ID: 1003113677 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:3269107-3269129 |
| Sequence | TCTGCTGATCCGTGGCCTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 172 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 16, 4: 155} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003113677_1003113680 | -6 | Left | 1003113677 | 6:3269107-3269129 | CCTTCAGGCCACGGATCAGCAGA | 0: 1 1: 0 2: 0 3: 16 4: 155 |
||
| Right | 1003113680 | 6:3269124-3269146 | AGCAGAACATACACGAACAAGGG | 0: 1 1: 0 2: 0 3: 10 4: 169 |
||||
| 1003113677_1003113679 | -7 | Left | 1003113677 | 6:3269107-3269129 | CCTTCAGGCCACGGATCAGCAGA | 0: 1 1: 0 2: 0 3: 16 4: 155 |
||
| Right | 1003113679 | 6:3269123-3269145 | CAGCAGAACATACACGAACAAGG | 0: 1 1: 0 2: 0 3: 9 4: 115 |
||||
| 1003113677_1003113681 | 23 | Left | 1003113677 | 6:3269107-3269129 | CCTTCAGGCCACGGATCAGCAGA | 0: 1 1: 0 2: 0 3: 16 4: 155 |
||
| Right | 1003113681 | 6:3269153-3269175 | ATTCCTCTTAATTTTACTGATGG | 0: 1 1: 0 2: 1 3: 36 4: 326 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003113677 | Original CRISPR | TCTGCTGATCCGTGGCCTGA AGG (reversed) | Intronic | ||