ID: 1003113878

View in Genome Browser
Species Human (GRCh38)
Location 6:3270503-3270525
Sequence CAGCCTGAGGAGGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1874
Summary {0: 1, 1: 4, 2: 13, 3: 191, 4: 1665}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003113878_1003113886 -3 Left 1003113878 6:3270503-3270525 CCGGCCTCCTCCTCCTCAGGCTG 0: 1
1: 4
2: 13
3: 191
4: 1665
Right 1003113886 6:3270523-3270545 CTGCCCTGGGAGGAGAGCTGTGG 0: 1
1: 0
2: 14
3: 123
4: 829
1003113878_1003113890 11 Left 1003113878 6:3270503-3270525 CCGGCCTCCTCCTCCTCAGGCTG 0: 1
1: 4
2: 13
3: 191
4: 1665
Right 1003113890 6:3270537-3270559 GAGCTGTGGGACCGCCTCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 87
1003113878_1003113887 -2 Left 1003113878 6:3270503-3270525 CCGGCCTCCTCCTCCTCAGGCTG 0: 1
1: 4
2: 13
3: 191
4: 1665
Right 1003113887 6:3270524-3270546 TGCCCTGGGAGGAGAGCTGTGGG 0: 1
1: 0
2: 5
3: 36
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003113878 Original CRISPR CAGCCTGAGGAGGAGGAGGC CGG (reversed) Exonic
900031826 1:378170-378192 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
900052374 1:606361-606383 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900204459 1:1426146-1426168 GAGACGGAGGAGGAGGAGGGGGG + Exonic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900331064 1:2134882-2134904 CTGCCTGGGGAGGAGGGGGGTGG + Intronic
900781084 1:4617570-4617592 CAGCCTGGGGTGGAGGGGCCAGG + Intergenic
900870668 1:5300092-5300114 CACCATGAGGAGGACCAGGCTGG - Intergenic
900889012 1:5435762-5435784 GTGCCGGAGGAGGAGGAGGCAGG + Intergenic
900943811 1:5818075-5818097 CACACTGAGGCGGTGGAGGCTGG + Intergenic
901048899 1:6416338-6416360 CTGCCTGTGGAGGAGGATGTTGG + Exonic
901084642 1:6603026-6603048 CAGCCTGCGGAGCCGGGGGCGGG - Intronic
901323769 1:8355323-8355345 CAGGCAGAGGGGGAGGAGCCTGG + Intronic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901475844 1:9488711-9488733 CAGACTGAGAAGGAGCAGTCAGG + Intergenic
901770017 1:11525255-11525277 CAGCCTGCCAAGGAGCAGGCAGG - Exonic
901815632 1:11791868-11791890 GAACATGAGCAGGAGGAGGCGGG - Intronic
902359105 1:15932331-15932353 AAGGCTGCTGAGGAGGAGGCAGG + Exonic
902395331 1:16129378-16129400 CAGCCTCTGGAGTGGGAGGCGGG + Intronic
902512895 1:16975779-16975801 CAGCCTCAGGTGGGTGAGGCTGG - Intronic
902630411 1:17701384-17701406 AAGCCTGAGGATGCGGAGGGAGG + Intergenic
902642100 1:17773625-17773647 TAGCCTGATGAAGAGGAGGCGGG + Intronic
902675987 1:18008858-18008880 GAGCCTGAGAAGGTCGAGGCTGG + Intergenic
903291302 1:22315907-22315929 CGGCCTGCTGCGGAGGAGGCTGG + Intergenic
903360572 1:22774405-22774427 CAGCCAGAGCAGGAGGAGTCAGG + Intronic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903570107 1:24297931-24297953 AAGCAGGAGGAGGAGGAGGAGGG + Intergenic
903724347 1:25430142-25430164 CAGCCTGTGGACGTGGAGCCCGG + Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904087180 1:27917087-27917109 AAGCAGGAGGAGGAGGAGGGAGG - Intergenic
904315287 1:29656168-29656190 CCTCCTGAGGTGGGGGAGGCAGG - Intergenic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904393860 1:30205042-30205064 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
904604409 1:31691055-31691077 GGGCCTTTGGAGGAGGAGGCTGG - Intronic
904711543 1:32433970-32433992 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
904744614 1:32703036-32703058 CAGCCTGGGAGGGTGGAGGCAGG + Exonic
904766583 1:32853358-32853380 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
905209884 1:36366713-36366735 CAGCCTGAGGACCAGGTGTCTGG - Intronic
905224881 1:36472472-36472494 GAGCCTGAGGTGGTGGGGGCAGG - Intronic
905243318 1:36595509-36595531 CTCCCAGAGGAGGAGGAAGCCGG - Intergenic
905257128 1:36692078-36692100 CAGTCTGAGGAGGATGAGCATGG - Intergenic
905314963 1:37076546-37076568 CATCCAGAGGAGGATGAAGCTGG + Intergenic
905325142 1:37146497-37146519 CTGCCTGAGGAGGAAGATTCTGG + Intergenic
905354101 1:37369075-37369097 CAGCCTGGGGGAGAGAAGGCAGG - Intergenic
905370495 1:37480213-37480235 AGGCCTGAGCAGGAGGAGGGAGG - Intronic
905465260 1:38148394-38148416 CAGCCTGGGGGAGAGAAGGCAGG - Intergenic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
905885921 1:41491920-41491942 CAGCCTTAGTGGGATGAGGCAGG - Intergenic
905995865 1:42380500-42380522 CAGCCGGAGCAGGAGGGGCCGGG - Intergenic
906013345 1:42550475-42550497 CAGCAAGATGAGGAGGAGGTAGG - Intronic
906223613 1:44103264-44103286 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
906288338 1:44602978-44603000 CGGCCCGAGGAGGAGGAGGAGGG - Intronic
906465117 1:46071580-46071602 CAGACTCAGGAGGCTGAGGCAGG + Intronic
906492232 1:46277798-46277820 CTGCCTGGGGAAGAGGAGGTGGG - Exonic
906636991 1:47416433-47416455 GAGCCAGAGGAGGCGGCGGCTGG + Exonic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
906704110 1:47882224-47882246 CAGCATGGGGAGCATGAGGCAGG - Intronic
907132943 1:52112966-52112988 TAGCCTCAGGAGGCTGAGGCAGG - Intergenic
907143585 1:52211591-52211613 CAGCCTCAGGAGGCTGAGGCCGG + Intronic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
907409885 1:54276362-54276384 CAGCCTGAGGAGGCTGAGGTGGG + Intronic
907421964 1:54353681-54353703 CAGCATGAGTAGGATGGGGCAGG - Intronic
907503657 1:54901920-54901942 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
907521166 1:55024258-55024280 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
907780375 1:57561129-57561151 CAGGCTGGGGGAGAGGAGGCAGG - Intronic
907797533 1:57732408-57732430 CAGCCTGAGCAGGCGGAGAGAGG + Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
908131201 1:61077136-61077158 CAGCCTGCGGCGGAGGGGGCAGG - Intronic
908233617 1:62129825-62129847 CAGCTACAGGAGGATGAGGCAGG + Intronic
908375974 1:63541674-63541696 CAGCCTCAGGAGGCTGAGGTAGG - Intronic
908534646 1:65066744-65066766 GTGCCGGAGGAGGAGGAGGAGGG - Intergenic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909729296 1:78873563-78873585 CGACCTGAGGAGGAGCAGTCTGG - Intergenic
909776787 1:79492615-79492637 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
909909869 1:81247097-81247119 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
909931170 1:81502049-81502071 GAGCCTGAGGAAGAGGACGGAGG + Intronic
910002829 1:82358929-82358951 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
910002837 1:82358944-82358966 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
910219531 1:84876444-84876466 CAACCTGGAGGGGAGGAGGCAGG - Intronic
910370670 1:86512424-86512446 CAGGCTGAAGAAGAGAAGGCAGG - Intergenic
910421548 1:87069082-87069104 CAGGCTGAGGAGGAAGAGGTGGG + Intronic
910831058 1:91463129-91463151 CAGCCTGGGGGAGAGCAGGCAGG + Intergenic
911070975 1:93831684-93831706 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
911148142 1:94571258-94571280 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
911155307 1:94630419-94630441 CCACCTGAGGATGAGGAAGCTGG - Intergenic
911257294 1:95647069-95647091 CAGACTGGGGAAGAGAAGGCAGG + Intergenic
911275382 1:95853093-95853115 CAGCCTGAGGAGGGGGCTCCAGG - Intergenic
911704762 1:100998395-100998417 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
911930490 1:103896684-103896706 TAAGCTGAAGAGGAGGAGGCAGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912813465 1:112811059-112811081 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
912813473 1:112811074-112811096 CAGCCTGGTGAGGAGCAGCCTGG - Intergenic
912815412 1:112824583-112824605 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
913046147 1:115075042-115075064 CAGACTGTGGAGGAGGTGACTGG + Intronic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913341091 1:117758825-117758847 CAGCCGGAGAGGGAGGAGGAGGG + Intergenic
913547548 1:119884474-119884496 CAGCCTGGGGTGGAGAAGGAAGG - Intergenic
913601103 1:120421737-120421759 AAATCAGAGGAGGAGGAGGCTGG - Intergenic
913671111 1:121097865-121097887 CAGCCGGAGGCGGCGGCGGCAGG + Intergenic
914022878 1:143885286-143885308 CAGCCGGAGGCGGCGGCGGCAGG + Intergenic
914085942 1:144454864-144454886 AAATCAGAGGAGGAGGAGGCTGG + Intronic
914191839 1:145418844-145418866 AAATCAGAGGAGGAGGAGGCTGG + Intergenic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914362291 1:146945293-146945315 AAATCAGAGGAGGAGGAGGCTGG - Intronic
914489383 1:148141790-148141812 AAATCAGAGGAGGAGGAGGCTGG + Intronic
914521151 1:148417584-148417606 CTGCCTGCAGAGCAGGAGGCAGG - Intergenic
914589764 1:149096845-149096867 AAATCAGAGGAGGAGGAGGCTGG + Intronic
914661365 1:149793230-149793252 CAGCCGGAGGCGGCGGCGGCAGG + Intronic
914802459 1:150971566-150971588 CTGGCTGAGGTGGAGGGGGCAGG - Intronic
914920553 1:151844499-151844521 GAGCCTGGGGAGGAGAAGGGTGG - Intergenic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915556002 1:156661158-156661180 GGGCCTGAAGAGGAGAAGGCTGG + Intergenic
915585984 1:156844265-156844287 CTGCCAGAGGAGGAGGATGCTGG - Exonic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
916025046 1:160826250-160826272 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
916201271 1:162273597-162273619 CCACCTGAGGAGGAGGAGTTTGG + Intronic
916328769 1:163592672-163592694 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916487484 1:165272468-165272490 CAGACTGAGGGGGAAGAGGCAGG - Intronic
916507681 1:165442911-165442933 CACCAGGAGGAAGAGGAGGCAGG - Intronic
916636846 1:166680051-166680073 GAGACTGAGAAGGAGGAGGGAGG - Intergenic
916716828 1:167453843-167453865 AAGCCTCCGGAGGAGGGGGCTGG - Intronic
916941700 1:169684489-169684511 CGACCTGAGGAGGAGCAGTCTGG - Intronic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917480362 1:175406566-175406588 CAGTCAGTGGAGGAGGAGGGAGG - Exonic
917749551 1:178041625-178041647 CAGCCTGGTGAGGAGCAGCCTGG - Intergenic
917750836 1:178051926-178051948 AAGACTGAGAAGGAGCAGGCTGG - Intergenic
917808503 1:178635544-178635566 CAGACTGGGGAGGCTGAGGCGGG + Intergenic
917812729 1:178675391-178675413 CACCCTCAGGAGGCTGAGGCAGG + Intergenic
917843739 1:179003265-179003287 CAGCCTAAGCAGGGGCAGGCAGG + Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918096854 1:181343172-181343194 AAGACTGGGGTGGAGGAGGCTGG + Intergenic
918112566 1:181469951-181469973 CAGCCAGAGGGTGAGGAGGGAGG + Intronic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918586332 1:186193200-186193222 CACCCTGAGGATGAGAAGGGAGG + Intergenic
918918199 1:190671584-190671606 CAGGCTGGGAAAGAGGAGGCAGG + Intergenic
919476308 1:198036451-198036473 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
919476316 1:198036466-198036488 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
919826254 1:201505674-201505696 GACCGTGAGCAGGAGGAGGCTGG + Intronic
919939464 1:202276362-202276384 CAGCCAGAGGTGGCGGAGGGAGG - Exonic
920007672 1:202845232-202845254 CAGCCTGAGGAGCAGGCTGGGGG - Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920124511 1:203682977-203682999 CAGCGAGAGGAGGAAGAGGATGG - Exonic
920211664 1:204332996-204333018 CCACCTAGGGAGGAGGAGGCAGG + Intronic
920348469 1:205321881-205321903 CACGCCGAGGGGGAGGAGGCGGG - Intergenic
920394133 1:205631690-205631712 CAGCGTGAGGAGGAGGCTGAGGG - Exonic
920408764 1:205741050-205741072 CCGCCTCAGGAGGCCGAGGCGGG + Intronic
920829316 1:209450609-209450631 CGGCCTGGCGAGGAGCAGGCTGG - Intergenic
920894163 1:210027514-210027536 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
920901627 1:210114874-210114896 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
921021997 1:211244376-211244398 TGGTCTGAGGAGGAGGAAGCAGG - Intergenic
921060249 1:211578958-211578980 CAGCCGGAGCAGGAGCAGGAGGG + Intergenic
921945405 1:220882763-220882785 CAGCAGGAGGAGGAGGAAGGAGG - Intronic
922013951 1:221623833-221623855 CAGCCTTGGGAAGCGGAGGCAGG - Intergenic
922363647 1:224844549-224844571 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
922368298 1:224886350-224886372 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922723853 1:227913607-227913629 AAGGCTGAGGAGGAGGAGGGAGG + Intergenic
922801614 1:228367200-228367222 CGGCTTGAGGAGGGGCAGGCAGG + Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923055820 1:230425657-230425679 GAGCCGGAGGAGGACGAGGCCGG - Intronic
923109515 1:230879771-230879793 CTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109528 1:230879808-230879830 CTGATTGAGGAGGGGGAGGCCGG - Intergenic
923211132 1:231805470-231805492 CGGCCAGAGCAGGAGGAGGGGGG + Intronic
923237846 1:232051650-232051672 GAGACAGAGGAGGAGGAGGTAGG + Intergenic
923257365 1:232233255-232233277 CAGCCTGGGGAGGAAGGGACAGG + Intergenic
923299719 1:232630084-232630106 GAGCGAGAGGAGGAGGAGGACGG - Intergenic
923548976 1:234946245-234946267 CAGCTTGGGGAGGCTGAGGCAGG + Intergenic
923962702 1:239103014-239103036 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
924226313 1:241924580-241924602 TAGGCTGAGGAGGAAGAGGAAGG - Intergenic
924383417 1:243483194-243483216 GAGCCCGGGGAGGAGGCGGCGGG + Intronic
924403647 1:243718559-243718581 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
924455470 1:244215562-244215584 GAGGCGGAGGAGGAGGAGCCGGG + Intergenic
1062766968 10:73686-73708 CAGCCTGAGGTCGAGGAAACGGG - Intergenic
1063069337 10:2645046-2645068 CAGCCTGAGTACGAAGAGACAGG + Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063173371 10:3529760-3529782 CAGTCAGAGGAAGAGGAGGAGGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063386654 10:5620245-5620267 CAGGCTGTGGGGGAGGTGGCTGG + Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063503826 10:6579300-6579322 CAGGCTGAGGGGGACTAGGCTGG - Intronic
1063690310 10:8280946-8280968 CACCCTGAGATGGTGGAGGCAGG + Intergenic
1063714456 10:8513640-8513662 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064803222 10:19099872-19099894 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
1064887087 10:20123215-20123237 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
1064979670 10:21153430-21153452 GAGGCTGAGGAGGCTGAGGCTGG - Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1065099793 10:22321484-22321506 GCGCCGGAGCAGGAGGAGGCCGG + Exonic
1065114896 10:22476011-22476033 AAGCATGAGCAGGAAGAGGCTGG + Intergenic
1065127941 10:22592426-22592448 GTGCCCCAGGAGGAGGAGGCAGG + Intronic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065363836 10:24915741-24915763 CAGTCTGAGGAGGAGCAACCAGG - Intronic
1065437547 10:25718078-25718100 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1065443281 10:25773260-25773282 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065610443 10:27466742-27466764 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1065643164 10:27805547-27805569 CAGCAAGACAAGGAGGAGGCAGG + Intergenic
1065739080 10:28780597-28780619 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1065771830 10:29085106-29085128 CTACCTGAAGAGGTGGAGGCAGG + Intergenic
1066000890 10:31103266-31103288 CTGGCTGTGGAGGAGCAGGCAGG + Intergenic
1066563379 10:36693478-36693500 CAGCCTTTGGAGGCCGAGGCGGG + Intergenic
1067360291 10:45572764-45572786 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067528143 10:47050730-47050752 AGGCCTGAGGAGGAGGAGAGGGG - Intergenic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1067909641 10:50332870-50332892 AAGACAGAGGAGGTGGAGGCAGG - Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068744415 10:60513985-60514007 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069362896 10:67663549-67663571 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
