ID: 1003114786

View in Genome Browser
Species Human (GRCh38)
Location 6:3276603-3276625
Sequence CAGACAGAGCTGAGGGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 412}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003114786_1003114790 -6 Left 1003114786 6:3276603-3276625 CCGGGGTCCCTCAGCTCTGTCTG 0: 1
1: 0
2: 2
3: 56
4: 412
Right 1003114790 6:3276620-3276642 TGTCTGGTGCTCGCTCTGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 220
1003114786_1003114792 8 Left 1003114786 6:3276603-3276625 CCGGGGTCCCTCAGCTCTGTCTG 0: 1
1: 0
2: 2
3: 56
4: 412
Right 1003114792 6:3276634-3276656 TCTGTGAGGTTGGCCTATGCTGG 0: 1
1: 0
2: 0
3: 8
4: 106
1003114786_1003114794 28 Left 1003114786 6:3276603-3276625 CCGGGGTCCCTCAGCTCTGTCTG 0: 1
1: 0
2: 2
3: 56
4: 412
Right 1003114794 6:3276654-3276676 TGGCTCAGCCGAGCTCCCACAGG No data
1003114786_1003114791 -2 Left 1003114786 6:3276603-3276625 CCGGGGTCCCTCAGCTCTGTCTG 0: 1
1: 0
2: 2
3: 56
4: 412
Right 1003114791 6:3276624-3276646 TGGTGCTCGCTCTGTGAGGTTGG 0: 1
1: 0
2: 3
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003114786 Original CRISPR CAGACAGAGCTGAGGGACCC CGG (reversed) Intronic
900393137 1:2442516-2442538 CAGGCAGAGCTGACGGGCCCAGG + Intronic
900572926 1:3368284-3368306 CAGACAGAGGTGTCGGAGCCTGG - Intronic
900577526 1:3390695-3390717 CAGACAGAAACGCGGGACCCGGG - Intronic
900873104 1:5319356-5319378 GAAACAGAGCTGAGAGACCAGGG + Intergenic
901211449 1:7528513-7528535 GACTCAGAGCTGAGGAACCCAGG - Intronic
901221040 1:7583934-7583956 CCGTCAGAGCTCAGGGTCCCAGG - Intronic
901638287 1:10680370-10680392 CAGACAGACCTGTGGGTCCCTGG - Intronic
902452513 1:16506188-16506210 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
902472569 1:16658862-16658884 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
902486236 1:16748581-16748603 CAGGCAGAGCTCAGGGATCTAGG + Intronic
902716599 1:18277034-18277056 GAGACAGGACTGAGAGACCCAGG + Intronic
902764506 1:18605560-18605582 CAGAGAGAGCTCTGGGACCCAGG - Intergenic
903164303 1:21509838-21509860 CAGACAGAGCGCAGGGTCCCAGG - Intronic
903238042 1:21963540-21963562 CAACCAGAGCAGAGGGTCCCTGG + Intergenic
903296277 1:22345144-22345166 TAGACAGAGCTGATGCACCAGGG - Intergenic
903614533 1:24642514-24642536 CAGCCAGAGCAGAGGCACCAGGG + Intronic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903928973 1:26851281-26851303 GAGGCAGGGCTGAGGGAGCCTGG + Intronic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904274540 1:29371729-29371751 CAGACAGCCCTGAGGGTCCCTGG - Intergenic
904611089 1:31726767-31726789 AAGACAGAGCTTAGTGACCTTGG - Intergenic
904815866 1:33197701-33197723 GAGACAGAGCTGAGAGGCCAAGG + Intergenic
904866012 1:33579491-33579513 CAGAGGAAGCTGAGGGCCCCTGG - Intronic
905548588 1:38818447-38818469 CAGAGCGAGCTGTGTGACCCTGG + Intergenic
905628640 1:39506042-39506064 CAGTCAGATCGGAGGGGCCCCGG + Intronic
905684941 1:39901501-39901523 CCGACTGTGCCGAGGGACCCGGG - Intronic
905687596 1:39919781-39919803 CAGAAGGAGCTGACGGCCCCAGG + Intergenic
906942663 1:50269165-50269187 GAGTCAGAGCTGAGAGTCCCAGG + Intergenic
906950158 1:50328515-50328537 CAGACAGAGCAGAAGCAGCCTGG + Intergenic
907222224 1:52915273-52915295 CAGACAAAGCTGAGGACCCTGGG - Intronic
907805723 1:57817514-57817536 CAGCCTGAGCTGAGAGCCCCAGG - Intronic
908067276 1:60420492-60420514 CACACAGACATTAGGGACCCAGG + Intergenic
910350692 1:86294239-86294261 GAGACAGAGCTGAGAGTCCAGGG - Intergenic
910669566 1:89759468-89759490 AAGGAAGAGCTGAAGGACCCTGG - Intronic
911297130 1:96131839-96131861 CAGAAAGAGCTTAGACACCCAGG - Intergenic
