ID: 1003113679

View in Genome Browser
Species Human (GRCh38)
Location 6:3269123-3269145
Sequence CAGCAGAACATACACGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003113677_1003113679 -7 Left 1003113677 6:3269107-3269129 CCTTCAGGCCACGGATCAGCAGA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1003113679 6:3269123-3269145 CAGCAGAACATACACGAACAAGG 0: 1
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003113679 Original CRISPR CAGCAGAACATACACGAACA AGG Intronic