ID: 1003113679

View in Genome Browser
Species Human (GRCh38)
Location 6:3269123-3269145
Sequence CAGCAGAACATACACGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003113677_1003113679 -7 Left 1003113677 6:3269107-3269129 CCTTCAGGCCACGGATCAGCAGA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 1003113679 6:3269123-3269145 CAGCAGAACATACACGAACAAGG 0: 1
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003113679 Original CRISPR CAGCAGAACATACACGAACA AGG Intronic
902276276 1:15342127-15342149 CTGCAATACATACACAAACAAGG - Intronic
902746053 1:18475302-18475324 CAGAAGAACAGACAAGAACAGGG - Intergenic
903907549 1:26696998-26697020 CAGCAGAACTCTCACGACCACGG + Exonic
914477381 1:148035137-148035159 CAGCAAAACACAGACTAACAAGG - Intergenic
922427990 1:225517535-225517557 CAGGAGAAGAAACACAAACAGGG + Intronic
923251215 1:232180994-232181016 CAGCAGCACATACATGACCGAGG + Intergenic
1068117843 10:52753449-52753471 CATCAGAACATACAGGAAGAAGG + Intergenic
1070190009 10:74103536-74103558 CAGAAGAACATACACAAAACTGG - Intronic
1074391278 10:113060091-113060113 CTGAAGAACAAACACTAACAGGG - Intronic
1075482741 10:122796489-122796511 CAACAGAACAGACACAAGCATGG + Intergenic
1076495555 10:130895308-130895330 GAGCAGACCACACAAGAACAGGG - Intergenic
1077959219 11:7055611-7055633 CAGGAGAACTTACTCCAACAGGG + Intronic
1078871267 11:15347410-15347432 CAGCAGAACCATCAAGAACAGGG - Intergenic
1082838972 11:57673016-57673038 CGGCAGAACAGACAAGAAAATGG - Exonic
1082912736 11:58395358-58395380 CAGCACCACATGCACGACCAAGG - Intergenic
1084225954 11:67714964-67714986 CATCAGAACAGACACTGACATGG + Intergenic
1084263785 11:67994838-67994860 CATCAGAACAGACACTGACATGG + Intronic
1084809625 11:71604282-71604304 CATCAGAACAGACACTGACATGG - Intergenic
1088997797 11:115017700-115017722 CAGCAGAATGGACACAAACAAGG + Intergenic
1089994959 11:122897648-122897670 CAGCAGAGCATCTAAGAACAAGG - Intronic
1099324673 12:81199530-81199552 CAGCAGATCAGACACAAACTCGG + Intronic
1099468872 12:83021900-83021922 CAGCAGCATATACACTAAAAGGG + Intronic
1099778168 12:87161223-87161245 CAGCAGAACAAACACTTAGAGGG + Intergenic
1100001197 12:89837421-89837443 CAGCAGAAAATCCACTAATAGGG - Intergenic
1100523204 12:95396286-95396308 CAGCCTAACCTACATGAACACGG + Intergenic
1101563366 12:105881426-105881448 CTGCAGAACCTACAAGAAGAAGG - Intergenic
1101750250 12:107577506-107577528 ATGGAGAACATACACGGACATGG - Intronic
1106127472 13:26912168-26912190 CAGGAGAACACACAGGACCATGG - Intergenic
1111235895 13:85406760-85406782 CAGCAAAACACACACAAACATGG + Intergenic
1111357537 13:87128310-87128332 GAGCAGAACATAGTCAAACATGG + Intergenic
1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG + Intergenic
1120349711 14:83339953-83339975 CAGCAGCACAGACAAGAAAAGGG + Intergenic
1120403687 14:84067208-84067230 AACGAGAACATACACAAACATGG - Intergenic
1122434305 14:101683276-101683298 CAGCAGAACATGCAAGAGAAAGG + Intergenic
1122725035 14:103744921-103744943 CAGCACAGCAGACACCAACAAGG + Intronic
1125223580 15:37368654-37368676 CATTAAAAAATACACGAACAAGG - Intergenic