913106607 1:115620159-115620181 GAGACAGAGCTGAGAGTCCAGGG + Intergenic
913219322 1:116646704-116646726 GCCACAGACCTGAGGGACCCCGG - Intronic
913314323 1:117537304-117537326 CAGAGAGAGCCAAGGGACTCGGG + Intergenic
915143396 1:153780390-153780412 AAGACAGAGCAGTGGGAGCCTGG - Intergenic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915528113 1:156488478-156488500 CAAAGAGAGCTGAGGGGACCAGG + Intronic
915648436 1:157290376-157290398 GAGACACAGGGGAGGGACCCTGG - Intergenic
916843206 1:168621644-168621666 CAGAAGGAACTTAGGGACCCTGG + Intergenic
917704345 1:177616438-177616460 CAGAAAGCCCTGAGGGTCCCTGG + Intergenic
918781441 1:188704801-188704823 CAGATAGAACTGAGGAACCAAGG - Intergenic
918879303 1:190094920-190094942 CAGAAATAGCTGATGGTCCCAGG - Intergenic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
920695700 1:208179994-208180016 CAGCCAGAGGGGAGAGACCCAGG - Intronic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
920937487 1:210449159-210449181 CAGACATGGCAGAGGGACCCGGG - Intronic
921070249 1:211652488-211652510 CACAGAGAGCTGAGATACCCTGG - Intergenic
921582966 1:216916247-216916269 CAGGGAGAGCTGAGGGTCCCTGG - Intronic
921924769 1:220702470-220702492 CAGGCAGAGTTGAGGGAACATGG + Intergenic
922166136 1:223117153-223117175 CCGGCAGTGCTGGGGGACCCGGG + Intronic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
923056832 1:230432824-230432846 CAGCCAGAACTGAGGATCCCTGG + Intergenic
924446760 1:244140066-244140088 CAGAGAGAGCGGAGAGACCTTGG - Intergenic
1062872897 10:922062-922084 CAGACAGAGCGGAGGGGTCAGGG + Intronic
1063995076 10:11611477-11611499 CGGACAGAGCTGGCGGTCCCGGG + Intronic
1064110580 10:12535236-12535258 CAGACAGAGCTGGGAGAGACAGG - Intronic
1064145609 10:12823963-12823985 AAGACAGAGAGGAGGGACCTCGG + Intronic
1064154755 10:12894660-12894682 CACACTGAGCTCAGGGACCCAGG + Intergenic
1065328581 10:24571107-24571129 CAGAAAGAGCTGAGGGGGGCTGG + Intergenic
1065919993 10:30384897-30384919 CAGACAAACGGGAGGGACCCAGG - Intergenic
1065921569 10:30397945-30397967 CAGACAGAGATGAGGCTCCTGGG + Intergenic
1066460610 10:35608963-35608985 CAAGCAGAGCTGAGAGAGCCCGG + Intergenic
1067074597 10:43168994-43169016 CAGACAGAATGGAGGGAGCCTGG + Intronic
1067225401 10:44372970-44372992 GAGACTGGGCTGAGGGAGCCTGG - Intronic
1067249857 10:44577024-44577046 GAAACAGTGCTGAGGGCCCCAGG + Intergenic
1068079167 10:52297971-52297993 CAGACAGAGCTCTGGGACCTTGG + Exonic
1069430245 10:68328561-68328583 CATAGAGATCAGAGGGACCCTGG - Intronic
1069708703 10:70475528-70475550 CTGCCACAGCTGAGGGACACTGG - Intergenic
1069735194 10:70649404-70649426 CAGACAGAAATGGTGGACCCAGG - Intergenic
1069814194 10:71183286-71183308 CAGGCAGGGCTAAGGGACCAAGG + Intergenic
1069818270 10:71212407-71212429 GCGGCAGAGCTGGGGGACCCGGG - Intergenic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070850138 10:79556813-79556835 GAGGCAGAGCTGAGGGGACCAGG + Exonic
1070857084 10:79614487-79614509 GAGAGAGAGCTGAGGGGACCAGG - Exonic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073106794 10:101036800-101036822 GAGGCAGAGGTGAGTGACCCCGG + Exonic
1074640213 10:115370928-115370950 TGGACACAGCAGAGGGACCCTGG - Intronic
1074711625 10:116182866-116182888 CAGCCAGAGCTGAGCGCTCCTGG + Intronic
1074756016 10:116624706-116624728 CTGACAGAGTTTAGGGAGCCAGG + Intronic
1075650928 10:124128097-124128119 CTGAGAGACCTGAGGGACCCTGG + Intergenic
1077009943 11:375255-375277 CCCAGAAAGCTGAGGGACCCTGG - Intronic
1077338424 11:2015626-2015648 CAGACAGGGCTCCGGGACCAAGG - Intergenic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1078063557 11:8063085-8063107 GAGACAGATGTGAGGGTCCCCGG - Intronic
