTGCCCTCTAACCAAAGG + Intergenic
926661192 2:15468971-15468993 ACACCCTGGGATATATCTCATGG - Intronic
927061595 2:19427754-19427776 CCATCCTGTCTTATATCCCAGGG + Intergenic
927603982 2:24469891-24469913 AGACCCTGCCCTAAGTACCAAGG + Intergenic
930739916 2:54821068-54821090 AGATCCTGGGCTATATCCCAGGG - Intronic
932304726 2:70693931-70693953 ACACCAAGCCCTATGTCCCTGGG - Intronic
934465870 2:94262464-94262486 CCACCCTGCCTTCTCTCCCACGG - Intergenic
938383750 2:130850608-130850630 ACAATCTGCCCTACTTCCCATGG - Intronic
939711725 2:145529572-145529594 ACATCCTACTCTATACCCCATGG - Intergenic
942821658 2:180122489-180122511 ACACCCTGCCACATATCACGTGG - Intergenic
943009619 2:182431448-182431470 ACACCCTGCCATTTATCTCATGG - Intronic
943167771 2:184352377-184352399 TTACCAAGCCCTATATCCCAAGG + Intergenic
945906943 2:215604522-215604544 ATACCCTGCCCCATGTCCCCAGG - Intergenic
1172953969 20:38742219-38742241 ACACTCTGCTCTATTCCCCAGGG + Intergenic
1172990486 20:39032532-39032554 ACACCCCACCCTTTTTCCCAGGG - Intronic
1173073327 20:39791594-39791616 ACCCCCTGCCCTTTCCCCCACGG - Intergenic
1174745244 20:53055746-53055768 ACTCCCAGCTCTCTATCCCAGGG + Intronic
1175012290 20:55750762-55750784 ACACCATGACCCAGATCCCAAGG + Intergenic
1176596870 21:8705668-8705690 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1180279790 22:10683110-10683132 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1180587008 22:16901636-16901658 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1183690074 22:39383355-39383377 ACACTCTCCCCTACAGCCCATGG - Exonic
950778728 3:15373010-15373032 ACATTCTCCCCTATATCTCAGGG - Intergenic
950901998 3:16506213-16506235 CCACCCTCCCCCTTATCCCATGG - Intronic
953439048 3:42902487-42902509 ACTCCCTTCCCTATCTCCTATGG + Intronic
953872427 3:46638876-46638898 ACACCCTGGCAAAGATCCCATGG - Intergenic
955856606 3:63279032-63279054 CCCCCCTCCCCTATCTCCCAAGG - Intronic
956964887 3:74447425-74447447 CCACTCTGCCATATGTCCCAGGG - Intronic
958730864 3:97958911-97958933 GCACCCTGCCCTGAAACCCAGGG + Intronic
961243452 3:125432089-125432111 ACAGCCTGCACTGTATCCCTAGG + Intergenic
961558827 3:127714934-127714956 ACACCCATCCCAACATCCCAGGG + Intronic
961865822 3:129952906-129952928 TCACCCTGCCACACATCCCAAGG - Intergenic
965524337 3:169700384-169700406 CCACCCTCCCCTATATGCAAAGG + Intergenic
967876466 3:194271274-194271296 AGGCCCTCCCCTCTATCCCAGGG - Intergenic
968779720 4:2571264-2571286 ACAGGCTGCCCTGTACCCCATGG + Intronic
970771353 4:19615827-19615849 ATACACTGCCCTAGGTCCCAAGG + Intergenic
971111006 4:23586057-23586079 TCACCCTGCCTTATATTCCTTGG - Intergenic
971490579 4:27208192-27208214 ACAGTCTGCCCCATATCTCAAGG - Intergenic
972243560 4:37220642-37220664 ACACCCTGCCAGCTATCTCATGG + Intergenic
972866270 4:43236964-43236986 AAACCTTGCCCAATATCACAAGG - Intergenic
973610239 4:52629564-52629586 ACACAATGCCCTATATTCCAGGG + Intronic
981726468 4:147852517-147852539 ACACCCTCCCTTAACTCCCAAGG - Intronic
983076720 4:163335233-163335255 ACAGCCTGACCTATAAACCAAGG + Intronic
987350804 5:17020204-17020226 ACACCCGGCCCTAGATCTGATGG - Intergenic
987526229 5:19053427-19053449 GCACCTTGACCCATATCCCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
994560000 5:101356568-101356590 ATACCCTGGCCTCTATCCTATGG + Intergenic
995549536 5:113267105-113267127 TCACACTCCCCTGTATCCCAGGG + Intronic
999736618 5:154517818-154517840 CCACCCTGCCATAGATGCCAGGG + Intergenic
1001501795 5:172242467-172242489 ACACATTGCCGTATATCCCCTGG - Intronic
1001824368 5:174733552-174733574 ACACCCTCCCCGAAATCACAGGG + Intergenic
1003113165 6:3265574-3265596 ACACCCTGCCCTATATCCCAGGG - Intronic
1004905178 6:20230907-20230929 ACACCGTGCCGTATCTCACAAGG - Intergenic