1069410261 10:68146195-68146217 CAGCCTGAGGTGGGGAAGGAAGG - Intronic
1069422544 10:68260348-68260370 AAGCCCCAGGAGGATGAGGCTGG - Intergenic
1069774179 10:70917291-70917313 GAGACTGAGGAGGAAGAGGAGGG - Intergenic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069915600 10:71784862-71784884 CAGTCAGAGAAGGAGGAGGGAGG - Intronic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070151804 10:73809981-73810003 CAGACTCAGGAGGCTGAGGCCGG - Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070404904 10:76085970-76085992 AAGCATGAGAAGGAGGAGGTGGG - Intronic
1070657407 10:78280956-78280978 CTGCCTGAGGAGGAGTGGCCTGG + Intergenic
1070833073 10:79432100-79432122 CAGGCTGAGGAGGCAGAGGTGGG + Intronic
1070877380 10:79826362-79826384 CAGGCGGAGGAGGAAGCGGCGGG + Intergenic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1070955568 10:80461216-80461238 CAGCCTCAAGAAAAGGAGGCAGG - Intronic
1070961889 10:80505251-80505273 CAGCCTCAGGAGGAGAGGGGAGG + Intronic
1070981189 10:80649557-80649579 GAAGCTGAGGAGGAGGAGGCTGG + Intergenic
1071480156 10:86059042-86059064 GCTCATGAGGAGGAGGAGGCAGG + Intronic
1071529535 10:86378073-86378095 TGGCCTGAGGAGGAGGACACTGG - Intergenic
1071573659 10:86711312-86711334 CAGCCCGGGAAGGAGGAGGAAGG - Intronic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1071643875 10:87342406-87342428 CAGGCGGAGGAGGAAGCGGCGGG + Intergenic
1071821642 10:89286318-89286340 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072273625 10:93801410-93801432 AAGACTGAGGAGGAGGACACGGG + Intergenic
1072328271 10:94319979-94320001 CACCCTTAGGAGGCTGAGGCAGG - Intronic
1072618000 10:97062581-97062603 CAGGGTGAGGAGGAGTCGGCAGG + Intronic
1072884427 10:99261238-99261260 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073013795 10:100382299-100382321 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073093794 10:100967953-100967975 AAGTCTGAGAAGGAGGAAGCAGG - Intergenic
1073100530 10:101004040-101004062 CATCCGAAGGAGGTGGAGGCGGG - Exonic
1073125662 10:101147209-101147231 CTCCCTGGGGAGGAGGAGCCAGG - Intergenic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1073433279 10:103500654-103500676 AAGCGTAAGGGGGAGGAGGCTGG - Intronic
1073513424 10:104056930-104056952 CAGCCTGTGTGGTAGGAGGCAGG - Intronic
1073656654 10:105424198-105424220 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1073897025 10:108173569-108173591 AAGTCTGAGGAGGAGAAGGGTGG - Intergenic
1073991702 10:109268811-109268833 TAGCCTGAGGAGTGGGAGGATGG + Intergenic
1074107193 10:110397343-110397365 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074416673 10:113273096-113273118 CAGGCTGAGGAGCACTAGGCAGG - Intergenic
1074583199 10:114740919-114740941 CACTCTCAGGAGGATGAGGCAGG + Intergenic
1074740682 10:116482304-116482326 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1074813880 10:117130575-117130597 CAGGCCTTGGAGGAGGAGGCAGG - Intronic
1074856885 10:117480413-117480435 CAGCCTGGAGAGGTGGAAGCAGG - Intergenic
1075077321 10:119359974-119359996 GAGGCTGAGGAGGCGGAGGGAGG + Intronic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1075288177 10:121205021-121205043 CAGACAGAGGTGGAGGTGGCAGG - Intergenic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1075795176 10:125115094-125115116 CAGCCTCAAGAGGAGGCAGCAGG - Intronic
1076005397 10:126944613-126944635 AAGCCTGAGGAGGAAGTGACTGG + Intronic
1076028679 10:127139681-127139703 CAGCATCAGGTGGAAGAGGCAGG - Intronic
1076280572 10:129242925-129242947 CAGCATGAGGATGAGGCTGCTGG - Intergenic
1076302879 10:129441327-129441349 CAGTCTCAGGACGAGGAGCCAGG - Intergenic
1076467869 10:130697444-130697466 CAACCTGAGGAAGAGGATTCTGG + Intergenic
1076562452 10:131376048-131376070 CAGCCTGAGGAGAAGAAGGTGGG - Intergenic
1076569056 10:131420420-131420442 CAGCAGGAGGAAGAGGAGGGCGG - Intergenic
1076624454 10:131812919-131812941 CATCCCGAGGAGGTGGGGGCTGG - Intergenic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076992256 11:281547-281569 GAGCCAGAGGAGGAGGAGGAGGG + Exonic
1077011443 11:380991-381013 CATTCAGAGGAGGAGGACGCAGG - Intronic
1077019144 11:409806-409828 CAGCCTGAGGGGCAGGAGGTGGG + Intronic
1077029729 11:459638-459660 CAGACGTGGGAGGAGGAGGCAGG - Intronic
1077057603 11:602566-602588 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1077104442 11:836050-836072 CATCCTGGGGCTGAGGAGGCAGG - Exonic
1077177068 11:1195808-1195830 GAGCCTGACGTGGAGCAGGCAGG + Intronic
1077259390 11:1607760-1607782 CAGCCTGAGGAGCAGCAGCAGGG + Exonic
1077259404 11:1607847-1607869 CAGCCTGAGGAGCAGCAGCAGGG + Exonic
1077259423 11:1607964-1607986 CAGCCTGAGGAGCAGCAGCAGGG + Exonic
1077261106 11:1621498-1621520 CAACCTGAGGAGGAGCAGCAGGG + Exonic
1077261120 11:1621585-1621607 CAACCTGAGGAGGAGCAGCAGGG + Exonic
1077262539 11:1630324-1630346 CAGCCTGAGGAGCAGCAGCAGGG - Exonic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077410727 11:2402793-2402815 CTGCCTGGGGAGGAGGATTCAGG + Exonic
1077412168 11:2408693-2408715 CAGCCTGCGGGGCAGGAGGAGGG + Intronic
1077521735 11:3040061-3040083 TAGACTGAGGAGGAGAAGGGGGG - Intronic
1077612099 11:3649575-3649597 CAGCCTGGCGAGGAGCAGCCTGG - Intronic
1077730249 11:4722693-4722715 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
1077811478 11:5642271-5642293 GAGCCTGAGGAGGGGGAGAAGGG - Intronic
1078191609 11:9095965-9095987 CAGCCGCAGGAGGGGCAGGCTGG - Intronic
1078522603 11:12075421-12075443 TAGCCTGAGATGGAGGTGGCAGG + Intergenic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079230424 11:18644661-18644683 CAGCCTGGGGAGAAGGAGAGAGG - Intergenic
1079249158 11:18774507-18774529 TACTCTGAGGAGGAGGGGGCTGG + Intronic
1079320582 11:19448237-19448259 CTGCCTGAGGAGGTGTGGGCAGG + Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079410485 11:20182853-20182875 CAGACAGAAGAGGAGAAGGCTGG - Intergenic
1079727164 11:23891242-23891264 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080640345 11:34154902-34154924 CAGCCTGAGCAGGAGAGGGAGGG - Intronic
1080684627 11:34504847-34504869 CAGGCTGAGAAAGAGGAGGGAGG + Intronic
1080882197 11:36332742-36332764 CAGCAGGAGGAGGAGGTGCCAGG - Intronic
1081159565 11:39735672-39735694 CAACCTGAGGAGGAGCAGTCTGG - Intergenic
1081629266 11:44677582-44677604 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1081649885 11:44816815-44816837 CCTCCTGAGCAGGAGGAGCCTGG + Intronic
1081831782 11:46120995-46121017 AAGCAGGAGGAGGAGGAGGAGGG + Exonic
1081906036 11:46670695-46670717 CTGCCTTGGGAGGTGGAGGCAGG + Intronic
1081968937 11:47185576-47185598 CAGCCAAAGCGGGAGGAGGCAGG + Intronic
1082053635 11:47794361-47794383 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1083227405 11:61293960-61293982 CAGCCTGAGAAGGAGGGGACCGG + Intronic
1083259334 11:61514714-61514736 CAGCCTGAGGTGTGGGAAGCTGG - Intergenic
1083473555 11:62900669-62900691 CAGATTTAAGAGGAGGAGGCTGG + Intergenic
1083751955 11:64765922-64765944 GAGGCGGAGGAGGAGGGGGCGGG + Intronic
1083851872 11:65372798-65372820 ACGCATGAGGAGGAGGAGGTGGG - Intergenic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084094592 11:66902706-66902728 CAGCTGGAGGAGGAAGAGGAGGG - Intronic
1084192563 11:67505460-67505482 CCGCCTGCAGCGGAGGAGGCAGG + Intronic
1084232217 11:67761357-67761379 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1084266936 11:68010024-68010046 CAGCCTGAGGAGGAGGAGTGGGG - Intronic
1084322955 11:68383784-68383806 TTTCCTGAGGAGGAGGTGGCGGG + Intronic
1084355457 11:68635368-68635390 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1084374150 11:68764475-68764497 CAGCCTGGGGAAGGGGAAGCCGG + Intronic
1084389118 11:68863488-68863510 CTGCCTGGGGAGGGGGTGGCAGG - Intergenic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084654108 11:70505377-70505399 CAAGCTGAGATGGAGGAGGCAGG + Intronic
1084724769 11:70934370-70934392 CGGCCTGAGAAGCAGGAGGGAGG - Intronic
1084798822 11:71527598-71527620 CAGCCTGAGGAGCAGCAGCAGGG - Exonic
1084801826 11:71549054-71549076 CAGCCTGAGGATGAGCAGCAGGG - Exonic
1084803971 11:71566026-71566048 CAGCCTGAGGAGCAGCAGCAGGG - Exonic
1084806452 11:71582548-71582570 CAGCCTGAGGAGGAGCAGCAGGG + Exonic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085508704 11:77074500-77074522 CTGGCTGATGAGGAGGGGGCTGG - Intronic
1085699033 11:78729820-78729842 AAGCAGGAGGAGGAGGAGGAAGG + Intronic
1085934173 11:81123473-81123495 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1086133063 11:83420752-83420774 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1086165219 11:83769916-83769938 CAGACTTAGGAAGAGGAAGCAGG - Intronic
1086550109 11:88044807-88044829 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1086573022 11:88306631-88306653 CAGCCAGAGAAGGAGGATGGAGG - Intronic
1087099009 11:94347344-94347366 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1087127725 11:94643261-94643283 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087314588 11:96589583-96589605 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1087743428 11:101915207-101915229 GAGCAGGAGGAGGAGGAAGCCGG + Exonic
1088449385 11:109965637-109965659 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1088996155 11:114999070-114999092 GAGGCTGAGGAGGCAGAGGCAGG + Intergenic
1089346572 11:117795399-117795421 CAGCCTGCGGGGGCGGAGGGAGG + Intronic
1089472173 11:118730202-118730224 CAGCCTGGGGAGGAGCAGCCTGG + Intergenic
1089472181 11:118730217-118730239 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089535467 11:119158342-119158364 CAGGCTGGGGGAGAGGAGGCTGG + Intronic
1089541134 11:119189545-119189567 CAGCCTGAGGTGGTGAAGGCAGG + Exonic
1089599141 11:119602818-119602840 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1089854677 11:121532795-121532817 CAGACTCAGGAGGCTGAGGCAGG - Intronic
1089987347 11:122826278-122826300 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1090014465 11:123073715-123073737 GAGCCTGAGGAAGAGGAGCTGGG + Exonic
1090020959 11:123127923-123127945 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1090273065 11:125401356-125401378 CAGCCAGGGTACGAGGAGGCGGG + Intronic
1090309276 11:125720435-125720457 CAGCCTGAGCAGGAGGAACTGGG - Intergenic
1090359014 11:126159991-126160013 CAGCTTTAGAAGGAGGAGGCTGG - Intergenic
1090409171 11:126495787-126495809 CAGCCTGAGGATCAGGACACTGG + Intronic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1090976852 11:131686567-131686589 GAGGCAGAAGAGGAGGAGGCAGG + Intronic
1091183576 11:133628443-133628465 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1091300452 11:134503929-134503951 AGACCTGGGGAGGAGGAGGCTGG + Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1092065622 12:5587817-5587839 CAGCCTGAGGAGGTGCATGGGGG - Intronic
1092225347 12:6744843-6744865 TAGCCTGAGGGAGAGGAGCCTGG - Intergenic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092393247 12:8100522-8100544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1092590498 12:9949236-9949258 AAGCCTGCAGAAGAGGAGGCAGG - Intergenic
1092626829 12:10336967-10336989 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
1092626837 12:10336982-10337004 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1092723798 12:11466209-11466231 CAGCCTGGCGAGGAGCAGCCTGG + Intronic
1092739409 12:11613734-11613756 CAGCCTGGTGAGGAGCAGCCTGG + Intergenic
1092901377 12:13062676-13062698 CTTACTGAGGAGGAGGAAGCAGG - Intronic
1092986613 12:13851925-13851947 TAGGCAGAGGAGGAGGAGGGTGG + Intronic
1093024229 12:14232216-14232238 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093302130 12:17471199-17471221 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1093429603 12:19069770-19069792 TAGCCTCAGGAGGCTGAGGCAGG + Intergenic
1093812938 12:23510090-23510112 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1094167801 12:27460573-27460595 TAGACTGAGGAGGAGAAGCCGGG + Intergenic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1095243233 12:39885839-39885861 AATCCTGGGTAGGAGGAGGCTGG - Intronic
1095516183 12:43007926-43007948 CAGCATGAAGAGGAAAAGGCAGG + Intergenic
1095603889 12:44044594-44044616 CAGGCTGAGGGAGAGAAGGCAGG - Intronic
1095696188 12:45146838-45146860 AAGGCTGAGGAGGATGAAGCAGG - Intergenic
1095999176 12:48114544-48114566 CGACCTGAGGAGGAGCAGTCTGG + Intronic
1096088485 12:48882640-48882662 CAGCCTGAGGTGGAGCAGAGAGG + Intergenic
1096255346 12:50058776-50058798 AAGGCCGAGGAGGAGGAGGTGGG + Exonic
1096288745 12:50323226-50323248 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096377384 12:51124553-51124575 CAGCCTGCGGAGGTGCAGGCAGG + Intronic
1096502125 12:52070414-52070436 GGGCGTGAGGAGGAGGAGGAAGG + Exonic
1096538105 12:52288204-52288226 AAGCCTGAGGAGGTGGAGTCAGG - Intronic
1096540672 12:52305162-52305184 AAGCCTGAGGAGGTGGAGTCAGG + Intronic
1096631522 12:52929785-52929807 TGGCCTGAAGAGGTGGAGGCAGG - Intronic
1096632695 12:52938971-52938993 GCTCCTGAGGAGGATGAGGCAGG + Intronic
1096736046 12:53655742-53655764 GAGCCTGAGGAGGATGAAGAAGG - Intronic
1096778211 12:53976487-53976509 GCGGCGGAGGAGGAGGAGGCAGG + Exonic
1096785155 12:54013107-54013129 AAGGCTGAGGAGGAGGAGGGTGG - Intronic
1096863939 12:54550026-54550048 GAGCCTGAGCGGGAGGAGGAGGG + Intronic
1096907272 12:54946989-54947011 CGACCTGAGGAGGAGCAGTCTGG + Intergenic
1097533892 12:60840492-60840514 CAGGCTGAGGAGGAGTAAGAAGG - Intergenic
1097592294 12:61588518-61588540 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1097694089 12:62760392-62760414 CAGCCTGGGGAGGAGGTGAGAGG - Intronic
1097871805 12:64608557-64608579 ACGCCTGAGGAGGCAGAGGCGGG - Intergenic
1097883223 12:64704872-64704894 GATCTTGAGGAGGAGGAGGAGGG + Intergenic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098070730 12:66671492-66671514 CAGCCTGTGGGGGTGGAGGGCGG - Intronic
1098161112 12:67648894-67648916 CCGCCCGAGGAAGAGGAGGACGG + Exonic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098630123 12:72712958-72712980 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1098653922 12:73006048-73006070 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1098749877 12:74279859-74279881 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1098919807 12:76293088-76293110 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1099697990 12:86045050-86045072 GGGCCAAAGGAGGAGGAGGCTGG - Intronic
1099836190 12:87911456-87911478 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102569354 12:113818112-113818134 CAGCCTTGGGAGGCTGAGGCGGG + Exonic
1102604329 12:114057125-114057147 CGACCTGAGGAGGAGCAGTCTGG - Intergenic
1103188530 12:118981405-118981427 GAGCCTGAGGAGGAGGGGGTTGG + Intergenic
1103346861 12:120256967-120256989 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1103396560 12:120611717-120611739 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1103518131 12:121520669-121520691 CCACGTGAGGAGGAAGAGGCAGG + Intronic
1103622007 12:122192862-122192884 GAGTCTGAGGTGGAGGAGTCAGG + Exonic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103845528 12:123899437-123899459 CAGCAGGAGAAGGAAGAGGCAGG - Intronic