1078239170 11:9514548-9514570 CAGAAAGTGCTGTGGCACCCTGG + Intronic
1079427424 11:20356849-20356871 CAAAGAGACCTGAGGGTCCCAGG - Intergenic
1080233596 11:30044959-30044981 CAGACAGAAAGGAGGGAGCCAGG + Intergenic
1080315041 11:30938313-30938335 CAGACAGACAGGAGGGAGCCAGG - Intronic
1080425914 11:32154160-32154182 TAGCCAGAGCTGATGGGCCCAGG - Intergenic
1081018203 11:37908467-37908489 CAGACAGACAGGAGGGAGCCAGG - Intergenic
1081354382 11:42095097-42095119 TGCACAGAGCAGAGGGACCCTGG - Intergenic
1082089904 11:48080787-48080809 AAGACAGAGCTAAGGTACTCTGG - Intronic
1082959800 11:58907278-58907300 AAGACAAAGCTGAGAGACCAAGG - Intronic
1082981808 11:59131087-59131109 CAGACAGAGATGAGGAACTTGGG + Intergenic
1083103892 11:60338286-60338308 CAAACAGAGCAGAAAGACCCGGG + Intronic
1083938711 11:65883624-65883646 AGGACAGAGCTGAGGGGGCCAGG - Exonic
1084201006 11:67558328-67558350 CAGAGAGAGCAGGGGGAGCCTGG - Intergenic
1084462242 11:69302519-69302541 CACTAAGAGCTTAGGGACCCAGG + Intronic
1084497995 11:69516532-69516554 GAGACATAGATGAGGGATCCTGG + Intergenic
1084661611 11:70549659-70549681 GGGACAGAGCTCTGGGACCCTGG - Intronic
1084891926 11:72240885-72240907 GAGACAGAGCGGAGGTAGCCTGG + Intronic
1084892950 11:72245316-72245338 CAGATGGAGCTGAGGGAACGGGG - Intronic
1084970371 11:72768242-72768264 CAGAAAGAGCAGAGGGGCACTGG - Intronic
1085224791 11:74909917-74909939 GAGCCAGAGCTCAGGGATCCTGG - Intronic
1085287942 11:75376271-75376293 CAACCAGAGCTTAGGGACCCTGG - Intergenic
1085460258 11:76689219-76689241 CAGCCAGAGCTACGGGAGCCTGG + Intergenic
1087496317 11:98894416-98894438 CACACACAGCACAGGGACCCTGG + Intergenic
1088142717 11:106636737-106636759 CAGGCAGAGATGGGGGAACCTGG - Intergenic
1088880193 11:113967473-113967495 CATACATAGCTGAGTGACCTTGG + Intergenic
1090403998 11:126466459-126466481 GGGACAGAGCTGGGGGGCCCAGG + Intronic
1090660628 11:128879414-128879436 CAGAAAGAGTGCAGGGACCCTGG - Intergenic
1091241240 11:134053815-134053837 CAGACACTGCCGAGGGAACCAGG + Intergenic
1202821408 11_KI270721v1_random:70808-70830 CAGACAGGGCTCCGGGACCAAGG - Intergenic
1091646217 12:2274207-2274229 CAGAAAGTGCTGTGGGGCCCAGG + Intronic
1092140528 12:6180455-6180477 CGGCCAGAGGTGAGGGTCCCTGG - Intergenic
1092767864 12:11869604-11869626 CTGAGAGAGCTCAGGGACCCAGG + Exonic
1092964060 12:13624810-13624832 CACACAGCGCTGAGGGGGCCTGG - Intronic
1093129650 12:15374899-15374921 CAGTCAGAGATGAGGGACTGGGG - Intronic
1094006422 12:25757130-25757152 GAGACAGAGCTGAGGGCCTGGGG + Intergenic
1096086257 12:48867045-48867067 CAGAGAGAAATGAGGGACTCTGG + Intergenic
1096774752 12:53957056-53957078 CGGAGAGAGCTGAGGGAGTCAGG + Exonic
1097045116 12:56181870-56181892 CAGACAGAGCTGTGGCTTCCAGG - Intronic
1097145178 12:56935026-56935048 CAGAAAGACCTGGGGGACTCAGG + Intergenic
1097617293 12:61898638-61898660 GGCACAGAGCAGAGGGACCCTGG + Intronic
1098578493 12:72071189-72071211 TGCACAGAGCAGAGGGACCCTGG + Intronic
1098915702 12:76254843-76254865 CAGACAGAGTTGAGAGACTGTGG + Intergenic
1101365316 12:104064871-104064893 GGGACAGAGCTGCCGGACCCGGG - Intronic
1102569478 12:113818830-113818852 CAGACAGGGGTGAGGGACAGTGG - Intronic
1103012196 12:117466012-117466034 CACACACAGGTGAGGGACACAGG + Exonic
1103124928 12:118413549-118413571 CACACAGAGCTCAGTAACCCTGG + Intronic
1103191223 12:119003657-119003679 CAGAAAGATCAGAGGGACACTGG + Intronic
1104836493 12:131795443-131795465 TAGACAGAGCTGCGGTAGCCAGG - Intronic
1105528930 13:21200738-21200760 TGCACAGAGCAGAGGGACCCTGG + Intergenic