1126552053 15:49942434-49942456 CAGCAGAAAATAAAATAACATGG + Intronic
1130087398 15:80789144-80789166 CAGCAGAACCCACACCAACTGGG - Intronic
1132983522 16:2751895-2751917 AAGCGGCACATACAGGAACAAGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1140337434 16:74121238-74121260 CAGCAGCACATACACTAAAGTGG + Intergenic
1144506439 17:15835200-15835222 CAGCAGCTCATACAAGAACCTGG - Intergenic
1145047609 17:19630313-19630335 CAGCAGAACATAAACTCCCAAGG + Intergenic
1146179694 17:30689689-30689711 CAGCAGTACAGACACAAGCAAGG - Intergenic
1151277064 17:73043133-73043155 AAGCAGAACATCAAAGAACAGGG + Intronic
1152089044 17:78237016-78237038 CAGAAGAACTTACAGGGACACGG + Intronic
1157818392 18:50747874-50747896 CACCAGATCATACCCAAACAAGG + Intergenic
1160557177 18:79733528-79733550 CAGCAGAACAGGCAGGAACGAGG - Intronic
1162661900 19:12176296-12176318 CAGGAGATCATACACACACAGGG - Intronic
1162978915 19:14225873-14225895 CAGCAGTACAGACACAAGCAAGG + Intergenic
1167965722 19:53144987-53145009 CCTCAGAAGATACACAAACATGG + Intronic
1168351177 19:55676823-55676845 CAGCAGCAGATACAAGAACATGG - Exonic
927017105 2:18975904-18975926 CAGCCACACATACACGAACAGGG + Intergenic
927448763 2:23188414-23188436 CAGCAGAACAGACTGGGACAGGG - Intergenic
933179051 2:79209666-79209688 CACCAGAAAATACATGCACATGG + Intronic
938386124 2:130868579-130868601 CAGCAGAACATCCAAGGAAAAGG + Intronic
938685792 2:133736502-133736524 CAGCAGAAACTACACAAAAAGGG + Intergenic
939108312 2:137975877-137975899 CATCAGAAAATATACGAAAATGG - Intronic
942201092 2:173572143-173572165 CAGCAGAACAAACTCGAAATTGG - Intergenic
942559424 2:177204620-177204642 CAGCAGGACACAAACGAACAAGG + Intergenic
942960604 2:181825734-181825756 GAGCAGAACATACAGGGTCAAGG + Intergenic
1170945077 20:20884223-20884245 CAGCAGAACAAACAGGAGCCTGG + Intergenic
1175330171 20:58158171-58158193 CACCAGAACATACCAAAACATGG + Intronic
1178642132 21:34353427-34353449 CCCCAAAACACACACGAACATGG - Intergenic
1179253838 21:39698115-39698137 CAGCATCACATACACCAACGTGG + Intergenic
1179401905 21:41091957-41091979 CAGCAGAACAGCCAGAAACATGG - Intergenic
1181080621 22:20412436-20412458 CAGCAGAATGAACACGAACCTGG - Intergenic
1184774080 22:46614871-46614893 CAGGGGAACCTACACGCACAGGG - Intronic
1184774248 22:46615557-46615579 CAGGGGAACCTACACGCACAGGG - Intronic
1184774417 22:46616214-46616236 CAGGGGAACCTACACGCACAGGG - Intronic
1184774457 22:46616386-46616408 CAGGGGAACCTACACGCACAGGG - Intronic
1184774529 22:46616676-46616698 CAGGGGAACCTACACGCACAGGG - Intronic
1184774741 22:46617531-46617553 CAGAGGAACCTACACGCACAAGG - Intronic
949520469 3:4848462-4848484 CAGCAGAAAATAAACGAAATTGG + Intronic
949948500 3:9209236-9209258 CAGCACAACAGCCATGAACACGG + Intronic
951192966 3:19791680-19791702 CAAAAGAACATATACAAACAGGG + Intergenic
956797103 3:72727264-72727286 CAGTAAACCATACACAAACATGG + Intergenic
957079216 3:75622790-75622812 CATCAGAACAGACACTGACATGG + Intergenic
957578998 3:82046478-82046500 TAGGAGAACATACAAGAAAAAGG - Intergenic
962563133 3:136629239-136629261 CAGCAGGACATACAAAAATAAGG + Intronic
967198248 3:187048291-187048313 AACCAGATCATACACGGACATGG - Intronic