1103851864 12:123938602-123938624 CAGCGTTAGGAGGAGTAGGATGG - Intronic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1104100737 12:125606718-125606740 CTGCCTGAGGAGGAGGCAGGAGG - Intronic
1104120808 12:125797976-125797998 CAGCCAGAGCAGGATGGGGCTGG - Intergenic
1104617810 12:130285010-130285032 CAGGCTGAGGTGGAGGTGGGGGG + Intergenic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104819068 12:131664515-131664537 GAGGCAGAGGAGGAGGAGCCAGG - Intergenic
1104951401 12:132442193-132442215 AAGCCTGAGGAGTGGGTGGCCGG - Intergenic
1104959942 12:132483877-132483899 CAGACTGAGGAGGCAGAGGCGGG - Intergenic
1105032076 12:132890974-132890996 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1105402242 13:20105876-20105898 CAGCCCCAGCTGGAGGAGGCTGG - Intergenic
1105430751 13:20335068-20335090 CAGCCTGAGGAGTCACAGGCTGG - Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1105546613 13:21355445-21355467 TAGCCTGGGGAGGGGGAGGAGGG + Intergenic
1105717527 13:23082093-23082115 TTGCCTGAGGAGGAGGAAGAAGG - Intergenic
1105740147 13:23315450-23315472 CAGGCTGGGGAAGAGAAGGCAGG - Intronic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106526120 13:30542654-30542676 GAGCCTGAGGAACAGGAGGAGGG - Intronic
1106526434 13:30544751-30544773 GAACCTGAGGAGAAGGAGGTGGG + Intronic
1106558997 13:30832945-30832967 TAGCCAGGGCAGGAGGAGGCTGG - Intergenic
1106570039 13:30918583-30918605 CATTCTGAGCAGGAGGAGGAAGG - Intronic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107374854 13:39792547-39792569 TAGGCTGAGGAGGAGGAGAAAGG + Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107644628 13:42481005-42481027 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
1107890060 13:44906257-44906279 TAGCAGGAGGAGGAGGAGGGAGG + Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108036640 13:46297023-46297045 CAGCGTGTGGAGGATGAGCCTGG - Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108210522 13:48135263-48135285 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1108493831 13:51005486-51005508 GAGCCTGAGAAAGAGGAGGGAGG - Intergenic
1109343498 13:61089999-61090021 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1109499205 13:63214781-63214803 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1110318220 13:74134372-74134394 CCGCCCGAGGATTAGGAGGCGGG + Intergenic
1110765378 13:79275792-79275814 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1110854504 13:80281405-80281427 CATCCTGAGCAGGACGAAGCAGG + Intergenic
1110978388 13:81867797-81867819 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1111057771 13:82972756-82972778 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1111165058 13:84447680-84447702 AAGCCAGAGCAGGTGGAGGCTGG + Intergenic
1111362207 13:87190514-87190536 CACCCTGGGGAGGAGCAGCCTGG + Intergenic
1111362216 13:87190529-87190551 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1111406259 13:87810968-87810990 CAGCGGGAGGAGGCGGAGGTTGG - Intergenic
1112402076 13:99086361-99086383 CAGGCGGAGGCGGAGGCGGCGGG - Intronic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1112505248 13:99971153-99971175 GGGCAGGAGGAGGAGGAGGCGGG + Exonic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1112701774 13:102018411-102018433 GAGCCAGAGGAGGAAGAGGAAGG - Intronic
1113619349 13:111702388-111702410 CAGCATGAGGAGGACGTGGGAGG + Intergenic
1113624878 13:111787649-111787671 CAGCATGAGGAGGACGTGGGAGG + Intergenic
1113679310 13:112231789-112231811 CAGCCAGAGGAGGCAGACGCCGG + Intergenic
1113679500 13:112233404-112233426 GACCCTGAGGAAGAGGACGCTGG - Intergenic
1113694863 13:112337824-112337846 AAACCTCAGGAGGAGGAGGAAGG - Intergenic
1113900280 13:113793108-113793130 CTGCCTGGGGAGGTGGAGGGGGG + Intronic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114620339 14:24092648-24092670 GAGCCTGAGGGGGAAGAGACGGG + Intronic
1114771151 14:25429786-25429808 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1115613638 14:35072401-35072423 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1115645691 14:35367227-35367249 GAGCCTGAGGTGGAGGGGCCTGG + Intergenic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1116490686 14:45499473-45499495 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1116534868 14:46016457-46016479 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1116613420 14:47105831-47105853 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1116613428 14:47105846-47105868 CAGCCTGGCGAGGAGCAGCCTGG - Intronic
1117100022 14:52335919-52335941 CAGCTTGAGCAGGAAGAGGGAGG + Intergenic
1117174062 14:53130080-53130102 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1117174070 14:53130095-53130117 CAGCCTGGCGAGGAGCAGCCTGG - Intronic
1117535996 14:56704028-56704050 CACCCTGAGTAGTAGGAGGATGG + Intronic
1117804108 14:59472471-59472493 CAGCCTGGGAAGGATGGGGCTGG - Intronic
1118028181 14:61791989-61792011 CAGGCTCAGGAGGCAGAGGCAGG + Intronic
1118122411 14:62859900-62859922 CAGGCTGGGGAAGAGAAGGCAGG + Intronic
1118199098 14:63655682-63655704 CAGGCTGAGAAGGCTGAGGCAGG + Intergenic
1118355933 14:65013792-65013814 GAGCCTCAGGAGGCTGAGGCAGG - Intronic
1118607445 14:67514537-67514559 CACCCTGGGGAGAAGGCGGCGGG + Intronic
1118708867 14:68503421-68503443 CAGCCTCTGGAGGAGGGGGAAGG - Intronic
1118739439 14:68728578-68728600 TAGCCTGTGGAGGCTGAGGCTGG + Intronic
1118937389 14:70300245-70300267 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1118950726 14:70434315-70434337 CAGGCTGCGGGAGAGGAGGCAGG + Intergenic
1119022335 14:71125952-71125974 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1119046442 14:71321544-71321566 CAGCCTGAGCTGGAGTAGGCAGG + Intronic
1119317108 14:73705150-73705172 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1119560425 14:75585077-75585099 CAGCCTGGCGAGGAGCAGCCTGG + Intronic
1119755885 14:77119261-77119283 CTGGCTGAGGAGGCTGAGGCAGG - Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1120216386 14:81684955-81684977 CAGCCTAGAGAGGTGGAGGCAGG - Intergenic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120438148 14:84504260-84504282 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1120660051 14:87239077-87239099 CAGCCTGAGGAGGAGGGGAGAGG + Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121144616 14:91573637-91573659 CTGGCAGGGGAGGAGGAGGCTGG + Intergenic
1121193398 14:92048782-92048804 CAGCCTGGTGAGGAGCAGCCTGG + Exonic
1121272286 14:92645838-92645860 CAACCTCAGGAGGTTGAGGCAGG + Intronic
1121332080 14:93055971-93055993 CAGCCTGATGAGGCTGGGGCAGG + Intronic
1121408896 14:93735801-93735823 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1121434539 14:93910527-93910549 CAGCCTGGGGAGGATGTGGTGGG - Intergenic
1121700846 14:95953084-95953106 GGGCCTGAGGCTGAGGAGGCTGG - Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122182834 14:99968291-99968313 CAGCCTGTGGTGGGGGAGGGTGG + Intergenic
1122321514 14:100858611-100858633 CAGGCTGAGAAAGAAGAGGCGGG - Intergenic
1122348994 14:101077117-101077139 CAGCCCGAGGTGGAGGCGGAGGG + Intergenic
1122381423 14:101309733-101309755 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1122814937 14:104307653-104307675 CAGCCTGGGCAGGAGAGGGCCGG + Intergenic
1122972434 14:105157900-105157922 TGGCCTGAGGATGAGGAGGGTGG - Intronic
1123016896 14:105380061-105380083 CAGCCTGTGGGGGAGGAGATGGG - Exonic
1123572339 15:21626376-21626398 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1123608954 15:22068963-22068985 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1123677820 15:22729218-22729240 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1123814761 15:23965423-23965445 GAGCTTGCGCAGGAGGAGGCAGG - Intergenic
1123882580 15:24689604-24689626 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1124177320 15:27438634-27438656 CACCCGGAGGAGCAGGAGGCGGG - Intronic
1124239337 15:28017051-28017073 CAGCCTGGGGAGCGGGGGGCGGG + Intronic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1125629080 15:41132795-41132817 CGACCTGAGGAGGAGTAGTCTGG - Intergenic
1125720671 15:41843730-41843752 CTTCCTGAGCAGGAGGAAGCAGG + Exonic
1125758434 15:42081538-42081560 CTTCCTGAGCAGGAGGAAGCAGG - Exonic
1125934817 15:43626031-43626053 CAGCCTCAGGAGGCTGAGACAGG - Intergenic
1126120166 15:45244506-45244528 TAGGCTGAGGAGGAGAAGGAAGG + Intergenic
1126283642 15:46986547-46986569 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1126473581 15:49042914-49042936 CAGCTTCAGGAGGCTGAGGCAGG + Intronic
1126530249 15:49703199-49703221 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1126758340 15:51946299-51946321 CAGCCTCAGGAGACTGAGGCAGG - Intronic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1127225086 15:56919263-56919285 GAGCCTGGGGAGGAGGACGCCGG + Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127515512 15:59689369-59689391 CAGCCGGCGGTGGAGGCGGCGGG + Exonic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128094487 15:64943659-64943681 CACCCTGAGAAGGAGGAGGGAGG - Intronic
1128113798 15:65093228-65093250 CTGCCTGAGGAAGAGGAGACAGG + Exonic
1128313765 15:66647432-66647454 CAGCCTGGGGAGCTGGCGGCAGG - Intronic
1128371405 15:67042238-67042260 CTACCTGAGGAGGGGGAGGGGGG + Intergenic
1128425950 15:67542704-67542726 CGGCGAGAGGAGGAGGAGGAAGG - Exonic
1128757282 15:70191575-70191597 CAGCATGGCCAGGAGGAGGCGGG + Intergenic
1128998690 15:72315924-72315946 CAGCCTGAGGAGGAAGAGGCTGG + Exonic
1129161651 15:73751295-73751317 CACCCAGAGGCAGAGGAGGCTGG - Exonic
1129169938 15:73801499-73801521 CAGCCTCAGTTGGAGGAGACGGG - Intergenic
1129180126 15:73868935-73868957 CACCCTCAGGATGAGGACGCTGG + Intergenic
1129191379 15:73939588-73939610 CTGCCTGGGGTGGCGGAGGCGGG + Intronic
1129288418 15:74544204-74544226 GAGCCTGAGGAAGAGGACGGAGG + Exonic
1129296974 15:74604935-74604957 CAGCCACAGGAGCAGGATGCAGG - Intronic
1129333286 15:74838571-74838593 CAGCCTGAGGGGGAGGCGGGTGG - Intronic
1129389530 15:75213701-75213723 CAGTCTGAGGTGGTGGGGGCAGG + Intergenic
1129406306 15:75320854-75320876 CAGCCAGATGAGGTGGAGGTTGG + Intergenic
1129462783 15:75708223-75708245 CAGCCTGTGGAGGAGGCCGCTGG - Intronic
1129591634 15:76920340-76920362 CAGACTGAGGAAGAGGATTCAGG + Intergenic
1129722091 15:77883193-77883215 CAGCCTGTGGAGGAGGCCGCTGG + Intergenic
1129788128 15:78322707-78322729 CAGCCTCAGGAGGAAAAGGGGGG + Intergenic
1130110342 15:80958925-80958947 CAGGCTAAGGAAGAGAAGGCTGG + Intronic
1130243649 15:82221931-82221953 CAGCCTGGGGAAGAGAAGGAAGG - Intronic
1130456826 15:84119350-84119372 CAGCCTGGGGAAGAGAAGGAAGG + Intergenic
1130855031 15:87832946-87832968 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132105401 15:99059325-99059347 CCGCGGGAGGAGGGGGAGGCCGG - Intergenic
1132340315 15:101074195-101074217 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1202981195 15_KI270727v1_random:360763-360785 CAGCCTGAGGAAGATGACGCAGG + Intergenic
1132456012 16:23319-23341 CAGCCTGAGGCCGAGGAAACAGG + Intergenic
1132475979 16:138363-138385 GGGCCTGAGGAGGACGAGGCGGG + Exonic
1132490116 16:223916-223938 CGGGAGGAGGAGGAGGAGGCGGG - Intronic
1132532911 16:462479-462501 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132833312 16:1940373-1940395 CACTCTGCAGAGGAGGAGGCAGG + Intronic
1132890054 16:2199381-2199403 CAGCCTGGGGATGGGGGGGCAGG + Intergenic
1133041059 16:3059873-3059895 TGGCCTGGGGAGGAGGAGGTGGG - Exonic
1133102220 16:3486397-3486419 CAGCCTGAGGAGGAGGGAGAGGG + Exonic
1133103637 16:3493765-3493787 CAGCCTGAGCAGGAGGGGCTCGG - Exonic
1133132737 16:3687737-3687759 CAGCCAGAGGCTGAGGAGGAAGG + Intronic
1133159540 16:3901285-3901307 CAGCTTCAGGAGGCTGAGGCTGG + Intergenic
1133651307 16:7816361-7816383 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1133938083 16:10284787-10284809 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134048788 16:11122219-11122241 GATCCTGAAGAAGAGGAGGCTGG - Intronic
1134060005 16:11193696-11193718 CAGGATGAGGAGGAAGAGGGAGG - Intergenic
1134562016 16:15219043-15219065 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1134649585 16:15898158-15898180 GAGGTTGAGGAGGAGGAGGAGGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134922554 16:18130669-18130691 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1135020856 16:18961854-18961876 GAGCATGAGAAGGAGGAGGCAGG - Intergenic
1135186588 16:20321160-20321182 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1135258097 16:20957693-20957715 TAGCCTCAGGAGGCCGAGGCAGG + Intronic
1135275717 16:21110757-21110779 CAGACTTAGGAGGTTGAGGCAGG + Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135548189 16:23379561-23379583 CAGCCTGAGGACGATCAGGTGGG + Intronic
1135729811 16:24884595-24884617 CAGCTTGGGGAGGCTGAGGCAGG - Intronic
1135834350 16:25811288-25811310 TAGGCTGAGGAAGAGGAGGAAGG - Intronic
1135994563 16:27238328-27238350 CTGCCAGAGGATCAGGAGGCTGG - Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136415108 16:30098185-30098207 TAGCCTGAGGTGGGGTAGGCGGG - Intergenic
1136477712 16:30524048-30524070 AAGCCTGAGGAAGAAGAGGGAGG + Exonic
1136498514 16:30658448-30658470 TAGGCTGAGGAGGAAGAGGGAGG + Exonic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1137363338 16:47840162-47840184 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1137622343 16:49884168-49884190 TTGCCAGAGGAGGAGGACGCTGG + Intergenic
1137666745 16:50254251-50254273 GAGCCTGCGGAAGCGGAGGCAGG - Intronic
1137684250 16:50374780-50374802 GAGACTGAGGAGGGGGAGGGAGG + Intergenic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1138204969 16:55118045-55118067 CGGCCTCAGGAGGAGGTGGTGGG - Intergenic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1138759198 16:59521692-59521714 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1138804861 16:60080507-60080529 CGGCCTGGGGAGGAGCAGCCTGG - Intergenic
1139482732 16:67239478-67239500 GAGACTGAGGAAGAGGTGGCAGG + Intronic
1139608801 16:68039922-68039944 TAGCCTGAGGTGGAGGAAGCAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139964304 16:70737060-70737082 CAGGCTCAGGAGGAGGAGATGGG + Intronic
1140159804 16:72477172-72477194 CATCCTGAGAGGGAGGAAGCTGG - Intergenic
1140194901 16:72847881-72847903 AAGCCCGAGGGGGAGGAGGCTGG + Intronic
1140299057 16:73738786-73738808 CAGCCTGTAGAGAAGGGGGCAGG - Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1140753645 16:78048441-78048463 CAGCCTCAGGACGGGCAGGCTGG + Intronic
1141195887 16:81860863-81860885 CAGCCTCAGGAGGCTGAGGCAGG + Intronic
1141632505 16:85296056-85296078 CAGGCTGAGAACCAGGAGGCCGG + Intergenic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1141842652 16:86584053-86584075 CAGGCTGAGGGGGCAGAGGCAGG - Intergenic
1141865300 16:86746075-86746097 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1141964004 16:87429184-87429206 CAGCCTGAGGTGGGTGGGGCCGG + Intronic
1141981104 16:87550970-87550992 CACACGGAGGTGGAGGAGGCGGG - Intergenic
1142062937 16:88042342-88042364 CAGCTCGGGGAGGAGGAAGCTGG - Intronic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142212077 16:88813110-88813132 GAGCCTTCGGAGGGGGAGGCCGG + Intergenic
1142218972 16:88843673-88843695 GAGCCTGAGGGGGAGGGGCCCGG + Intronic