1108247528 13:48532886-48532908 CAGAGACAGCTGAGGGGCCCAGG - Intronic
1108419003 13:50229499-50229521 CAGACAGTATTGAGTGACCCAGG + Intronic
1109881275 13:68480530-68480552 CACACAGAGCTGTGGGACTTAGG - Intergenic
1111459400 13:88519910-88519932 TACACACAGCAGAGGGACCCTGG - Intergenic
1113164017 13:107417255-107417277 CAGACAATGGTTAGGGACCCAGG - Intronic
1113421758 13:110176554-110176576 CAGAAAGAGCTGGGGAACACAGG + Intronic
1115707357 14:36012897-36012919 CAGACAGACAGGAGGGAGCCAGG - Intergenic
1116133602 14:40891756-40891778 TACACACAGCAGAGGGACCCTGG + Intergenic
1117996017 14:61479053-61479075 CAGAAAGACATGAGGAACCCTGG + Intronic
1118922768 14:70165264-70165286 GTGACAGAACTGAGTGACCCGGG - Intronic
1119393159 14:74305001-74305023 TAGACAATGCTGAGGCACCCTGG - Intronic
1119543476 14:75455773-75455795 TGGACAGAGCTTAGGGAACCCGG - Intronic
1119544345 14:75460741-75460763 GTGGGAGAGCTGAGGGACCCTGG + Intronic
1122440814 14:101730733-101730755 AAGACAGAGCTGAGAGTCCAGGG + Intronic
1122517912 14:102321334-102321356 CAGCCACACCTGAGGGACCTTGG - Intronic
1122969814 14:105147966-105147988 CAGACAGGGCAGACAGACCCGGG + Intronic
1123105031 14:105837317-105837339 GAGGCAGGGCTGAGGGAGCCTGG - Intergenic
1124552717 15:30696408-30696430 AGCAGAGAGCTGAGGGACCCAGG - Intronic
1124559744 15:30760626-30760648 GAGACAGAGCTTAGAGTCCCAGG + Intronic
1124671505 15:31645095-31645117 GAGACAGAGCTTAGAGTCCCAGG - Intronic
1124678525 15:31709262-31709284 AGCAGAGAGCTGAGGGACCCAGG + Intronic
1124722215 15:32120175-32120197 CAGACCCAGCTGAGTGACCTCGG - Intronic
1125202663 15:37113685-37113707 CAGCCAGCCCTCAGGGACCCTGG - Intergenic
1125375604 15:39025636-39025658 CAGACAGGGCGTAGGGAGCCAGG + Intergenic
1125721071 15:41845458-41845480 CCCAAAGGGCTGAGGGACCCTGG - Intronic
1126312113 15:47329239-47329261 CAGAAAGAGCTGAGGGGTCAGGG + Intronic
1126409403 15:48356513-48356535 CAGAGAGATGTGAGGGACTCAGG + Intergenic
1128222942 15:65981794-65981816 CAGAGAGAGGTGAGGGTCCTAGG - Intronic
1128709288 15:69859793-69859815 CAGTAAGAGCTGTGGGACACTGG + Intergenic
1128783830 15:70380178-70380200 CAGACAGAGCTGGGGGGACTTGG + Intergenic
1128812851 15:70585142-70585164 AAGACAGAGCAGCGGGACCCGGG + Intergenic
1129372742 15:75108430-75108452 GAGCAAGAGCTGAGTGACCCTGG - Intronic
1129477763 15:75797554-75797576 CAGACAGAGATGAGGCTCCTGGG - Intergenic
1129600653 15:76996389-76996411 CAGCCAGAGCTGAGGGGCAGAGG - Intronic
1129607453 15:77031759-77031781 TCCACAGAGCTCAGGGACCCTGG - Intronic
1129614716 15:77089256-77089278 CAGACAGGACAGAGGGATCCTGG + Intergenic
1129835830 15:78704820-78704842 CAGACAGAGATGAGGCTCCTGGG - Intronic
1130146677 15:81279802-81279824 CAGCCAGTGCTGGGAGACCCAGG - Intronic
1131071925 15:89471461-89471483 CAGAGAGGTCTGGGGGACCCAGG + Exonic
1131475411 15:92734359-92734381 CAGACAACCCTGAGGGACCATGG - Intronic
1132600990 16:772876-772898 CAGACAGAGGTGAGGGCACCTGG - Exonic
1132743708 16:1428234-1428256 CCGACACAGCTGAGGGACGGCGG - Intergenic
1132873199 16:2124618-2124640 CACTCAGAGCTGAGTGCCCCAGG + Intronic
1132956453 16:2596853-2596875 CAGGCAGAGCAGAGGGGCCAGGG + Intronic
1133382032 16:5339250-5339272 CAGACAGACCTCAGGGAAACTGG - Intergenic
1133532633 16:6669846-6669868 CAGGCAGATCTGATGGAGCCAGG + Intronic
1133543910 16:6786520-6786542 CAGACAGAGTTCAGAGATCCTGG + Intronic
1134552287 16:15143797-15143819 CACTCAGAGCTGAGTGCCCCAGG + Intergenic
1136374395 16:29856787-29856809 CAGTCAGGGATGTGGGACCCAGG + Intergenic
1137396955 16:48122982-48123004 CAGAAACAGCTGGGGAACCCAGG + Intronic
1137576596 16:49604171-49604193 GAGACAGTGGTGAGGGGCCCGGG - Intronic