969022305 4:4146745-4146767 CATCAGAACAGACACTGACATGG + Intergenic
969731569 4:8960648-8960670 CATCAGAACAGACACTGACATGG - Intergenic
969791167 4:9494756-9494778 CATCAGAACAGACACTGACATGG - Intergenic
972033762 4:34494617-34494639 CAGCAGAAGAAAGAAGAACAAGG - Intergenic
979975783 4:127194652-127194674 CAGCATAAAATATACGAATAGGG + Intergenic
980473368 4:133277961-133277983 CAGCTGAACATACACCCTCATGG - Intergenic
985618020 5:936325-936347 CAGGAGAACACACAGGAACGAGG - Intergenic
986698953 5:10386000-10386022 CAGCACAACACTCACGTACATGG - Intronic
996090598 5:119347726-119347748 AAGCAGAACTTACCCAAACAGGG - Intronic
996998396 5:129726949-129726971 AAGCAAAACAGACAAGAACAGGG - Intronic
997659927 5:135581780-135581802 CAGAAGAACTCACACAAACAAGG - Intergenic
998807880 5:145936673-145936695 CAGCAGAAGTTACATGCACAAGG + Intronic
1000672931 5:164084973-164084995 CAGCTGAATATAAACGAACTAGG - Intergenic
1002880139 6:1243725-1243747 AGGCAGAACACACAAGAACAAGG - Intergenic
1003113679 6:3269123-3269145 CAGCAGAACATACACGAACAAGG + Intronic
1003306811 6:4936252-4936274 TAGCAGAACACACAGCAACAGGG + Intronic
1011227335 6:85122066-85122088 CAGCATAAAATAGACTAACATGG + Intergenic
1012240936 6:96871059-96871081 CAGCAGAACATAAAACATCAAGG + Intergenic
1013127868 6:107202574-107202596 TAGCAGAATATAAAGGAACAGGG + Intronic
1017917348 6:158842060-158842082 CATCAGAGCATACACAATCATGG + Intergenic
1020309726 7:6858787-6858809 CATCAGAACAGACACTGACATGG + Intergenic
1021553765 7:21899266-21899288 CAACAGAACATACTGGAAAATGG + Intronic
1021863373 7:24929810-24929832 GAGCAAAACATACATGACCAAGG - Intronic
1028949862 7:96622246-96622268 CACCAGAACATAAAAGGACATGG + Intronic
1029488795 7:100859110-100859132 AAGCAGGACATAGACGAAGAAGG - Exonic
1029523192 7:101077505-101077527 CAGCTGAACATGCAGGGACATGG + Intergenic
1030142489 7:106319418-106319440 CAGCAGAGGATAAATGAACATGG + Intergenic
1031804392 7:126291061-126291083 CTGCAGAACAGACACCAACATGG - Intergenic
1034566353 7:151918766-151918788 AAGCAGAACAAACACCAACAGGG + Intergenic
1037101541 8:15053208-15053230 CAGAAGAACTGACATGAACATGG - Intronic
1037422852 8:18722379-18722401 AAACAGAACATATAAGAACATGG - Intronic
1037987575 8:23299443-23299465 CAGCAGAGCAGACAGGGACATGG - Intronic
1038144219 8:24879337-24879359 CAGCAGAACATAGACAACAAAGG + Intergenic
1043341432 8:79244463-79244485 CAGCAGAACATATCAGACCAAGG - Intergenic
1053633611 9:39971380-39971402 GAACAGAACATACTTGAACAGGG - Intergenic
1053772138 9:41492120-41492142 GAACAGAACATACTTGAACAGGG + Intergenic
1054210276 9:62279317-62279339 GAACAGAACATACTTGAACAGGG + Intergenic
1054314715 9:63569610-63569632 GAACAGAACATACTTGAACAGGG - Intergenic
1057261089 9:93585141-93585163 CAGCAGCACATGCATGAACACGG - Intronic
1187673616 X:21693165-21693187 TAGCACAACATCCACGAGCAAGG - Intergenic
1188810140 X:34643699-34643721 CTGCAGAACATCAATGAACATGG + Intronic
1197137220 X:123075775-123075797 AAGCACAACATACCTGAACATGG - Intergenic
1199864970 X:151837312-151837334 CATCAGAACATAGAGGAAGAGGG + Intergenic
1200950544 Y:8894553-8894575 CAGCAGAACATCCAGGGGCATGG + Intergenic