1142248141 16:88979098-88979120 CGGCCTGGGGGAGAGGAGGCCGG - Intergenic
1142269163 16:89080158-89080180 GGGCCTGAGGAGGAGGAGTGTGG + Intergenic
1142285893 16:89171423-89171445 GAGCCAGAGGAGGATGGGGCGGG - Intergenic
1142400434 16:89855695-89855717 GCCCCTGAGGAGGAGGAGGCTGG - Intronic
1142427678 16:90009334-90009356 ACGCCTGTGGAGGAGGAGGTCGG - Exonic
1142442274 16:90106546-90106568 GGTCCTGAGGAGGAGGAGGCTGG - Intergenic
1142478749 17:205198-205220 AGGCAGGAGGAGGAGGAGGCAGG - Intergenic
1142582091 17:949126-949148 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582119 17:949202-949224 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582147 17:949278-949300 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582175 17:949354-949376 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582203 17:949430-949452 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582245 17:949544-949566 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582302 17:949696-949718 CAGCAGGGAGAGGAGGAGGCAGG - Intronic
1142586576 17:978627-978649 CAGCCTGGGGCGGGGGAGGCGGG + Intronic
1142740826 17:1931004-1931026 CAGCCTGGGAAGGAGGAGACCGG + Intergenic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1142852155 17:2709510-2709532 GAGGGGGAGGAGGAGGAGGCTGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143152178 17:4814555-4814577 CAGCATTAGGAGGAGAAGGGGGG + Intronic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143229303 17:5338454-5338476 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1143266830 17:5644275-5644297 CAGTCTGAGGCTGAGGAGGTGGG - Intergenic
1143524328 17:7463394-7463416 CAGGCTCAGGGGGAGGAGGTGGG + Exonic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144074236 17:11702530-11702552 GAGCCAGAGGAGGAGGAAGGAGG + Intronic
1144313868 17:14040081-14040103 AAGCCTGAGAAGGAGGTGGGGGG - Intergenic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145164836 17:20605346-20605368 CGGCCTGGTGGGGAGGAGGCAGG + Intergenic
1145278730 17:21453411-21453433 AAGCTTGAGAAGGAGGAGGGTGG + Intergenic
1145399122 17:22517074-22517096 AAGCTTGAGAAGGAGGAGGGTGG - Intergenic
1145787814 17:27605431-27605453 CAGGCTGAGGAGCCAGAGGCTGG + Exonic
1145963853 17:28903051-28903073 CAGCCTCCGAAGGCGGAGGCGGG + Exonic
1145979552 17:29003732-29003754 AAGCCTGAGGATGAGAGGGCTGG - Intronic
1146265514 17:31450263-31450285 CAGCCTGAGAGGTAGGAGGAAGG - Intronic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146429129 17:32773990-32774012 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1146669007 17:34724022-34724044 CAGGCTGAGCTGGAGCAGGCTGG + Intergenic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147321261 17:39647461-39647483 CCTCCTGATGAGGGGGAGGCAGG - Intronic
1147725555 17:42564331-42564353 GAGTCGGAGGAGGAGGAGCCTGG + Intronic
1147782512 17:42953841-42953863 CAGCCTCAGAAGGAGGGGCCAGG - Intronic
1147860229 17:43516526-43516548 GAGCCTGGGGAGGTCGAGGCTGG - Intronic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148384659 17:47225465-47225487 CTGGCTGAGGAGGAGAGGGCTGG + Intergenic
1148591595 17:48820400-48820422 GAGGCTGAGGAGGCTGAGGCAGG - Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148670268 17:49404961-49404983 CAGCCCGCGGAGGTGCAGGCAGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149319422 17:55469120-55469142 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1149486338 17:57045895-57045917 CCGCGTGGGGAGGCGGAGGCGGG - Intergenic
1149567140 17:57648525-57648547 CTGCCTCAGGAGGAGGAGTCTGG + Intronic
1149595191 17:57861146-57861168 GAGCTGGAGGAGGAGGAGGAAGG + Intergenic
1149656612 17:58312503-58312525 AGACCTGAGGAGGAGGATGCAGG - Exonic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149819851 17:59765685-59765707 GAGGCTGAGGAGGAGGCGGAGGG + Intronic
1149992590 17:61391213-61391235 GAGGCAGAGGAGGAGGAGGGCGG + Intronic
1150096216 17:62378449-62378471 GAGCCTTGGGAGGCGGAGGCAGG + Intronic
1150377411 17:64693335-64693357 CAGCTAGAGGAGGCTGAGGCAGG - Intergenic
1150423182 17:65056634-65056656 CCGCCGGAGGAGGAGGTGGAGGG - Exonic
1150781722 17:68128676-68128698 CACACTGAGGATGAGGAGGGAGG - Intergenic
1150860582 17:68796659-68796681 CGGCCTGGTGAGGAGGAGCCTGG + Intergenic
1151359378 17:73579415-73579437 AAGCCTGAGTAAGAGGATGCAGG - Intronic
1151413595 17:73947390-73947412 AAGCCTGAGAAGGTGGCGGCTGG + Intergenic
1151492718 17:74442454-74442476 CAGGCTGAGGAAGAGCAGGTGGG - Intronic
1151496591 17:74461774-74461796 CAGCCTGAGGAGTACAGGGCAGG + Intergenic
1151542741 17:74773036-74773058 CACTCTGAGGAGGAGGTGACAGG + Exonic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151825711 17:76523139-76523161 CAGCCTGAGACCGAGGAAGCTGG - Intergenic
1151853015 17:76702258-76702280 CAGCCTCAGGAGGCAGAGGCAGG + Intronic
1151894234 17:76969372-76969394 CCGACTTAGGAGGAGAAGGCAGG - Intergenic
1151989227 17:77563790-77563812 AGGCCAGAGAAGGAGGAGGCTGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152059779 17:78063381-78063403 CAGGCTGAGGAGGAAGGGGAGGG + Intronic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152378768 17:79931475-79931497 CAGCCTGAGATGGAGTAGGGTGG - Intergenic
1152404784 17:80091015-80091037 CTGGCTGAGGAGGGGGAGCCGGG - Intronic
1152453801 17:80401183-80401205 CAGCCTGGGGAGGAGGTGAGGGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152633904 17:81422793-81422815 CATCCCGAGGAGGAAAAGGCGGG + Intronic
1152755383 17:82084976-82084998 CAGGCTGGGGATGGGGAGGCTGG + Intronic
1152797667 17:82316074-82316096 GAGCCTGCAGAGGAGGCGGCGGG + Intronic
1152803173 17:82341347-82341369 CAGGCTGAGGAAGCTGAGGCTGG - Intergenic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1152947831 17:83207544-83207566 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1152959813 18:73011-73033 CAGCCTGAGGTCGAGGAAACAGG - Intronic
1153004129 18:482225-482247 CAGCCTCAGAAGGCTGAGGCAGG - Intronic
1153419493 18:4888401-4888423 CAGGTTGAGTAGGAGGAGACCGG - Intergenic
1153457252 18:5295358-5295380 CCGCCGGCGGAGGAGGGGGCCGG - Intronic
1154425082 18:14265849-14265871 TAGGGTGAGGAGGAGTAGGCTGG + Intergenic
1154485034 18:14866456-14866478 CAGCCTGAGCTGTAGGAGGGTGG + Intergenic
1155498019 18:26461566-26461588 CAGCCTGAGGGGTAGGAGTGGGG + Intronic
1155892789 18:31288315-31288337 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
1155940792 18:31800183-31800205 CAGACTGGGGAAGAGAAGGCAGG - Intergenic
1155941456 18:31805435-31805457 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1155941464 18:31805450-31805472 CAGCCTGGTGAGGAGCAGCCTGG - Intergenic
1156302155 18:35845529-35845551 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1156645926 18:39162298-39162320 CAGCCTGAGGAAGGTGATGCAGG + Intergenic
1156695314 18:39759371-39759393 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1156825894 18:41429802-41429824 CAGCCAGAGGAGGAGAAATCCGG - Intergenic
1156938435 18:42738280-42738302 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157341233 18:46780292-46780314 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1157563426 18:48664072-48664094 CACCCTGAGGTAGATGAGGCAGG - Intronic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157729669 18:49992610-49992632 CATCCTCAGGAGTAAGAGGCTGG - Intronic
1157796524 18:50580175-50580197 AGGCTGGAGGAGGAGGAGGCAGG + Intronic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158328505 18:56336275-56336297 GAGACTCAGGAGGATGAGGCAGG - Intergenic
1158394734 18:57070679-57070701 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1158512513 18:58103809-58103831 CAGCCCGAGGAGGAGAATGCAGG + Intronic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1158576797 18:58645041-58645063 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1159063659 18:63543706-63543728 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1159078212 18:63705321-63705343 CAGCTTTGGGAGGCGGAGGCAGG - Intronic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160144746 18:76354481-76354503 CAGCCTGGGGATCAGCAGGCAGG - Intergenic
1160265788 18:77340035-77340057 CAGCATGAGGATGAGCAGGTGGG + Intergenic
1160394242 18:78559927-78559949 CAGCCTGACGAGGGGAAGTCGGG + Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160513669 18:79466712-79466734 CCAACTGAGGAAGAGGAGGCAGG - Intronic
1160594101 18:79962458-79962480 GCTGCTGAGGAGGAGGAGGCAGG - Intergenic
1160657564 19:281383-281405 CGGCCTCAGGAGGAGGAGTGCGG + Exonic
1160667662 19:340575-340597 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1160698160 19:494481-494503 CAGCCTGGGCAGGAGGGGGATGG + Intronic
1160825398 19:1077944-1077966 AAGGCGGAGGAGGAGCAGGCTGG + Exonic
1160901815 19:1432611-1432633 CAGCCTGAGACGGAGGCGGTGGG - Exonic
1160960530 19:1718783-1718805 CGGCCGGGGGAGGGGGAGGCTGG - Intergenic
1160991785 19:1863178-1863200 GCGGCTGAGGAGGAGGAGGCGGG + Exonic
1161012697 19:1968084-1968106 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161012733 19:1968192-1968214 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161012792 19:1968362-1968384 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161026522 19:2039752-2039774 CTGGCTGAGGAGGAGGCCGCGGG - Exonic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161314005 19:3609403-3609425 GAACGTGAGGAGGAGGAAGCAGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161351990 19:3798622-3798644 CAGCCTTGGGAGGCTGAGGCAGG - Intronic
1161417748 19:4157154-4157176 CAGCCGGCGGGGGAGGTGGCTGG - Exonic
1161594370 19:5143750-5143772 GAGGCTGAGCAGCAGGAGGCTGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161631747 19:5360400-5360422 CAGCCAGAGGTGGACCAGGCAGG - Intergenic
1161674692 19:5638831-5638853 CAGCTTGGGGAGGATGAGGCAGG - Intronic
1161711938 19:5853732-5853754 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161815726 19:6498732-6498754 CAGGCTCGGGAGGAGGAGGGAGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161937159 19:7379103-7379125 CAGCCTGTGGGGGTGGAGGTGGG - Exonic
1162028552 19:7907667-7907689 GAGCCTGGGGAGGAGGCTGCCGG - Intronic
1162159653 19:8702433-8702455 GAGCCTGACAAGGAGGTGGCTGG - Intergenic
1162237784 19:9321872-9321894 GAGCCCACGGAGGAGGAGGCGGG - Intergenic
1162261896 19:9540682-9540704 CAGCCTGAGGGGGAGGGGAGAGG - Intergenic
1162299393 19:9835589-9835611 AAGCCTGAGGAAGCTGAGGCAGG + Intronic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1162964404 19:14149159-14149181 CAGGCTGGAGAGGAGGGGGCCGG + Exonic
1163023642 19:14496630-14496652 CAGGCTGGGGCAGAGGAGGCCGG - Intergenic
1163029892 19:14537204-14537226 GGGGCTCAGGAGGAGGAGGCGGG + Intronic
1163083001 19:14956895-14956917 GAGCAGGAGGAGGAGGAGGTGGG - Intronic
1163146143 19:15380222-15380244 CCCCCAGAGGAGGAGGAGGAGGG - Exonic
1163394778 19:17053473-17053495 CAGCCGGAGGGAGAAGAGGCTGG - Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163487189 19:17595054-17595076 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1163577980 19:18121834-18121856 CTGCCTGCTGAGGAGGAGGCGGG - Exonic
1163583997 19:18154248-18154270 CAGCCTGGGGAGGCGGAGATAGG - Intronic
1163779302 19:19238097-19238119 GAGCCTCAGGAGGAGGGGCCAGG + Intronic
1163800928 19:19364926-19364948 CAGCCGGAATAGGAGGAGACAGG - Intergenic
1163900369 19:20095052-20095074 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
1163906943 19:20156236-20156258 CAGCCTGGGGAGGAAGAGAGAGG - Intergenic
1164104763 19:22099833-22099855 CAGCATTAGGAGGCCGAGGCGGG + Intergenic
1164258670 19:23550888-23550910 CAGCCTGGGGAGGAGAAGAGAGG - Intronic
1164430681 19:28185853-28185875 CAGCCTCATGAGGAGGAGGCTGG + Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1164834646 19:31349566-31349588 AGGCCAGAGGAGGAGGGGGCGGG + Intergenic
1165063461 19:33216079-33216101 TTCCCGGAGGAGGAGGAGGCAGG + Intronic
1165313499 19:35041703-35041725 TCACCTGAGGAGGAGGGGGCTGG - Exonic
1165321087 19:35085572-35085594 AAGCCAGTGTAGGAGGAGGCAGG - Intergenic
1165391272 19:35540333-35540355 CAGCCTGGTGGGCAGGAGGCTGG + Intronic
1165427298 19:35753236-35753258 CTGCCTGAGGATGAGGAGGTGGG + Exonic
1165819435 19:38665255-38665277 CAGCCGGTGGTGGAGGAGGTGGG - Intronic
1165834147 19:38744113-38744135 CAGCTCGTGGATGAGGAGGCTGG - Exonic
1165961676 19:39539946-39539968 CAGCCTGAGGAGGCCGGGGAAGG - Exonic
1166167686 19:41003877-41003899 CAGCCTGGGGAGGCGGATGTTGG + Intronic
1166199734 19:41229195-41229217 CAGCCTTAGGAGGCCGAGGTGGG - Intronic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1166905891 19:46108123-46108145 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
1166905899 19:46108138-46108160 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1167071837 19:47226503-47226525 CCGCCGGAGGAGGGGGCGGCAGG - Intronic
1167239141 19:48333152-48333174 CAGCCTGTCGTGAAGGAGGCGGG + Exonic
1167258438 19:48444134-48444156 CAGCCTGAGAACGAGGGGGCGGG + Exonic
1167261175 19:48459126-48459148 CAGCCTCGGGAGGCTGAGGCAGG + Intronic
1167386217 19:49165795-49165817 AAGCCTGAGCAGGAAGAAGCAGG - Intronic
1167509503 19:49888589-49888611 CTGCCCGAGGAGGAGGACGAGGG + Exonic
1167513626 19:49910127-49910149 CACTCTGTGGAGGACGAGGCGGG + Intronic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1167638848 19:50669129-50669151 CGCCCTGAGGAGGAGGGGACTGG + Exonic
1167745536 19:51349557-51349579 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
1167756890 19:51418314-51418336 CAGACTCAGGAGGCTGAGGCAGG - Intergenic
1167915185 19:52734647-52734669 GGGGCTGAGGAGGGGGAGGCTGG + Intronic
1167951663 19:53032513-53032535 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1168107312 19:54172850-54172872 GGGTCTGAGGAGGAGGAGCCTGG - Intronic
1168248044 19:55124184-55124206 CGACCTGAGGAGGAGCAGCCTGG - Intergenic
1168303447 19:55419946-55419968 CAGCCAGAGAAGGAAGAGGGAGG + Intergenic
1168315495 19:55483173-55483195 CAGCCAGTGGAGCAGGGGGCTGG - Exonic
1168316890 19:55488457-55488479 AGGCCCGAGGAGGAGCAGGCAGG - Intronic
1168646812 19:58064412-58064434 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
924963607 2:56893-56915 CAGCCTGGGGAGGTGGAGCTGGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925263352 2:2546985-2547007 CTGCCCGAGGATGAGGAGGATGG + Intergenic
925401571 2:3576796-3576818 CAGCACGGGGAGGTGGAGGCGGG + Intronic
925544461 2:5002640-5002662 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
925617106 2:5754149-5754171 CAGCCTCGCAAGGAGGAGGCTGG + Intergenic
925940417 2:8811855-8811877 GAAGCTGAGGAGGAAGAGGCGGG + Intronic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926153781 2:10439387-10439409 GAGCCTGAGAAGTAGGATGCTGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926559756 2:14403049-14403071 CAGCCTGAGGATGAGGAAGAAGG + Intergenic
926777994 2:16441043-16441065 GAGTCTGAGGAGGAAGTGGCAGG + Intergenic
927397465 2:22670259-22670281 GAGCCTGAGGAGGATGTGGGAGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928366532 2:30707151-30707173 CAGCCTGAGGAGGAGGGCTGTGG + Intergenic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
928778209 2:34791357-34791379 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
928928475 2:36600695-36600717 CAGCCTGGGGAGGAGGGGAAAGG - Intronic
928991984 2:37242299-37242321 CAGCCTGAGAAGGCTGAGGCAGG - Intronic