1138237250 16:55394947-55394969 CACACAGACCTGAGGGATCTTGG - Intronic
1139298769 16:65926044-65926066 CAGACAGCAATGAGGGACCTTGG - Intergenic
1139334801 16:66224248-66224270 CAAAGAGAGGTGAGGCACCCAGG + Intergenic
1139368274 16:66447296-66447318 CAGCAAGAGCTAAGAGACCCAGG + Intronic
1139655951 16:68387381-68387403 CTGACTGAGGTGAGGGATCCTGG + Intronic
1140423053 16:74836468-74836490 GCGCCACAGCTGAGGGACCCTGG - Intergenic
1140687847 16:77450829-77450851 CAGCCTGAGCTGCTGGACCCTGG + Intergenic
1141256620 16:82408471-82408493 CAGCCAGGGCTGAGAGCCCCTGG - Intergenic
1141786092 16:86201816-86201838 CAGGCAGAGCTGAGTGAGGCGGG + Intergenic
1143115554 17:4580063-4580085 CAGACAGAGCTGTGGGTCTAGGG + Intergenic
1144866153 17:18337294-18337316 CACCCAGTGCTGAGGGACTCCGG - Intronic
1145278602 17:21452926-21452948 CAGAAAGGGCTGAGCGTCCCAGG - Intergenic
1145399248 17:22517559-22517581 CAGAAAGGGCTGAGCGTCCCGGG + Intergenic
1145770804 17:27491749-27491771 CACACAGACCTGGGCGACCCTGG - Intronic
1145808015 17:27748360-27748382 CTGATAGAGCTGGGGGACCCGGG - Intergenic
1146058930 17:29594370-29594392 CAGAGGAAGCTGAGGGGCCCTGG + Intronic
1146631671 17:34474416-34474438 CAGAGAGAGGAGCGGGACCCAGG + Intergenic
1147855696 17:43478093-43478115 GAGACAGAGTTCAGGGGCCCAGG - Intergenic
1148133642 17:45277644-45277666 CAAACTGAGCTGAGGCACCCCGG + Intronic
1148191263 17:45680335-45680357 CAGACAGAGCTGACCTACCCTGG - Intergenic
1148237418 17:45978227-45978249 AAGCCAGAGCTGAGGCACCTTGG + Intronic
1148588054 17:48794889-48794911 CAGTCACAGCTGCGGGACCTGGG + Intronic
1148904217 17:50901288-50901310 CAGTCAGATCTGAGAGACCTTGG - Intergenic
1151565292 17:74894006-74894028 CGGACAGATCTCAGGGACCGAGG - Intergenic
1152241603 17:79164045-79164067 CAGACAGAGGTGTGGGCTCCAGG + Intronic
1152312788 17:79561010-79561032 CAGACAGAGCTGGGGGCGCCTGG + Intergenic
1152441077 17:80310119-80310141 CAGACAGAGCTCAGAGACATGGG - Intronic
1152655302 17:81516658-81516680 GAGACAGAAGTGTGGGACCCTGG - Intronic
1152788244 17:82263452-82263474 CAGACAGTGCTGAAGGCCCCTGG - Intronic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1153747369 18:8193695-8193717 CAGAAAGTGTTGAGGGACCCAGG + Intronic
1155365954 18:25049306-25049328 CACACAGTGCTGAAGAACCCAGG + Intergenic
1156258730 18:35424490-35424512 CAGTCAGAACTGAGAGTCCCAGG - Intergenic
1156269407 18:35517242-35517264 CAGACTGACCTGAGGTAGCCAGG + Intergenic
1157673374 18:49549618-49549640 GAGACTGAGATGAGGGACCAGGG + Intergenic
1158357581 18:56638379-56638401 CAGCCAGAGCTGAGCGGCGCGGG - Exonic
1158405590 18:57156711-57156733 GTGACAGAGGTGAGGGACCCAGG - Intergenic
1160244050 18:77143237-77143259 TGCACAGAGCAGAGGGACCCTGG - Intergenic
1160389455 18:78519020-78519042 GGGACAGAGCCGAGAGACCCTGG + Intergenic
1160726265 19:619102-619124 CAGCCAGTGCTGTGGGACACAGG + Exonic
1160782745 19:885070-885092 GAGCCTGAGCTGCGGGACCCTGG + Intronic
1161013864 19:1973565-1973587 CAGCCAGGGCTGAGGGACCTGGG - Intronic
1161056940 19:2195416-2195438 GAGACAGAGCAGATGGGCCCGGG - Intronic
1161640829 19:5421741-5421763 CACACACAGCTGTGTGACCCTGG - Intergenic
1162698486 19:12495773-12495795 CACACAGGGCTCCGGGACCCGGG - Intronic
1164393395 19:27844449-27844471 CTGACAGAGCCCAGGGCCCCCGG - Intergenic
1165360401 19:35333076-35333098 TAGACAGAGCTGCGGGACCTCGG + Intronic
1165419271 19:35715041-35715063 GAGAGAGAACTGGGGGACCCTGG + Exonic
1165938515 19:39403499-39403521 CCCACAGACCTGGGGGACCCAGG - Intergenic
1166203284 19:41252625-41252647 CAGAAATAGCTGAGGTCCCCAGG + Intronic
1166325245 19:42045963-42045985 CAGAGAGAGACGAGGGACCCAGG + Intronic