1005122869 6:22409971-22409993 CCTCCCTGCCCCTTATCCCAAGG + Intergenic
1005214657 6:23511141-23511163 ACCTCCTGCACTATATCCTAGGG + Intergenic
1006465927 6:34195017-34195039 ACCCCCTGCCCTGTGTCCCTAGG + Intergenic
1007173449 6:39880257-39880279 CCACACTGACCTTTATCCCATGG + Intronic
1007970862 6:46050806-46050828 ACAACCTGCCATAAATCTCAAGG - Intronic
1008160256 6:48068313-48068335 TCACCCTGCCATACCTCCCAGGG + Exonic
1012982448 6:105844424-105844446 ACACCCAGCCATGTTTCCCAGGG + Intergenic
1014936089 6:127386755-127386777 ACACCTTGTCATATATACCATGG - Intergenic
1018173782 6:161162264-161162286 ACACCCTACCCCACATCCCTGGG + Intronic
1019650869 7:2157541-2157563 ACCCTCTGCCCTGTGTCCCAGGG - Intronic
1020151537 7:5685398-5685420 ACACCCTGGCTTCCATCCCAGGG - Intronic
1022181930 7:27929222-27929244 CCACCCTACCCTAAATCACAGGG - Intronic
1023200685 7:37693994-37694016 AAACAGTGCCCTATATCCCAAGG - Intronic
1023967945 7:44972953-44972975 AGACCCTGCCCTGTGTCCCAAGG + Intronic
1024541037 7:50475390-50475412 ACACCCTGGCCTTTCTCCCTGGG + Intronic
1029695373 7:102209605-102209627 ACACCCCCCTTTATATCCCAAGG - Intronic
1030056978 7:105591726-105591748 ACACCCTGAGCTATAACTCAAGG - Intronic
1033718821 7:144034973-144034995 ACACACACCCCTATATACCACGG + Intergenic
1036380437 8:8233022-8233044 CCACCCTGCACTGTCTCCCATGG - Intergenic
1036774006 8:11597656-11597678 TCCCCCTGCCCTGGATCCCAAGG + Intergenic
1036849128 8:12189638-12189660 CCACCCTGCACTGTCTCCCATGG + Intronic
1036870489 8:12431912-12431934 CCACCCTGCACTGTCTCCCATGG + Intronic
1040289301 8:46116232-46116254 ACACCCTGCCCCATAGCCTGGGG + Intergenic
1042435887 8:68764153-68764175 ACACCCTGCACTGTACCACAAGG - Intronic
1042883356 8:73519813-73519835 AGACTCTGCCCTGTATCTCAAGG + Intronic
1048568317 8:135627245-135627267 TCACCCTGGCTTCTATCCCAAGG + Intronic
1052325921 9:27216716-27216738 CAGCCCTGCCCTAGATCCCAAGG - Intronic
1053376566 9:37612102-37612124 AAACCCTGACCTATATCCCAGGG + Intronic
1053695927 9:40639240-40639262 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1053942912 9:43270278-43270300 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1054307174 9:63438458-63438480 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054405907 9:64762450-64762472 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054439533 9:65247937-65247959 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054490874 9:65774002-65774024 CCACCCTGCCTTCTCTCCCATGG + Intergenic
1056423968 9:86457723-86457745 CCTCCCTGGCCTACATCCCAGGG - Intergenic
1057223223 9:93268855-93268877 TCACCCTGCCCTGTCTCCCATGG + Exonic
1057888071 9:98846159-98846181 ACACTCTCCCTTATAGCCCAGGG - Intronic
1059402193 9:114077446-114077468 CCACTCTGCCCTAAATCCCGGGG - Intronic
1062697030 9:137880760-137880782 ACAGCCTCCCCTCCATCCCAGGG - Intronic
1202778374 9_KI270717v1_random:12853-12875 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1186011199 X:5135255-5135277 ACATCCTGCCCTATGTGCAAGGG + Intergenic
1186617584 X:11205385-11205407 AGACCTTGCCAAATATCCCAGGG + Intronic
1187731792 X:22262930-22262952 CCAGCCTGCCGTATCTCCCATGG - Intergenic
1187818772 X:23262417-23262439 ACACCCCACCCTCTCTCCCATGG - Intergenic
1189675387 X:43455929-43455951 ACAACCTCTCCTATTTCCCAGGG + Intergenic
1190183701 X:48217129-48217151 ACTCCCTGCCCTATATATCCAGG + Intronic
1190753305 X:53380566-53380588 ACTCCCTGCCTGATTTCCCAGGG - Intronic
1192480638 X:71482213-71482235 ACACACTTCCCTTTATCTCATGG + Intronic
1193969955 X:88039072-88039094 ACTCAGTGTCCTATATCCCAGGG + Intergenic
1195737753 X:108031226-108031248 AAATCCTGCCCTATCTCTCAAGG - Intergenic
1200249478 X:154545095-154545117 GCACCCTCCCCTGTGTCCCATGG - Intronic
1201193687 Y:11471157-11471179 CCACCCTGCCTTCTCTCCCACGG - Intergenic