929215652 2:39409082-39409104 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
929344462 2:40864111-40864133 CAGCATGAGGGAGAGGAGGGTGG - Intergenic
929584633 2:43106030-43106052 GAGCTAGAGGAGGAGGAGGAGGG - Intergenic
929587521 2:43125808-43125830 GAGCTAGAGGAGGAGGAGCCAGG - Intergenic
929793153 2:45038486-45038508 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
930099210 2:47590094-47590116 CAACCTGAGGAGGAGCAGTCTGG + Intergenic
930099216 2:47590109-47590131 CAGTCTGGGGAGGAGGTGACAGG + Intergenic
930213362 2:48667074-48667096 CATGCTGAAGAGGTGGAGGCAGG - Intronic
930364627 2:50424123-50424145 GAGGCGGAGGAGGAGGAGGAGGG + Intronic
931671714 2:64653822-64653844 CAGGCAGCGGAGGAGGAAGCAGG + Exonic
932137743 2:69245407-69245429 GAGCCTGGGGAGGAGGGGGAAGG - Exonic
932159550 2:69447724-69447746 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
932159558 2:69447739-69447761 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
932447660 2:71790725-71790747 CAGCCTGAGAAGGACGGGGAGGG + Intergenic
932485824 2:72083845-72083867 CAGCCTGAGCTGGAACAGGCTGG + Intergenic
932625925 2:73295866-73295888 CTGCCTGAGAGGGAGGAGGAGGG + Intergenic
932691767 2:73919522-73919544 AAGCCTGAGTATGATGAGGCAGG + Exonic
932873674 2:75428978-75429000 CTCCCTGTGGAAGAGGAGGCTGG + Intergenic
933013009 2:77090052-77090074 CAGCCTGGCGAGGAGCAGCCTGG - Intronic
933163642 2:79053047-79053069 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
933310591 2:80656993-80657015 CAGCCTTAGGAGGCTGAAGCAGG + Intergenic
933552488 2:83792966-83792988 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934542267 2:95185464-95185486 AGGCCTGAGGAGGAGGGGGTGGG - Intergenic
934573947 2:95389006-95389028 CAGGCTGAGGAGGGGTAGTCTGG + Intergenic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934678444 2:96265996-96266018 GAGGCAGAGGAGGAGGAAGCCGG - Intergenic
935024317 2:99261628-99261650 CAGACAGTGGAGGAGCAGGCAGG + Intronic
935617614 2:105102435-105102457 CACTCTGAGGAGGAGGTGGTGGG + Intergenic
935682090 2:105647041-105647063 AAGCCCGAGGAGGAGGGAGCTGG - Intergenic
935707589 2:105870252-105870274 CAGCTGGAGGCTGAGGAGGCAGG + Intronic
936495572 2:113017775-113017797 GAGCTGGAGGAGGAGGAGGAGGG + Intergenic
936516601 2:113185215-113185237 CAGCCTGGGTGGGAGGAGGATGG + Intronic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
937045040 2:118846745-118846767 GAGGCGCAGGAGGAGGAGGCCGG - Exonic
937110333 2:119362068-119362090 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
937264432 2:120607070-120607092 CAGGCTGAGCCAGAGGAGGCTGG + Intergenic
937343200 2:121104980-121105002 CAGCAGGAGGAGCAGCAGGCCGG + Intergenic
937365339 2:121257234-121257256 CAGCCTGAGGTGGGGGTGGGTGG - Intronic
937428599 2:121819640-121819662 GGGCCTGAGCGGGAGGAGGCTGG - Intergenic
937877783 2:126838214-126838236 CAGGGTGTGGATGAGGAGGCAGG - Intergenic
937898055 2:126993586-126993608 CAGCCTCAGGAGGCTGAGGCAGG + Intergenic
937907407 2:127058955-127058977 AAGCCGGAGGAGAAGGAGGGAGG + Intronic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
937980077 2:127609569-127609591 GAGCCTGAGGAGGATGTGGATGG + Exonic
937988303 2:127648511-127648533 CAGCCCCTCGAGGAGGAGGCTGG - Intronic
938297265 2:130185955-130185977 GAACCTGAGGAGGAGGTGGAGGG + Intronic
938459511 2:131488720-131488742 GAACCTGAGGAGGAGGTGGAGGG - Intronic
938548944 2:132361715-132361737 CAGCCTCAGGCGCAGGAGGGAGG - Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939069105 2:137518165-137518187 CAGGCTGGGGAAGAGAAGGCAGG - Intronic
939083235 2:137687021-137687043 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939460828 2:142493919-142493941 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
939500457 2:142976877-142976899 AAGCCTGGGGAGGAGAGGGCTGG + Intronic
939734981 2:145833084-145833106 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
939911107 2:147984237-147984259 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940107246 2:150114235-150114257 CAGCCTGGGGAGGAGGTGAGAGG - Intergenic
940182842 2:150954681-150954703 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
940323106 2:152398009-152398031 CAGCCTTGGGAGGCTGAGGCGGG + Intronic
940530097 2:154868982-154869004 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
940545975 2:155085861-155085883 CAGACTCAGAAGGAGGAGGGTGG + Intergenic
940675897 2:156724119-156724141 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
941456279 2:165714546-165714568 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
941572302 2:167186693-167186715 CAGCATGAGGAAGAGCAAGCAGG - Intronic
941935990 2:170981711-170981733 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
942404196 2:175635891-175635913 GAGCCTGAAGAGGAGGAGAGGGG - Intergenic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942569233 2:177296567-177296589 TAGCCTTGGGAGGATGAGGCCGG + Intronic
943061486 2:183045532-183045554 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
943064359 2:183070998-183071020 CAGCCACAGGAGGGGCAGGCTGG + Intergenic
943103513 2:183514278-183514300 TAGGCTGAGGAGGAAGAGGAGGG - Intergenic
943460267 2:188164917-188164939 CAGCCTGGCGAGGAGTAGCCTGG + Intergenic
943593096 2:189822159-189822181 CGGGCAGTGGAGGAGGAGGCGGG + Intronic
943685489 2:190813344-190813366 CAGCCTGAAGATCAAGAGGCTGG - Intergenic
944250939 2:197579762-197579784 CAACCTGAGGAGGAGCAGTCTGG - Intronic
944387355 2:199181032-199181054 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
945522614 2:210847226-210847248 CAGTGGGATGAGGAGGAGGCTGG - Intergenic
945642211 2:212444104-212444126 CAGGCTGGGGAAGAGGAGGAGGG - Intronic
946074928 2:217065840-217065862 CAGCCTGGAGAAGAGGAGGCTGG - Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946195673 2:218032070-218032092 CAGCCTCAGGAGCAAGAGGTTGG - Intergenic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
946871859 2:224091925-224091947 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
946886403 2:224226947-224226969 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
946886411 2:224226962-224226984 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
947869771 2:233428127-233428149 GAGCCAGAGGAGGAGGAGGTGGG + Intronic
947894765 2:233659557-233659579 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
947964445 2:234267663-234267685 CACCCTGCTGAGGAGGAGCCAGG - Intergenic
948310462 2:236981899-236981921 CAGCCTGTGGAGGAGGCTGTGGG + Intergenic
948336069 2:237208137-237208159 GAGACTGTGGAAGAGGAGGCAGG + Intergenic
948463822 2:238142856-238142878 GCGCTGGAGGAGGAGGAGGCAGG + Exonic
948468478 2:238163253-238163275 CAGCCTGCCCTGGAGGAGGCAGG + Intronic
948603243 2:239119406-239119428 CAGGCTAAGGATGAGGAGACAGG + Intronic
948635360 2:239331119-239331141 CAGCCTGCCCAGGAGGAAGCGGG + Intronic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948806388 2:240455157-240455179 TAACCTGAGGAGCAGGAGCCTGG + Intronic
948947207 2:241226872-241226894 CGGCTGGAGGAGGAGGAGGGAGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168792723 20:590722-590744 CCTCCAGAGGAGGAGGATGCAGG - Intergenic
1168991895 20:2102675-2102697 CGGCCGGGGGAGGAGGAGGTGGG + Intronic
1169136795 20:3202696-3202718 GAGCCTGAGGAGGGGGCGTCTGG - Intronic
1169171778 20:3471137-3471159 AAGGCTGAGGAGGAGGACGGCGG + Exonic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169303644 20:4469483-4469505 GAGCCTGGGGAGGAGCAGGGAGG - Intergenic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169328550 20:4697754-4697776 CAGCCAGGGGAGGAGCAGGGAGG + Intronic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170222050 20:13951485-13951507 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1170973373 20:21137883-21137905 CAGCTTGAGGCTGAGGAGGGAGG - Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171109247 20:22465242-22465264 CTGCCAGAGGAGAAGGAGGTGGG - Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1171958287 20:31475866-31475888 GGGTCTGAGGAGGAAGAGGCAGG - Intronic
1171997686 20:31744838-31744860 CACTCTGAGGAGGCTGAGGCGGG + Intronic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172447415 20:35000477-35000499 CAGCTCAAGGAGGAGCAGGCAGG + Exonic
1172495668 20:35381979-35382001 CAGCCTGTTGAGGAGAAGGTTGG - Exonic
1172560565 20:35884348-35884370 CAGCAGGAGGAGGAGGAGCTGGG + Intronic
1172654646 20:36529440-36529462 CAGCCTCGGGAGGCTGAGGCAGG - Intergenic
1172888839 20:38249440-38249462 AACTCTGAGGAGGAGGAGGGTGG + Intronic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173106975 20:40146103-40146125 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1173116364 20:40247454-40247476 CTGCCGGGGGAAGAGGAGGCAGG - Intergenic
1173162714 20:40664293-40664315 GACCCAGAGGAGGAGGAGGGAGG - Intergenic
1173334560 20:42102049-42102071 CTTCCTGAGGTGGAGGTGGCTGG - Intronic
1173750089 20:45469810-45469832 CAGGCTGAGGAGGAGGGCGGCGG - Exonic
1173781586 20:45761076-45761098 CAGCCTGGGGAGGAGGAGAAAGG - Intronic
1173783388 20:45774828-45774850 CAGCCTTGGGAGGCTGAGGCAGG + Intronic
1173848174 20:46201113-46201135 CAGCATGGGGAAGCGGAGGCCGG - Intronic
1173972347 20:47162595-47162617 AAGCCTGGGGAGGTCGAGGCTGG - Intronic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1174476592 20:50800238-50800260 GAGCCTGAGTAGGAGTTGGCTGG + Intronic
1174482598 20:50841960-50841982 CAGCGTGGGGAGGAGCATGCAGG + Intronic
1174485620 20:50859461-50859483 GTGTCTGAGGAGGAGGAGACAGG + Intronic
1174501687 20:50989575-50989597 GAGGCAGAGAAGGAGGAGGCTGG + Intergenic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1174618236 20:51853102-51853124 TAGCCTGAGGAGGTGGAGGTGGG + Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175229451 20:57464429-57464451 CAGGCTGAAGCGGGGGAGGCTGG + Intergenic
1175417364 20:58810786-58810808 CAGCCTGAGGTGGTTGAGTCAGG + Intergenic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175725429 20:61315102-61315124 GAGCCCAAGGAGGAGGAGTCTGG - Intronic
1175743238 20:61435497-61435519 CGGCCGGAGGAGGTGGAGGATGG + Intronic
1175914584 20:62419727-62419749 CATCCTGAAGAGGAGGAAGAGGG + Exonic
1175944808 20:62553741-62553763 CTCCCGGAGAAGGAGGAGGCTGG + Intronic
1176070974 20:63226333-63226355 CAAGCTGAGGAGGAGGGGACCGG + Intergenic
1176121118 20:63455023-63455045 CTGCCTGGGCAGGAGGGGGCGGG - Intronic
1176177822 20:63737034-63737056 CACCCGGAGGAGCTGGAGGCTGG - Intronic
1176385574 21:6137340-6137362 CAGCCTGAGGAGGAGGGAAACGG - Intergenic
1176723786 21:10413784-10413806 CAGCCTGAGTGGTAGGAGGGTGG + Intergenic
1176796294 21:13373019-13373041 CAGCCTGAGCTGTAGGAGGGTGG - Intergenic
1177031262 21:15983851-15983873 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
1177031270 21:15983866-15983888 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1177315376 21:19454019-19454041 CAGTCTGAGGTGGCAGAGGCAGG - Intergenic
1178001102 21:28162825-28162847 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1178006016 21:28220167-28220189 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1178236315 21:30845983-30846005 AATCCAGAGGAGAAGGAGGCAGG + Intergenic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1178837097 21:36108011-36108033 CAGCCATAGGAGGTGGAGGAGGG - Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179550567 21:42140998-42141020 CTGCCTGACGAAGAGGGGGCGGG - Intronic
1179590412 21:42404299-42404321 CAGCCTTAGGAGGCTGAGGTGGG - Intronic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1179737899 21:43400912-43400934 CAGCCTGAGGAGGAGGGAAACGG + Intergenic
1179912169 21:44456139-44456161 CACCCTGAGGAGGGAGGGGCTGG + Intronic
1180094985 21:45552292-45552314 CAGCCTGAGCAGCAGGGGTCAGG + Intergenic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180304931 22:11066525-11066547 CAGCCTGAGCGGTAGGAGGGTGG + Intergenic
1180726856 22:17952748-17952770 CTGCCTGATGAGGAAAAGGCTGG + Intronic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1181162851 22:20968016-20968038 GAGACGGGGGAGGAGGAGGCGGG - Intronic
1181431427 22:22884088-22884110 AAGCCTGAGGAGGAACTGGCTGG - Intronic
1181602424 22:23960438-23960460 CCGCTTGGGGAGGAGGAGGGAGG - Intronic
1181606089 22:23980869-23980891 CCGCTTGGGGAGGAGGAGGGAGG + Intronic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182113862 22:27743661-27743683 CAGCCTGGCGAGGAGCAGGCTGG - Intergenic
1182431992 22:30304627-30304649 CAGCCTGTGGAGCAGAGGGCAGG + Exonic
1182475477 22:30574473-30574495 CACGCTGAGGCGGAGGAGGACGG - Intronic
1182549014 22:31091143-31091165 GAGCCGCTGGAGGAGGAGGCAGG - Exonic
1182676351 22:32042637-32042659 CAGGCTGTGGAGGGGGAGTCAGG + Intergenic
1182774210 22:32818972-32818994 GTGTCAGAGGAGGAGGAGGCAGG - Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182998509 22:34835964-34835986 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1183072691 22:35407371-35407393 CAGACTGAGGGGGTGGAGGGTGG - Intronic
1183276049 22:36898845-36898867 CAACCTGAGGAAGTGGAGGGAGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183322828 22:37175685-37175707 CTGCCTGGGAAGGAGGAGACAGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183745773 22:39690970-39690992 GAATCTGTGGAGGAGGAGGCTGG + Intergenic
1183775000 22:39958205-39958227 GAGACTGAGGAGGAGAAGCCAGG - Intronic
1183804690 22:40198470-40198492 GAGCCTGAGTAGGATGAGGAGGG + Intronic
1183832776 22:40427511-40427533 CTGCCTCAGGAGGGGCAGGCAGG + Intronic
1183932783 22:41245808-41245830 CAGTCTGGGGAGGGAGAGGCAGG - Exonic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184244035 22:43226957-43226979 GAGGCTGAGGGGGAGGAGGAGGG - Intronic
1184469941 22:44690745-44690767 CAGCCGGAGGATGAGGAGCAGGG + Intronic
1184514741 22:44955076-44955098 CAGCCTGAGGGGGCAGAGGGTGG + Intronic
1184567268 22:45299491-45299513 TACCCTGAGGAGGACGAGGAAGG - Intergenic
1184606663 22:45578371-45578393 CAGCTAGCGCAGGAGGAGGCTGG - Intronic
1184620356 22:45672020-45672042 GAGCCTGACGAGGAGGAGGAAGG - Exonic
1184863267 22:47188919-47188941 GAGCCTGAGGAGGAGGGGCTGGG + Intergenic
1184893683 22:47394611-47394633 CAGACAGAGGAGGAGAAGACAGG + Intergenic
1185046282 22:48530156-48530178 CGACTCGAGGAGGAGGAGGCTGG + Intronic
1185116243 22:48939849-48939871 CAGACTCAGGGGGAGGCGGCCGG + Intergenic
1185184365 22:49388624-49388646 CTTCCTGAGGAAGAGGAAGCAGG - Intergenic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949162181 3:894711-894733 CAGCCTGGTGAGGAGCAGCCTGG + Intergenic
949162189 3:894726-894748 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
949201043 3:1379687-1379709 CTTCCTGAGGAGGAGGTGGGGGG + Intronic
949445639 3:4131321-4131343 CAGGCTGGGGAAGAGCAGGCAGG - Intronic
949671066 3:6399329-6399351 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
949827349 3:8178676-8178698 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
949827357 3:8178691-8178713 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
949949361 3:9216484-9216506 CAGCCTGAAGTGTAGGAGGAAGG - Intronic
950044525 3:9941072-9941094 CAGCATGAGGATGGGCAGGCAGG - Intronic
950114884 3:10444362-10444384 CAGCAGGAGGATGTGGAGGCAGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950515224 3:13460609-13460631 TACCCTGAGGAGGAGGTGGGAGG + Intergenic
950575945 3:13832126-13832148 GAGCCTGAGGAGGAGGAAGAGGG - Intronic