1166369428 19:42292883-42292905 CAGAGTGAGTTGGGGGACCCAGG + Intronic
1166406987 19:42528492-42528514 CAGACAAAGCTCTGGGCCCCAGG - Exonic
1166520724 19:43478539-43478561 CAGCCAGAGCTGACAGAGCCAGG + Intronic
1166521101 19:43480792-43480814 CAGCCAGAGCTGACAGAGCCAGG + Intronic
1168084188 19:54033289-54033311 CATACAAAGCAGAGAGACCCCGG - Intergenic
1168103243 19:54152317-54152339 CCGAGCGAGGTGAGGGACCCAGG + Exonic
1168467603 19:56616739-56616761 GAGACAGAGCTGAGAGACCAAGG - Intronic
1202704961 1_KI270713v1_random:15680-15702 CAGGCAGAGCTCAGGGATCTAGG - Intergenic
924981230 2:223376-223398 GAGACAGAGCTGAGGGAAGCTGG - Intronic
925058927 2:876231-876253 TATAGAGAGCTGAGGGATCCTGG - Intergenic
925724424 2:6859469-6859491 TGCACAGAGCAGAGGGACCCTGG - Intronic
925762168 2:7195554-7195576 CAAACAGGGGTGAGGGACCTGGG - Intergenic
927088918 2:19695692-19695714 CACACAGAGCTGAAATACCCAGG + Intergenic
929901869 2:46011747-46011769 AAGAGAGAGATGGGGGACCCTGG - Intronic
930768919 2:55112579-55112601 CAGACACAGCTGAGGCAGCCCGG - Intronic
931276297 2:60746573-60746595 CAGACAGACAGGAGGGAGCCAGG - Intergenic
931653458 2:64489194-64489216 CAGGCAGGTCTGAGGAACCCGGG - Intergenic
932325452 2:70856769-70856791 AAGACAGAGCTGAGAGTCCAGGG + Intergenic
933969466 2:87458508-87458530 CCCACAGGGCAGAGGGACCCGGG - Intergenic
936324320 2:111491986-111492008 CCCACAGGGCAGAGGGACCCGGG + Intergenic
936750526 2:115635546-115635568 CAGACTGAACTGAGGTATCCAGG - Intronic
937228600 2:120383973-120383995 CAGACACAACAGAGGGGCCCAGG + Intergenic
937795335 2:126010882-126010904 CAGACACAGCTGAGAGACTAGGG + Intergenic
938131326 2:128717968-128717990 GAGACAGAGCTGAGGGACAGAGG + Intergenic
938365575 2:130730584-130730606 CAGATAGAGCTCATGGTCCCAGG - Intergenic
939073698 2:137574587-137574609 CAGACAGACCTGAGTGGCCATGG - Intronic
939818355 2:146924027-146924049 GAGACAGAACTGAGAGTCCCAGG + Intergenic
944800137 2:203231042-203231064 TACACACAGCAGAGGGACCCTGG - Intergenic
944909768 2:204298912-204298934 CAGTCAGAGCTGAGTCTCCCTGG + Intergenic
945119724 2:206444333-206444355 CAGAGATCGCTGAGGGACCCAGG - Intronic
946966286 2:225041645-225041667 CAGAAAGGGCTGAGGAACACAGG - Intronic
948407368 2:237732370-237732392 CAGACAGGGGTGTGGGAGCCAGG - Intronic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1170635292 20:18099137-18099159 TAGAGAGAACTGAGGAACCCAGG - Intergenic
1170704061 20:18728776-18728798 CAGACAGACCCAGGGGACCCAGG - Intronic
1170730391 20:18969872-18969894 CAGAGAGAGCTAAGGAACCTAGG + Intergenic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1173326073 20:42034933-42034955 CAGTCAGAGCTCTAGGACCCTGG + Intergenic
1173607731 20:44343518-44343540 CCGTCAGGGCTGAGGGCCCCTGG + Intronic
1173837812 20:46137235-46137257 CAGCCAGAACTGAGGACCCCTGG + Intergenic
1173975152 20:47181247-47181269 CAGACAGAGGTGAGTGATCCAGG + Intronic
1174367569 20:50065664-50065686 CAGGCAGTGCTGGGTGACCCTGG - Intergenic
1174619856 20:51865670-51865692 CTGAAACAGCTGGGGGACCCTGG - Intergenic
1175708237 20:61197278-61197300 GAGAGAGTGCAGAGGGACCCCGG - Intergenic
1175819018 20:61898533-61898555 CAGACAGCACAGAGTGACCCTGG + Intronic
1176026354 20:62987553-62987575 CAGAGACAGCTGGGGGACCCGGG + Intergenic
1176177738 20:63736679-63736701 CAGACAGAGCTGAGGACCCCTGG + Exonic
1178911868 21:36681165-36681187 CTGCCAGAGAAGAGGGACCCTGG + Intergenic
1179180195 21:39038050-39038072 TGGACAGGACTGAGGGACCCAGG - Intergenic
1179510134 21:41867053-41867075 CAGACAGGGCTAAGGGAGCAGGG + Intronic
1179553242 21:42156595-42156617 CAGCCAGAGCTGGGGGTCTCAGG - Intergenic
