ID: 1003113677

View in Genome Browser
Species Human (GRCh38)
Location 6:3269107-3269129
Sequence TCTGCTGATCCGTGGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003113677_1003113680 -6 Left 1003113677 6:3269107-3269129 CCTTCAGGCCACGGATCAGCAGA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1003113680 6:3269124-3269146 AGCAGAACATACACGAACAAGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1003113677_1003113679 -7 Left 1003113677 6:3269107-3269129 CCTTCAGGCCACGGATCAGCAGA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1003113679 6:3269123-3269145 CAGCAGAACATACACGAACAAGG 0: 1
1: 0
2: 0
3: 9
4: 115
1003113677_1003113681 23 Left 1003113677 6:3269107-3269129 CCTTCAGGCCACGGATCAGCAGA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1003113681 6:3269153-3269175 ATTCCTCTTAATTTTACTGATGG 0: 1
1: 0
2: 1
3: 36
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003113677 Original CRISPR TCTGCTGATCCGTGGCCTGA AGG (reversed) Intronic