950582885 3:13874108-13874130 TGACCTGAGGAGGAGGCGGCAGG + Intronic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950829360 3:15859426-15859448 GCGGCGGAGGAGGAGGAGGCTGG - Exonic
950926405 3:16745977-16745999 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
950997715 3:17521303-17521325 TAGGCTGAGGAGGAGGTGGAAGG - Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951556546 3:23926415-23926437 GAGCAAGAGGAGGAGGAGGAAGG - Intronic
951889083 3:27552214-27552236 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
951908465 3:27725861-27725883 CAGCCTGAGATGGAGCAAGCAGG + Intergenic
952210742 3:31226765-31226787 CAGCAAGAGAAGGAGCAGGCAGG + Intergenic
952282176 3:31934518-31934540 CAGCTTCAGGAGGCTGAGGCAGG - Intronic
952296730 3:32068883-32068905 CGACCTGAGGAGGAGCAGTCTGG - Intronic
952499356 3:33945448-33945470 CAGCCTGAGGGTCAGGAGGTGGG + Intergenic
952509773 3:34041365-34041387 CAGCTTCAGGAGGCTGAGGCAGG + Intergenic
952663551 3:35878405-35878427 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
952761376 3:36917437-36917459 CAGCAGGGGAAGGAGGAGGCAGG + Intronic
952821812 3:37492353-37492375 CAGCTTGGGAAGGCGGAGGCTGG + Intronic
952895348 3:38075093-38075115 CAGCCTGAGGAGGAGGGGAAAGG + Intronic
952912039 3:38199373-38199395 TAGCCTGAGGAGGCTGAGGTGGG - Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953018776 3:39100746-39100768 CAGCCTGGGGTGGAGAGGGCAGG - Exonic
953077217 3:39581835-39581857 CAGCCTGGTGAGGAGCAGCCTGG + Intergenic
953082720 3:39635618-39635640 CACGCAGAGGAGGAGGAAGCAGG + Intergenic
953137696 3:40197314-40197336 CAGCCTGTGCAGCAGGAGGTGGG - Intronic
953279235 3:41536724-41536746 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
953419271 3:42742031-42742053 CAGCATGAAGAGGTGCAGGCAGG - Intronic
953599539 3:44349081-44349103 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
953724830 3:45388722-45388744 GAGCCGGAGGAAGAGGAGACTGG - Intronic
953794711 3:45975773-45975795 CAGCTTGAGGAGGAAGAGATGGG + Intronic
953834560 3:46331489-46331511 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
953936498 3:47048694-47048716 CACCCTGGCGAGGAGGAGGGAGG - Intronic
954121845 3:48504232-48504254 GAGCAGGAGGAGGAGGAGGGAGG + Exonic
954144703 3:48628817-48628839 CAGCCTGGGGAGCAGAGGGCTGG - Intronic
954485838 3:50850698-50850720 CATCCTGAGGAGAAGGAGAGAGG - Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
954748480 3:52800458-52800480 CAGGCTGGAGCGGAGGAGGCCGG - Intronic
954781654 3:53066372-53066394 CAGCCTTGGCAGGTGGAGGCAGG + Intronic
954838443 3:53491787-53491809 GGGCTAGAGGAGGAGGAGGCTGG - Intergenic
955044710 3:55348877-55348899 CACCATGGGGAGGGGGAGGCAGG - Intergenic
955059590 3:55483937-55483959 CTGCCTGCGGAGGAGGAGTTGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955253270 3:57305329-57305351 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955347659 3:58173108-58173130 GAGACAGAGGAGGAGGAGGTGGG - Intergenic
955386900 3:58487569-58487591 CATGCTGAGGGTGAGGAGGCTGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956464605 3:69506645-69506667 CAGACTCAGGAGGCTGAGGCAGG - Intronic
956624322 3:71251949-71251971 CAGCTTGGGGAGTAGGAGGTGGG - Intronic
956728699 3:72177484-72177506 GCGGCTGGGGAGGAGGAGGCAGG - Intergenic
956737334 3:72247808-72247830 CAGCCAGGAGAGGAGGGGGCAGG - Intergenic
957287168 3:78231656-78231678 GAGCCTGAGGCTGTGGAGGCTGG - Intergenic
957444280 3:80294883-80294905 GAGGCTGAGGTGGGGGAGGCGGG - Intergenic
957904949 3:86542508-86542530 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
957985608 3:87571001-87571023 CGACCTGAGGAGGAGCAGTCTGG - Intergenic
958676913 3:97277036-97277058 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
959972347 3:112421597-112421619 CAGCCTGGCGAGGAGCAGGCTGG + Intergenic
960054544 3:113267837-113267859 CAGCCTTCGGAGGCTGAGGCAGG - Intronic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
960967749 3:123116789-123116811 GAACCAGAGGAGGAGGAGGTGGG + Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961343924 3:126248698-126248720 CAACTTGAGGAGGAGCAGTCTGG - Intergenic
961381105 3:126497095-126497117 TCACCTGTGGAGGAGGAGGCGGG - Intronic
961430709 3:126880894-126880916 CAGGCTGTTGAGGTGGAGGCTGG + Intronic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961569400 3:127787122-127787144 CTGCATGAGGAGGAGGATTCAGG + Intronic
961585046 3:127915414-127915436 CGCCCTGCGGAGGAGGAGGGAGG - Exonic
961625142 3:128256596-128256618 CAGCCTGAAGAAGTGGAGTCAGG - Intronic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
961647327 3:128399646-128399668 CAGCCTGACAAAGAGGTGGCTGG + Intronic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
961711720 3:128833238-128833260 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
961717762 3:128870392-128870414 CGGCCTGGGGAGGAGGTGGTGGG + Intergenic
961749440 3:129086739-129086761 CACCCTGAGGAAGAAGAGGGGGG - Intergenic
961880961 3:130060932-130060954 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
962044544 3:131741767-131741789 CAGCCTCTGCAGTAGGAGGCTGG - Intronic
962055853 3:131870873-131870895 CAGCCTGAAGAAGAGAAGGCTGG + Intronic
962244664 3:133782612-133782634 AAACCTGAGGTGGAGGAGGGTGG + Intergenic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
962403871 3:135083651-135083673 CAGGCTGAGGAGGTGCAGGTAGG + Intronic
962712738 3:138101436-138101458 CAGCCGCAGGAGGGGCAGGCTGG + Intronic
962775910 3:138659403-138659425 CTGCCTGGGGAGGCTGAGGCAGG + Intronic
962899801 3:139751289-139751311 CAACCTCAGGAGGTTGAGGCAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963319639 3:143798907-143798929 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
963331785 3:143923107-143923129 CAGGCTGAGGGAGAGAAGGCAGG + Intergenic
963425122 3:145114605-145114627 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
963456748 3:145555210-145555232 CAGCCTGGCGAGGATCAGGCTGG + Intergenic
963468520 3:145712024-145712046 CAGCCTGGGGAGGAGGGGGGAGG - Intergenic
963663245 3:148153310-148153332 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
963663253 3:148153325-148153347 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
963684238 3:148416007-148416029 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
963684246 3:148416022-148416044 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
963791120 3:149583448-149583470 CAGCCTCGGGAGGCTGAGGCAGG - Intronic
963926608 3:150957768-150957790 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
964067735 3:152598651-152598673 CAGCCTGAGGAGGAGGGGAGAGG - Intergenic
964125550 3:153230775-153230797 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
964203717 3:154147297-154147319 CATCCTCAGGAGGCTGAGGCAGG + Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964459836 3:156912292-156912314 GAGACTCAGAAGGAGGAGGCTGG - Intronic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
965096344 3:164232143-164232165 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
965210281 3:165777776-165777798 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
965262741 3:166504848-166504870 CAGCCTGGTGAGGAGCAGCCTGG + Intergenic
965262749 3:166504863-166504885 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
965334970 3:167423859-167423881 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
965590314 3:170356662-170356684 CAGCCTGGTGGGGTGGAGGCAGG + Intergenic
965626410 3:170687403-170687425 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
965640140 3:170822038-170822060 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
965713310 3:171578075-171578097 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
966397562 3:179518496-179518518 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
966398543 3:179524994-179525016 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
966596216 3:181726516-181726538 CTGCCTGAAGAGGATGAGGGTGG - Intergenic
966789703 3:183655817-183655839 GAGGCTGAGGAGGCTGAGGCAGG + Intronic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967151999 3:186659283-186659305 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967496127 3:190146180-190146202 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
967740392 3:192997312-192997334 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
967993638 3:195150599-195150621 CACCCTGAGGAGGAAGCGGCAGG - Intronic
968074713 3:195810055-195810077 CACCGTGAGGACGTGGAGGCCGG - Intronic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968205326 3:196794639-196794661 CAGCCAGAGGCAGAGGAGGGAGG + Intronic
968362545 3:198157510-198157532 GGTCCTGAGGAGGAGGAGGCTGG - Intergenic
968413408 4:407915-407937 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968446666 4:655568-655590 CAGCCTGGGGAGGAGGAAGAAGG + Intronic
968577839 4:1376217-1376239 CAGCCTGAGGAGGGGGCTGCCGG + Intronic
968592412 4:1465674-1465696 GGTGCTGAGGAGGAGGAGGCGGG + Intergenic
968663856 4:1810261-1810283 CACGCTGAGGAGGAGGGGGCTGG - Intergenic
968706494 4:2080695-2080717 CACCCCGAGGAGGAGGGGTCTGG + Intronic
968800213 4:2738386-2738408 CAGGCTGGGGGAGAGGAGGCAGG - Intergenic
968887024 4:3340530-3340552 CAGCCTAAGCAGGAGGGAGCGGG + Intronic
968900785 4:3430799-3430821 CAGTCTCAGGAAGTGGAGGCCGG + Exonic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
968906981 4:3458235-3458257 CAGGCTGGGGGAGAGGAGGCAGG - Intergenic
968993295 4:3929036-3929058 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
968993303 4:3929051-3929073 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
969054563 4:4393538-4393560 CAGCCACAGGAGGTAGAGGCAGG - Intronic
969311299 4:6354266-6354288 GAGACTGAGGAAGAGCAGGCAGG - Intronic
969432501 4:7163938-7163960 CAGACTCAGGAGGCTGAGGCAGG + Intergenic
969657947 4:8508863-8508885 CGGCGGGAGGAGGAGGAGGAAGG - Intergenic
969717904 4:8877333-8877355 GGGCCTGAGGAGGAGGAGATGGG + Intergenic
969720264 4:8889656-8889678 CAACCAGAGGAGGCAGAGGCTGG + Intergenic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971123270 4:23726057-23726079 CTGCCTGGCGAGGAGCAGGCTGG + Intergenic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
971358144 4:25913400-25913422 CAACTTGAGGAGGAGGAAACAGG + Intronic
971552561 4:27975618-27975640 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
972201275 4:36716918-36716940 CAGGCTGCGGAAGAGAAGGCAGG + Intergenic
972324307 4:38000835-38000857 GACCCTGAGGAGGAGGTGGTGGG - Intronic
973118474 4:46489318-46489340 CAGGCTGAGGAAGAGTAGGCAGG - Intergenic
973179669 4:47252097-47252119 CATCCAGAGGAGTAGGAGGGGGG - Intronic
973393300 4:49573877-49573899 TAGGATGAGGAGGAGTAGGCTGG + Intergenic
973611812 4:52643161-52643183 CAGCCAGAGGAGGAGATGGAGGG - Intronic
973751032 4:54021446-54021468 CAGCCTGTTGAGGAGCAGCCTGG - Intronic
973921389 4:55689050-55689072 CAGCCTGTAGAGGCTGAGGCAGG + Intergenic
974173512 4:58295385-58295407 CGACCTGAGGAGGAGCAGTCTGG + Intergenic
974373223 4:61044021-61044043 AGGCCTGAGCAGGAGGAAGCAGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975982582 4:80177013-80177035 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
976610363 4:87024700-87024722 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
976740052 4:88347811-88347833 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
976884668 4:89968847-89968869 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977446523 4:97138665-97138687 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
977609849 4:99020482-99020504 GAGCCTGAGGAGGAGGAGGCGGG + Intronic
977609863 4:99020537-99020559 CTGCCTGAGGAGGAGGAGGCGGG + Intronic
978233010 4:106423703-106423725 CAGCCTCAGGAGGCTGAGGTGGG + Intergenic
978243894 4:106549209-106549231 CACTTTGAGGAGGAGGAGGCAGG - Intergenic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978438519 4:108710683-108710705 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
978521362 4:109619176-109619198 GAGGCTGAGGAGGCTGAGGCAGG - Intronic
979039159 4:115764742-115764764 AAGCCTGAGGAACAGGAGGAAGG - Intergenic
979054717 4:115979708-115979730 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
979279309 4:118847323-118847345 CAGCCTCAGGAACAGGAGGAAGG - Intergenic
979721168 4:123902118-123902140 CAGCCTGGGGAGGATGAAGCTGG - Intergenic
979721181 4:123902170-123902192 CATCCTGAGGATGAGGAGGGAGG + Intergenic
979798393 4:124876070-124876092 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
980387916 4:132110914-132110936 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
980388828 4:132119859-132119881 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
980472530 4:133267758-133267780 CAGCCTGGCGAGGAGGAGAGAGG + Intergenic
980602232 4:135040287-135040309 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
980714228 4:136611178-136611200 CAGGCTAAGGAGGAAGAGGGAGG - Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981197744 4:141940893-141940915 CATACTGATGAGGAGGAGGAAGG - Intergenic
981431336 4:144664311-144664333 CAGCATGTGGAGGAGGATGCAGG + Intronic
981482811 4:145255594-145255616 CAGCCTGGCGAGGAGCAGCCAGG + Intergenic
981692642 4:147526696-147526718 CAGCCTTAGGAGGCCGAAGCAGG + Intronic
982318709 4:154057912-154057934 CAGCCTGAGGAGGAGGGGAGAGG - Intergenic
982396813 4:154922927-154922949 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
982473943 4:155827295-155827317 TAGGCTGAGGAGGAGGAGACAGG - Intergenic
982552051 4:156814330-156814352 CATCCTGAGAAGGAGCAGTCAGG + Intronic
983033864 4:162838030-162838052 CAGCCTTAGGAAGAATAGGCAGG + Intergenic
983295267 4:165859018-165859040 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
983344841 4:166515065-166515087 CAGGCTGAGGAGGAAGAAGAGGG + Intergenic
983447967 4:167877905-167877927 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983659488 4:170118111-170118133 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
983883853 4:172960451-172960473 CAGCCTGGCGAGGAGCAGCCTGG + Intronic
983883861 4:172960466-172960488 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
983939399 4:173524685-173524707 GGCCCTGAGGAAGAGGAGGCAGG + Intergenic
983946760 4:173594945-173594967 CAGCTACAGGAGGATGAGGCAGG - Intergenic
984060250 4:174981758-174981780 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
985057487 4:186048272-186048294 CAGCCTGGCGAGGAGGGGACAGG + Intergenic
985079103 4:186246222-186246244 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
985147031 4:186903783-186903805 CGGCCTTAGGAGCAGGAGTCGGG + Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985285753 4:188335131-188335153 CAGCCTGGAGAGCAGGAGGGAGG + Intergenic
985312566 4:188617953-188617975 AAGCCTGAGGAGGAGCAGGGAGG - Intergenic
985322466 4:188730140-188730162 CCGCTAAAGGAGGAGGAGGCTGG + Intergenic
985582267 5:704446-704468 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985720419 5:1485916-1485938 CAGCCCGAGGATGCAGAGGCGGG - Intronic
985721922 5:1493985-1494007 CCCCCAGAGGAGGAAGAGGCAGG + Intronic
985766600 5:1783191-1783213 CAGCCAGAGGAGGAGCAACCTGG - Intergenic
986152422 5:5140071-5140093 GCGCCAGAGGAGGAGGACGCGGG - Intergenic
986378496 5:7159413-7159435 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