1179592139 21:42415891-42415913 CAGACTGACCTGAGAGCCCCTGG + Intronic
1179921908 21:44512106-44512128 CACACAGGACTGAGGGAGCCAGG + Intronic
1179985795 21:44919751-44919773 CTGACAGAGGAGAGGGGCCCCGG + Intronic
1180613934 22:17115429-17115451 CAGAGAGAGCTCAGGCTCCCAGG + Exonic
1180820612 22:18824760-18824782 GCCACAGACCTGAGGGACCCCGG - Intergenic
1181206835 22:21259232-21259254 GCCACAGACCTGAGGGACCCCGG - Intergenic
1181522926 22:23459797-23459819 CAGACAGCGCTGCAGGCCCCAGG - Intergenic
1181633043 22:24161452-24161474 CGGCCAGAGCAGCGGGACCCAGG + Intronic
1182132584 22:27867786-27867808 CAGACAGAGTTGAAGGATTCAGG - Intronic
1182182330 22:28363183-28363205 TATACACAGCAGAGGGACCCTGG - Intronic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1183939732 22:41286501-41286523 CCGGAAGAGCTGAGGGACCTGGG - Intergenic
1184455491 22:44607528-44607550 CAGAAAGAGCGGAGGCAGCCGGG + Intergenic
1184457697 22:44620907-44620929 CAGCCACAGATGAGGAACCCAGG + Intergenic
1184473281 22:44707673-44707695 CAGACAGAGGTGAGGGCAACTGG - Intronic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1184670973 22:46012225-46012247 GACCCAGAGCTGAGGGACACTGG + Intergenic
1184849843 22:47113859-47113881 CAGACCTAGCTCAGGTACCCTGG - Intronic
1185040335 22:48500796-48500818 CAGACAGGGCTGGGGGACTCAGG + Intronic
1185047797 22:48537682-48537704 CAGGGAGAGCTGCAGGACCCTGG - Intronic
1185195728 22:49468141-49468163 CAGAGAGAGGAGAGGAACCCTGG + Intronic
1203220088 22_KI270731v1_random:36191-36213 GCCACAGACCTGAGGGACCCCGG + Intergenic
1203270738 22_KI270734v1_random:50635-50657 GCCACAGACCTGAGGGACCCCGG - Intergenic
950160600 3:10757920-10757942 CAGACCCAGCTGTGTGACCCTGG - Intergenic
950180963 3:10912799-10912821 CACACAGAGCTGGGTGACCTTGG - Intronic
950648682 3:14393688-14393710 CATCTAGAGCTGAGGGATCCTGG + Intergenic
950659314 3:14456977-14456999 CAGTCAGAGCTCTGGGACCATGG + Intronic
950767714 3:15285790-15285812 CAAACAGTGCTGAGTGACCCAGG - Intronic
953079171 3:39599315-39599337 AAGACAGAGCTGAGGAAACAAGG + Intergenic
953151203 3:40326738-40326760 CAAGCAGAGCTGTGGAACCCTGG + Intergenic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
954516103 3:51178566-51178588 GAGCCAGAGCTGGGGGACCTTGG + Intronic
954809609 3:53240010-53240032 CAGTCACTGCTGAGGGACCCAGG + Intronic
954861547 3:53694846-53694868 CAGTCACAGGTGAAGGACCCTGG + Intronic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
955021343 3:55124610-55124632 CAGACAACTCTGAGGGACACTGG - Intergenic
958460906 3:94394089-94394111 CAGTCAGAGCTGCTGGACCTGGG - Intergenic
958537248 3:95419011-95419033 CAGAGAGAGGACAGGGACCCTGG - Intergenic
960260483 3:115562665-115562687 AAGACAGAGTTCAGGGATCCAGG + Intergenic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
962030313 3:131592876-131592898 CAGACAGAGCTGAAGACCCCAGG - Intronic
962576891 3:136763236-136763258 TGCACAGAGCAGAGGGACCCTGG - Intergenic
962797497 3:138861866-138861888 CAGAGAGAACTGTGGGAGCCTGG - Intergenic
963251968 3:143111892-143111914 CAGACAGAGGTGAGGGACAGTGG + Intergenic
963543677 3:146627494-146627516 AAGAGAGAGCTGAGGGTCTCTGG - Intergenic
964520717 3:157563635-157563657 CACACACAGCACAGGGACCCTGG + Intronic
964736759 3:159926002-159926024 GAGACAGAGCTGAAGGACCCAGG - Intergenic
965708484 3:171533379-171533401 CAGACATAGCTGGGGTAGCCTGG + Intergenic
966912013 3:184564998-184565020 CAGCCAGGGCTCAGGGACCCTGG - Intronic
969440228 4:7212654-7212676 AAGCCAGAGCTGAGGCCCCCTGG + Intronic
969843502 4:9901130-9901152 CAGACTGAGCTCAGGCCCCCAGG + Intronic
971426812 4:26524192-26524214 TAAACAGAGCTGAGGGAGCTGGG - Intergenic