987196900 5:15536021-15536043 CAGCCTGAGCTGGAGCAGGTGGG - Intronic
987281947 5:16421662-16421684 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
987358908 5:17088988-17089010 CAGCCTCAGGAGGCTGAGGTGGG - Intronic
987489547 5:18560256-18560278 GTGCCTGAGGAGGCTGAGGCAGG - Intergenic
987578313 5:19758043-19758065 CAGACTGGGGAAGAGAAGGCAGG + Intronic
987614452 5:20254356-20254378 CAACTTTAGGAGGATGAGGCAGG - Intronic
987847539 5:23305330-23305352 TAGCCGGAGGAGGAGCAAGCCGG - Intergenic
988188809 5:27901502-27901524 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
988228796 5:28448392-28448414 CAGGCTGAGGAAGAGAAGGCAGG - Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988547521 5:32172747-32172769 CTGCCTCAGGAGGCTGAGGCAGG + Intronic
989688990 5:44118773-44118795 CAGCCTGGTGAGGAGCAGCCTGG + Intergenic
990512380 5:56500299-56500321 CAGCCTGAGATGGAGGTGGGGGG - Intergenic
990565213 5:57021056-57021078 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
990565223 5:57021071-57021093 CAGCCTGGGGAGGAGGGGAGGGG + Intergenic
990926167 5:61026236-61026258 CAGCCTGCAGGGGAGGAGGGGGG + Intronic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
992090625 5:73312877-73312899 GAGGGGGAGGAGGAGGAGGCAGG - Intergenic
992102274 5:73419308-73419330 CACCCTTAGGAGGGGGTGGCAGG - Intergenic
992365138 5:76083275-76083297 CAGCACCAGGGGGAGGAGGCAGG + Exonic
993055099 5:82971797-82971819 CAGCCATAGGAGGTGGAGGAGGG + Intergenic
994126206 5:96170964-96170986 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
994779090 5:104068590-104068612 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
994784043 5:104132832-104132854 CATGCTGAAGAGGAGGAAGCTGG - Intergenic
995250254 5:109984814-109984836 GAGCAGGAGGAGGAGGAGGATGG + Intergenic
995548421 5:113255665-113255687 CAGCCTTAGGAGGAATATGCTGG + Intronic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
995870014 5:116734663-116734685 CAGCCCAAGGAGGCAGAGGCAGG + Intergenic
995899465 5:117050420-117050442 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
996052772 5:118951299-118951321 CAGCCTGGGGAGGAAGAGAGAGG + Intronic
996358726 5:122622951-122622973 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996575103 5:124970686-124970708 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
996630797 5:125629809-125629831 CAGCCCAGGGAAGAGGAGGCTGG + Intergenic
996726103 5:126674409-126674431 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
997013555 5:129905226-129905248 GAGCCCGAGGAGGAGGACGGGGG + Exonic
997579049 5:135005839-135005861 TGGCCCCAGGAGGAGGAGGCAGG - Intronic
997678993 5:135736065-135736087 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
997788849 5:136738531-136738553 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
998157654 5:139795763-139795785 GAGCTGGAGGAGGAGGAGGAGGG - Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998286917 5:140871223-140871245 CAGCGTGAGTACCAGGAGGCTGG - Exonic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
998673096 5:144375920-144375942 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
998887109 5:146706165-146706187 CAGCCGTAGGAGGGGCAGGCTGG + Intronic
998995296 5:147864931-147864953 CAGCCTGGGGAGGAAGGGACAGG - Intergenic
999254266 5:150201114-150201136 CAGCATGAGCAGGATGAGGTAGG - Exonic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
999351414 5:150875113-150875135 CAGGCTGAGGGAGAGAAGGCAGG - Intronic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000519496 5:162279416-162279438 CAGCCTGGCGAGGAGCAGCCCGG + Intergenic
1001199753 5:169705385-169705407 CAACTTGAGGCGGTGGAGGCAGG + Intronic
1001334032 5:170783143-170783165 GAGGCCCAGGAGGAGGAGGCGGG - Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001570249 5:172726021-172726043 GAGCCTGAGGAGCAGCAGGGAGG - Intergenic
1001687607 5:173606073-173606095 GTTCCTGAGGAGGAAGAGGCTGG + Intergenic
1002168650 5:177363092-177363114 CAGCCGGGGGAGGAGGAGCCCGG + Intronic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1002427589 5:179185363-179185385 CCGCCTGAGCAGGGAGAGGCTGG + Intronic
1002436408 5:179234527-179234549 GAGCCTGGGGAGGTGCAGGCTGG - Intronic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002741994 5:181440698-181440720 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003175473 6:3750515-3750537 CAGGCTGAGGGGGTGGAAGCCGG - Intronic
1003197310 6:3926248-3926270 CAGCAGGAGGAGGAGAAAGCAGG + Intergenic
1003318508 6:5032901-5032923 CAGCAGGAGGAGGAGAAAGCAGG - Intergenic
1003364122 6:5456617-5456639 CAGCCTCATGAGGCTGAGGCAGG + Intronic
1003405079 6:5821316-5821338 CAGCCTGGGGATGGGGAGGAGGG - Intergenic
1003518045 6:6833997-6834019 CATCCTGAGGGTCAGGAGGCTGG - Intergenic
1003590263 6:7431537-7431559 CAGCCCGTGGAGGAGGAAGGAGG + Intergenic
1004173202 6:13315248-13315270 TAGGCTGAGCAGGAGGAGGGAGG - Intronic
1004283617 6:14301005-14301027 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1004344145 6:14832721-14832743 CAGCCTGAGCAGGAAGGGGTGGG + Intergenic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1004485611 6:16063611-16063633 CAACCAGAAGAGGAGGAGGAAGG + Intergenic
1004508089 6:16263046-16263068 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
1004516065 6:16323270-16323292 CAGCTTTAGGAGGCTGAGGCGGG + Intronic
1004575131 6:16887613-16887635 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1004768672 6:18758119-18758141 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1005380789 6:25232170-25232192 CTGCCTCAGGAGGCTGAGGCAGG + Intergenic
1005495449 6:26383859-26383881 GAGCAGGAGGAGGAGGAGGGAGG - Exonic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005629320 6:27692951-27692973 GAGGCTGAGGAGGCTGAGGCAGG + Intergenic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1005786677 6:29251297-29251319 CAGCCTGGGGAGGAGGGGCAAGG + Intergenic
1005959359 6:30684868-30684890 GAGGCTGAGAAGGAGGAGGCGGG - Exonic
1005987043 6:30882074-30882096 CTGCCTCTGGAGGAGCAGGCTGG - Intronic
1006031293 6:31178469-31178491 CATTCTGAGAAGCAGGAGGCAGG + Intronic
1006062384 6:31433491-31433513 CAGGCTGAGGAAGAGAAAGCAGG - Intergenic
1006093884 6:31644123-31644145 GAGCCTGTGGAGGAGTGGGCCGG + Exonic
1006333979 6:33411006-33411028 CGGCAGGAGGAGGAGGCGGCGGG - Exonic
1006335784 6:33420012-33420034 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1006376931 6:33676888-33676910 AAGGGTGAGGAGGTGGAGGCAGG + Exonic
1006391565 6:33761840-33761862 GAGACTGAGGATGAGGAGACTGG - Intergenic
1006547707 6:34792876-34792898 CAGACAGAAGAGGAGGAGGTGGG - Intronic
1006563138 6:34931123-34931145 CAGCCTTGGGAGGCTGAGGCGGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006639741 6:35483777-35483799 CAGCCTGATGTGGTGGAGGGAGG - Intronic
1006716305 6:36122950-36122972 AAGCCTGTGGAGGGGGAAGCGGG + Intergenic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1006910980 6:37563443-37563465 CCGGCTGAGGAGGAGGCGGGTGG - Intergenic
1007084693 6:39135089-39135111 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1007271516 6:40640974-40640996 CTGCTTGGGGAGGAGGTGGCAGG + Intergenic
1007433033 6:41787370-41787392 CAGCCTGTGGAGGTGGGGGTAGG - Exonic
1007576031 6:42925649-42925671 CAGCCTGCAGAGGAGGAGGCAGG - Exonic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1008526101 6:52408686-52408708 CAGCCTGAGGGCCAGGAGGCTGG + Intergenic
1008545028 6:52576769-52576791 GAGCCTGGGGAGGAGGGAGCTGG - Intronic
1008850307 6:56014878-56014900 CAGCCTGGGGAGGAGGAAAGAGG + Intergenic
1009269720 6:61601722-61601744 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1010841402 6:80651876-80651898 CGGCCTGGCGAGGAGGAGCCTGG + Intergenic
1011099708 6:83708431-83708453 CAGCGCGAGGAGGAGGAGGGAGG - Intronic
1011114657 6:83876943-83876965 CAGACTGGGGAGGCTGAGGCAGG - Intronic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012011228 6:93788603-93788625 CTGCCTCAGGAGGCTGAGGCAGG - Intergenic
1012315736 6:97781267-97781289 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1012408187 6:98924843-98924865 CTGCCAGTGCAGGAGGAGGCGGG - Intronic
1012767553 6:103387589-103387611 CAGCCACAGGAGGAGGAGCTGGG + Intergenic
1013366543 6:109441723-109441745 CATCCAGAGGGAGAGGAGGCTGG - Intronic
1013437649 6:110127809-110127831 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1013628841 6:111965078-111965100 GAGGCGGAGGAGGAGGAGGAGGG + Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013808233 6:114016758-114016780 CAGCCTGGGGAGGAGGTGAGAGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014611990 6:123558270-123558292 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1014631674 6:123797067-123797089 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1015165131 6:130193989-130194011 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1015181988 6:130370401-130370423 TGGGATGAGGAGGAGGAGGCTGG + Intronic
1015801471 6:137065392-137065414 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016147297 6:140692447-140692469 CAGGCTGTGGGGGAGAAGGCAGG + Intergenic
1016248778 6:142017485-142017507 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1016853172 6:148641455-148641477 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016924478 6:149329226-149329248 CAGACTTGGGAGGAAGAGGCAGG + Intronic
1017256881 6:152343638-152343660 GAGGCTGAGGAGGCTGAGGCAGG - Intronic
1017269716 6:152491847-152491869 CAGCCTGGTGAGGAGCAGCCTGG - Intronic
1017428030 6:154342624-154342646 GGGGCTGAGGAGGGGGAGGCAGG + Intronic
1017815353 6:158012246-158012268 CAGCCTGGGAAGGAGGATGTGGG - Intronic
1018025229 6:159800436-159800458 GAGCTTGAGGAGGGGGTGGCGGG + Intronic
1018077493 6:160230114-160230136 CAGCCTGGTGAGGAGGGGACAGG - Intronic
1018084596 6:160290625-160290647 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1018177409 6:161189260-161189282 GAGCCAGATGGGGAGGAGGCAGG - Intronic
1018217368 6:161542037-161542059 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018495496 6:164342793-164342815 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1018521569 6:164656206-164656228 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1018770269 6:166964522-166964544 CAGCTTCAGGAGGCTGAGGCAGG - Intergenic
1018813475 6:167314449-167314471 CAGCCTGAGGCGAAGTAGGCAGG - Intronic
1018907153 6:168082266-168082288 CAGTCTGTGGATGAGGAGTCTGG + Intergenic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019247131 6:170716436-170716458 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1019253137 7:31197-31219 GGTCCTGAGGAGGAGGAGGCTGG + Intergenic
1019312039 7:367589-367611 CAGCCTGGGGAGGAGGGAGGGGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019603345 7:1896126-1896148 GGGCCCCAGGAGGAGGAGGCAGG - Intronic
1019649965 7:2151552-2151574 CAGCCTGCAGAGCAGAAGGCAGG + Intronic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019791320 7:3015701-3015723 CAGCCAGGTGAGGAGAAGGCAGG - Intronic
1019807882 7:3141933-3141955 CAGCCTCAGGAGGCTGAGGTGGG + Intronic
1019969308 7:4527400-4527422 CAGCCTTGGGAGGCCGAGGCTGG + Intergenic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1020315953 7:6905445-6905467 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1020396750 7:7725776-7725798 CAGTCTGGGGAAGAGAAGGCAGG - Intronic
1020448436 7:8295028-8295050 CCTACTGAGGAGGCGGAGGCAGG - Intergenic
1020710380 7:11597894-11597916 CAGGCTGGGGAAGAGAAGGCAGG - Intronic
1020727386 7:11832292-11832314 CAGCTGGAGGGGGAGGAGGGGGG + Intergenic
1020794106 7:12661215-12661237 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021674201 7:23064134-23064156 CAGCCTGAGGGGGCAGAGACAGG - Intergenic
1021960526 7:25868297-25868319 CAAACTGAGGAGGAGGAAGTGGG - Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022145874 7:27539966-27539988 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1022447312 7:30480889-30480911 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1022447320 7:30480904-30480926 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1022494237 7:30843308-30843330 CAGCATTTGGAGGAGGAGGGTGG + Intronic
1022708970 7:32834025-32834047 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1022708978 7:32834040-32834062 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1022718238 7:32918120-32918142 TAACCCAAGGAGGAGGAGGCTGG + Intergenic
1022738249 7:33096297-33096319 TAACCCAAGGAGGAGGAGGCTGG + Intronic
1022859959 7:34357634-34357656 CAGCCTGATGAGGAGTGGGCTGG - Intergenic
1023289730 7:38656633-38656655 CAGCCACAGGAGGGGCAGGCTGG - Intergenic
1023296765 7:38723133-38723155 TAGGCTGAGAAGGAGGAGGAAGG + Exonic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1023698977 7:42874647-42874669 CGGCCTGGCGAGGAGCAGGCTGG + Intergenic
1023821741 7:43984426-43984448 CCTCCTCAGGAGGAGGAGCCAGG + Intergenic
1024040571 7:45550413-45550435 CAGGCTGGGGAAGAGAAGGCAGG - Intergenic
1024100666 7:46029455-46029477 AAGCCTGAGAAGCAAGAGGCTGG - Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024739354 7:52337709-52337731 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1024884310 7:54124378-54124400 CAGACTGAGGGAGAGAAGGCAGG + Intergenic
1024927643 7:54634233-54634255 CAGCTTTAGGGGGAGGAGGGAGG + Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1024972711 7:55085384-55085406 CAGCATGGGGAGCAGGATGCTGG + Intronic
1025087371 7:56034237-56034259 CCCCCGGAGGAGGAGGGGGCTGG - Intronic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1025899409 7:65731844-65731866 CCCCCGGAGGAGGAGGGGGCAGG - Intergenic
1025997319 7:66536213-66536235 CAGCATGAGCAGGAAGGGGCAGG + Intergenic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026578521 7:71594650-71594672 CAGGCAGAAGGGGAGGAGGCAGG + Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026878473 7:73893523-73893545 CAGCCCCCGCAGGAGGAGGCTGG + Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027157779 7:75780773-75780795 CAGCCTGTGGAGGAGGGGAGAGG - Intronic
1027267299 7:76501436-76501458 CAGCTTGGAGAGGAGGAGCCTGG - Intronic
1027319110 7:77001301-77001323 CAGCTTGGAGAGGAGGAGCCTGG - Intergenic
1027851860 7:83461339-83461361 CAGCCTGGCGAGGAGCAGCCTGG - Intronic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028670420 7:93395592-93395614 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1028897481 7:96058744-96058766 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1029205935 7:98869524-98869546 CAGCCTGGGGGGGTGGAAGCAGG + Intronic
1029259523 7:99292375-99292397 CAGCTGGAGGAGGAGCAGGGAGG + Intergenic
1029500124 7:100923808-100923830 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1029678906 7:102093839-102093861 GAATCGGAGGAGGAGGAGGCTGG + Intronic
1029750004 7:102537845-102537867 CCTCCTCAGGAGGAGGAGCCAGG + Intergenic
1029767954 7:102636951-102636973 CCTCCTCAGGAGGAGGAGCCAGG + Intronic
1029797224 7:102908964-102908986 CACCCTGAAGAGGAGGACACAGG - Intronic
1031422554 7:121568069-121568091 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1031685755 7:124730685-124730707 CAGCCTGAGGAGGAGGGGAAAGG - Intergenic
1031998078 7:128245957-128245979 GAGGCTGAGGAGGCTGAGGCAGG + Intronic
1032157486 7:129480828-129480850 CAGCCTCAGGAGGTTGATGCAGG - Exonic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032441636 7:131946640-131946662 GAAACGGAGGAGGAGGAGGCAGG + Intergenic
1032475607 7:132209536-132209558 CAGCCAGGGGAGGAGGGGGATGG + Intronic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032536265 7:132667152-132667174 GAGCCTGGGGAGAAGGAGACAGG + Intronic
1032579588 7:133091909-133091931 CAGCCTTGGGAGGTTGAGGCAGG + Intergenic
1033246139 7:139717855-139717877 CAGCCTTTGGAGGCTGAGGCAGG - Intronic
1033465129 7:141582862-141582884 CAGCCTGGTGAGGAGCAGCCTGG + Intronic
1033465137 7:141582877-141582899 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
1033625483 7:143106471-143106493 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034238780 7:149593527-149593549 TAGGCTGAGGAGGAGGATGAGGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034492141 7:151399156-151399178 CACCCTGAGGAGGAGGCTGAAGG - Intronic
1034720393 7:153286875-153286897 CAGCCTGAGCAGGAGCTGGTCGG + Intergenic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035239566 7:157520929-157520951 GAGACTGGGGAGGAGGAGGGTGG + Intergenic
1035474985 7:159136917-159136939 ATACCTGGGGAGGAGGAGGCAGG + Intronic
1035501006 8:91498-91520 CAGCCTCCGCAGGAGGAGGTGGG + Intergenic
1035534755 8:382420-382442 AAGCGGGAGAAGGAGGAGGCAGG + Intergenic
1035633541 8:1126891-1126913 CTGCCTCAGGAGGAGCTGGCTGG - Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036549565 8:9804589-9804611 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1036549573 8:9804604-9804626 CAGCCTGGTGAGGAGCAGCCTGG - Intergenic
1036601051 8:10260408-10260430 GAGACAGAGGAGGAGGAAGCGGG + Intronic
1036686311 8:10913955-10913977 CAGCCTGGGGTGCAAGAGGCTGG + Intronic
1037974924 8:23202259-23202281 CAGCCTGCTGAGGAAGAGGGAGG + Intronic
1038554246 8:28494977-28494999 CAGCCCGCGGAGGAGGCAGCCGG - Intronic
1038624929 8:29182501-29182523 CAGCCTAAGGGGGCGGAGGAGGG + Intronic
1038913096 8:31989133-31989155 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1039406557 8:37318327-37318349 CCCCCTGAGGAGCAGGAGCCAGG + Intergenic
1039499102 8:38002766-38002788 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1039577777 8:38638328-38638350 CAGCCTTGGGAGGCTGAGGCAGG - Intergenic
1039793930 8:40896601-40896623 AAGCCAAAGGCGGAGGAGGCAGG + Intronic
1040427836 8:47307330-47307352 CAGCCTCAGGAGGCTGAGGCAGG - Intronic
1040570240 8:48602144-48602166 AAGACAGAGAAGGAGGAGGCGGG - Intergenic
1040647930 8:49421119-49421141 CAACCTGAGGAGGAGCAGTCTGG - Intergenic
1041191218 8:55356849-55356871 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1041237956 8:55823775-55823797 AAACCTGGGGAGGAGGAGGAAGG + Intronic
1041260629 8:56018239-56018261 CTGCCTTAGGAGGCCGAGGCAGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041401373 8:57448768-57448790 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1041444294 8:57933171-57933193 TACCCTGAGCAGGAAGAGGCAGG + Intergenic
1041601194 8:59718986-59719008 GAGTCTGAGTATGAGGAGGCTGG + Intergenic
1041651938 8:60310591-60310613 CGACCTGAGGAGGAGCAGCCTGG + Intergenic
1041651946 8:60310606-60310628 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1041926142 8:63238636-63238658 CAGCCTCAGGAGGCTAAGGCAGG - Intergenic
1042001030 8:64123729-64123751 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1042154929 8:65834178-65834200 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1042529721 8:69802664-69802686 GAGCCTCAGCAGGAAGAGGCTGG - Intronic
1042560507 8:70069954-70069976 CTGGCTGGGGTGGAGGAGGCTGG - Intronic
1042705994 8:71666042-71666064 CAACCTGAGGAGAAGCAGTCTGG - Intergenic
1042707270 8:71676568-71676590 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1043509264 8:80933487-80933509 CAGCCTGTGAAAGAGGAGGAAGG + Intergenic
1043519141 8:81025721-81025743 CAGCCACAGGAGGAGGTGCCTGG + Intronic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1045051966 8:98335675-98335697 CAGCCCCAGGAGCAGAAGGCTGG - Intergenic
1045224605 8:100232243-100232265 TTGGCTGCGGAGGAGGAGGCTGG + Intronic
1045495028 8:102700849-102700871 GAGGCTGGGGAGGAGGAGCCTGG - Intergenic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046074797 8:109302465-109302487 CAGCCTGGGGAGGAGGGGAGAGG - Intronic
1046128643 8:109941335-109941357 CAGTCTGGGGAAGAGAAGGCAGG + Intergenic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1048068906 8:131001205-131001227 AAGCCTGAGGACGAGGAGTGAGG + Intronic
1048498227 8:134953377-134953399 CAGCCTGTGGAGATTGAGGCTGG - Intergenic
1048573187 8:135671644-135671666 CAGCCTGAGGAGGCAGGGGCTGG + Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1048956701 8:139543416-139543438 GAGCAAGTGGAGGAGGAGGCAGG + Intergenic
1049250791 8:141588011-141588033 AAGCCAGAGGAGGGGAAGGCAGG + Intergenic
1049322280 8:142002945-142002967 GGGCCAGAGGAGGAGGCGGCTGG - Intergenic
1049389470 8:142360580-142360602 CAGCCTGAGGGGCTGGTGGCTGG - Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049868913 8:144958347-144958369 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1049976933 9:868929-868951 GAGCCTGGGGAGGTTGAGGCTGG + Intronic
1050117502 9:2277213-2277235 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1050140373 9:2511044-2511066 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050377041 9:4984722-4984744 CAGCCTGCACTGGAGGAGGCCGG - Intergenic
1050474066 9:6021605-6021627 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1050790563 9:9463472-9463494 AAGCTGGAGGTGGAGGAGGCAGG + Intronic
1051052531 9:12949976-12949998 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051668136 9:19484462-19484484 CAGCCGGAGAAGCTGGAGGCTGG + Intergenic
1052877572 9:33578787-33578809 CAGGGTGGGGAGGAGTAGGCTGG + Intergenic
1053060068 9:35023706-35023728 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1053114424 9:35489445-35489467 CAGCCAGAGGGGGATGGGGCAGG - Intergenic
1053134062 9:35638315-35638337 CGACCTGAGGAGGAGCAGTCTGG - Intronic
1053498416 9:38565421-38565443 CAGGGTGGGGAGGAGTAGGCTGG - Intronic
1053575557 9:39355561-39355583 CAGCAGGAGGGGGAGGAGGAGGG - Intergenic
1053751954 9:41266195-41266217 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054153963 9:61627375-61627397 CAGGATGATGAGGAGAAGGCAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054257477 9:62830525-62830547 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054731877 9:68709309-68709331 GAGCCTGGGGAGGTTGAGGCTGG - Intronic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055413758 9:76060457-76060479 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055599560 9:77901519-77901541 CGGCCTAAGGAGGAAGAGGCAGG - Intronic
1055699091 9:78921761-78921783 AAGGCTGAGGAGGAGGAAGGAGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055809956 9:80139065-80139087 CAGCCTGGGGAGGAAGAGAGAGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056301352 9:85245074-85245096 CAGGCTCGTGAGGAGGAGGCTGG - Intergenic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057550723 9:96049489-96049511 CAGCCTGGAGCGGAGCAGGCCGG + Intergenic
1057621378 9:96639036-96639058 GAGCAGGAGGAGGAGGAGGAGGG + Intergenic
1057677873 9:97149908-97149930 CAGGGTGGGGAGGAGAAGGCTGG - Intergenic
1057803739 9:98206098-98206120 CTGCCTCAGGAGGCTGAGGCAGG - Intronic
1057922009 9:99105234-99105256 CAGCACGAGGAGGAGCAGCCGGG - Exonic
1057942843 9:99299940-99299962 CTGCCTGAAGGGGAGGATGCAGG - Intergenic
1058026302 9:100144758-100144780 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
1058259229 9:102809417-102809439 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1058745529 9:107986812-107986834 GAGGATGAGGCGGAGGAGGCTGG + Intergenic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1059546259 9:115178709-115178731 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1059863574 9:118489713-118489735 CGGCCTGACGAGGAGCAGCCTGG + Intergenic
1059935365 9:119304875-119304897 CAGCCTGAGGAGTGGGAGAAAGG - Intronic
1060050064 9:120372133-120372155 AAGGCTGAGGAGGAGGAAGTGGG - Intergenic
1060135322 9:121147921-121147943 CAGACTGAGAAGGAGAAGGAGGG + Intronic
1060205275 9:121678987-121679009 CATCCTGAGAGGGAGGGGGCAGG + Intronic
1060209287 9:121700056-121700078 CAGCCTGAGGCTGGGGAGCCAGG + Intronic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1060350896 9:122858914-122858936 ACGGCTGCGGAGGAGGAGGCTGG + Exonic
1060402632 9:123357312-123357334 CAGCCTGTGGTGGTGGGGGCAGG - Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060407195 9:123378633-123378655 GAGCGTGGGGAGGAGGCGGCTGG + Exonic
1060484662 9:124039572-124039594 AAGGCAGGGGAGGAGGAGGCAGG + Intergenic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1060718300 9:125955275-125955297 CTGGCTGAGGAAGAGGAAGCGGG - Intronic
1060798133 9:126526469-126526491 AAGCCTCAGGAGCTGGAGGCTGG + Intergenic
1060819337 9:126652280-126652302 GAGTCTGAGGAGGAGAAGGGGGG + Intronic
1060920183 9:127414957-127414979 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1060962580 9:127691515-127691537 CAGGCTGTGGAGGAGGACGCTGG - Exonic
1061162301 9:128902391-128902413 CTGCCTCAGAAGGAGGAGTCTGG + Intronic
1061419011 9:130463320-130463342 GATGCCGAGGAGGAGGAGGCCGG - Intronic
1061507196 9:131038101-131038123 CAGGCAGAGGAAGAGGGGGCGGG - Intronic
1061582963 9:131548708-131548730 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1061623660 9:131827769-131827791 CAGCCTGGGGAGCAGGAGCGGGG + Intergenic
1061749927 9:132770477-132770499 CACCCTGTGGAGGAGCGGGCTGG + Intronic
1062158861 9:135068891-135068913 GAGCCTGGGGAGGAGCAGCCAGG + Intergenic
1062173341 9:135147586-135147608 GAGCCAGAGGAGGAGGAGGTCGG - Intergenic
1062299457 9:135856919-135856941 CATCCTGAAGAGGAGGTGGAGGG - Intronic
1062326054 9:136013123-136013145 CAGCCTGAGGAGGACTGGGTGGG - Intronic
1062338720 9:136084044-136084066 CAGCCTGAGGAAGAGCGGGGAGG + Intronic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062491019 9:136804950-136804972 CAGCCTCTGGAGGGAGAGGCAGG - Intronic
1062691426 9:137844023-137844045 CGACCTGAGGAGGAGCAGTCTGG - Intronic
1062738279 9:138150631-138150653 CAGCCTGAGGTCGAGGAAACGGG + Intergenic
1062747233 9:138221169-138221191 GGTCCTGAGGAGGAGGAGGCTGG - Intergenic
1203607906 Un_KI270748v1:71914-71936 CAGCCTCCGCAGGAGGAGGTGGG - Intergenic
1185491193 X:518239-518261 CAGGCTGAGGTGGAGGATGGAGG - Intergenic
1185499042 X:583931-583953 AAACAAGAGGAGGAGGAGGCTGG + Intergenic
1185728042 X:2438554-2438576 CTGCCTCAGGAGGGTGAGGCAGG + Intronic
1186112967 X:6276242-6276264 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1186350845 X:8737715-8737737 CAGCCTCGGGAGGCTGAGGCAGG + Intergenic
1186437150 X:9552407-9552429 TTGCCTGAGGAGGAGTTGGCTGG + Intronic
1186751631 X:12627500-12627522 GAGCCTGAGGAGAAAGAGGTTGG + Intronic
1186783969 X:12941449-12941471 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1186792478 X:13012451-13012473 CAGCCTGAGAAGGACTTGGCCGG + Intergenic
1187009759 X:15267299-15267321 CTGCCTCAGGAGGGAGAGGCAGG - Intronic
1187342773 X:18436223-18436245 TAGGCTGAGGAGGAAGAGGGAGG + Intronic
1187604901 X:20872129-20872151 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1187736911 X:22314142-22314164 CCACCAGAGGAGGAGGAGGAGGG + Intergenic
1188301148 X:28506472-28506494 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
1188301156 X:28506487-28506509 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1188333124 X:28896678-28896700 CAGCCTGGGGAGGAGGGGAGAGG + Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188890956 X:35610734-35610756 CAACCTGAGGAGGAGCAGTCTGG - Intergenic
1189031906 X:37459874-37459896 CGACCTGAGGAGGAGCAGTCTGG + Intronic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189893697 X:45632245-45632267 CAGCCGCAGGAGGGGCAGGCTGG + Intergenic
1191014297 X:55792365-55792387 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1191184298 X:57592778-57592800 GCGCCTGAGGAGGAGGCGGAGGG + Exonic
1191220843 X:57986153-57986175 CAGCCGCAGGAGGGGCAGGCTGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192243907 X:69357867-69357889 CATCCTGAAGAGGAGGAAGGAGG - Intergenic
1192359926 X:70433015-70433037 AAGCCTGGGGAGGAGGGGGAGGG - Exonic
1192454489 X:71265828-71265850 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1192550412 X:72049058-72049080 GAGCAGGAGGAGGAGGAGGAGGG + Intergenic
1192731608 X:73806962-73806984 CAGCCTGGTGAGGAGCAGCCTGG + Intergenic
1192731616 X:73806977-73806999 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1192914236 X:75636351-75636373 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1192935955 X:75858675-75858697 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1193369445 X:80676942-80676964 GAGGCAGAGGAAGAGGAGGCAGG - Exonic
1193516987 X:82478265-82478287 CAGCCTGAGGATCTGGAGGGAGG - Intergenic
1193885842 X:86983462-86983484 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1194503076 X:94702872-94702894 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1195017053 X:100790509-100790531 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1195418534 X:104647169-104647191 CAGCCTGCAGAGGTGCAGGCAGG + Intronic
1195633570 X:107087715-107087737 CAGCTTGTGGAGGCTGAGGCAGG - Intronic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1195809756 X:108816584-108816606 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1195923101 X:110002384-110002406 GAGCCTGAGCCGGAGGAGGGAGG + Intergenic
1196016456 X:110944898-110944920 CAGCCTGGGGAAGTGGATGCAGG - Intronic
1196135934 X:112209576-112209598 CAGGCTGGGGAAGAGAAGGCAGG + Intergenic
1196434199 X:115660060-115660082 CAGCTTGATGTGGAGGAGGAAGG - Intergenic
1196496766 X:116332443-116332465 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1196859878 X:120016565-120016587 AAGCATGAGGAGGACGAGGAGGG - Intergenic
1196992777 X:121347054-121347076 CAGCCTGGCGAGGAGCAGCCTGG + Intergenic
1196992787 X:121347069-121347091 CAGCCTGGGGAGGAGGGGAGGGG + Intergenic
1197793546 X:130278685-130278707 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1198180111 X:134199227-134199249 CAGCCTTCGGAGGCTGAGGCAGG - Intergenic
1198598359 X:138260442-138260464 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic
1198767206 X:140091727-140091749 CGGCCTGAAGAGGAGGATGGAGG + Intergenic
1198867015 X:141133904-141133926 TAGCTTGAGGAAGAGGAGACTGG + Intergenic
1199201508 X:145095217-145095239 CAGACTTAGGAAGAGGAAGCAGG - Intergenic
1199377719 X:147133188-147133210 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1199764274 X:150929654-150929676 CTGCCTGGGGAGGCTGAGGCAGG - Intergenic
1200400357 X:156016406-156016428 CAGCCTGAGGCCGAGGAAACAGG - Intergenic
1200521301 Y:4212291-4212313 CAGGCTGAGGGAGAGAAGGCAGG - Intergenic
1200659528 Y:5942853-5942875 CAGCCTGGCGAGGAGCAGCCTGG - Intergenic
1200749447 Y:6931285-6931307 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1201473588 Y:14358508-14358530 CAGCCTGGGGAGGAGGGGAGAGG + Intergenic
1201486141 Y:14496479-14496501 CAGCCTCAAGAAGAGGAGGCAGG - Intergenic
1201540766 Y:15102675-15102697 CAGTCTGGGGAGGAGGAGAGAGG + Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202061960 Y:20897860-20897882 CAGCCTGGGGAGGAGGGGAGAGG - Intergenic