971875300 4:32300861-32300883 TAGACACAGCAGAGGGACCCTGG - Intergenic
972105908 4:35486965-35486987 TAGACAGAGCTCAAGGAGCCAGG - Intergenic
972337862 4:38123819-38123841 CAGGCAGAGATGACAGACCCAGG - Intronic
972413233 4:38813893-38813915 CAGACAGAGCTGAGGGTGGCTGG - Intronic
975574369 4:75848230-75848252 CACACAGAGCTGAAGGGGCCGGG - Intergenic
978654737 4:111052011-111052033 CACACACAGCACAGGGACCCTGG - Intergenic
979494638 4:121369955-121369977 CAGGCAGGGCTGAGAGATCCTGG - Intronic
979505155 4:121486477-121486499 CAGGGAGAGCTGAGTGACCTAGG - Intergenic
982014998 4:151144797-151144819 CAGACAGAGCTGAGTGGACCAGG - Intronic
982128565 4:152205965-152205987 AAAACAGAGCAGAGGAACCCAGG + Intergenic
985427831 4:189847236-189847258 ATGAAAGAGCTGAGGGACACAGG - Intergenic
986101173 5:4613043-4613065 CAGACAGAGGTGACAGAGCCTGG + Intergenic
986439025 5:7762399-7762421 CAGTCAGAGCTCAGGGGCCCAGG - Intronic
987646470 5:20678891-20678913 CAGACAGAGATGAGGGCACAGGG + Intergenic
988567451 5:32330572-32330594 CAGACAGAGGTGCAGGACTCAGG + Intergenic
988928540 5:36013468-36013490 CAGCCAGAGCTAAGGGTCCAAGG + Intergenic
992788529 5:80192809-80192831 GAGACAGAGCTGAGGTGCCTGGG - Intronic
992844307 5:80729875-80729897 GGGACAGAGCTGATGCACCCTGG - Intronic
993901937 5:93590099-93590121 CTGCCAGAGCTGAGGCAGCCTGG - Intronic
994661261 5:102656954-102656976 GAGACTGAGGTGAGGGAACCTGG + Intergenic
997274653 5:132574415-132574437 CGCACACAGCAGAGGGACCCTGG + Intronic
997302857 5:132819188-132819210 CAGGCACACCTGAGGCACCCCGG - Intergenic
997446346 5:133943117-133943139 TGGACTGTGCTGAGGGACCCAGG + Intergenic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
998439861 5:142149491-142149513 CAAACAGATCTTAGGGACTCTGG - Intronic
1001047009 5:168381631-168381653 CAGATATAGCTGAGAGCCCCTGG - Intronic
1001193916 5:169654547-169654569 GAGACAGCGCTGAGGGGCCTGGG - Intronic
1001282065 5:170393228-170393250 CAGACTGAGCTGAGGGTGTCTGG - Intronic
1001361490 5:171090683-171090705 TGCACAGAGCAGAGGGACCCTGG - Intronic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002590593 5:180289495-180289517 TACTCAGAGCTGAGGGACCCAGG + Intronic
1002764321 6:226256-226278 CAGACAGAGCTGGGGACACCTGG + Intergenic
1002853812 6:1020426-1020448 GAGACACAGCTGAGGGAGGCAGG + Intergenic
1003111276 6:3253737-3253759 CCGGCAGTGCTGGGGGACCCGGG - Intronic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1003230068 6:4243714-4243736 TACACAGAGCTGGGGGGCCCTGG + Intergenic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1005153848 6:22781223-22781245 GTGTCACAGCTGAGGGACCCAGG + Intergenic
1006729101 6:36222281-36222303 CAGGCAGAACTGAGGGGGCCAGG + Intronic
1007706775 6:43795845-43795867 GAGACAGAGATGAGGGGCTCTGG - Intergenic
1007765600 6:44158046-44158068 CAGGCAGGGCTGAGGGGCACTGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1010713857 6:79206349-79206371 TGCACAGAGCAGAGGGACCCTGG - Intronic
1012752278 6:103179059-103179081 CAGACATGGCTGAGGGACTCTGG + Intergenic
1015188108 6:130441625-130441647 CAGTTAGAGTGGAGGGACCCCGG - Exonic
1015366226 6:132401059-132401081 GAGAGAGAGCTGCGGGCCCCGGG + Intronic
1015597100 6:134876052-134876074 AAGACAGAGCTGGGGAACCAAGG + Intergenic
1016897305 6:149066086-149066108 CAGAGAGAGGTGAGGGTGCCAGG + Intronic
1017451156 6:154555607-154555629 CAGGCATAGCTGGGGCACCCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019299508 7:296238-296260 CAGGCAGGGCTGAGGGCACCAGG - Intergenic
1019508303 7:1404665-1404687 CAGGCAGAAATGAGGGACCCTGG + Intergenic
1019588402 7:1816754-1816776 CAGACAGCGCTGCAGGCCCCAGG + Intronic
1020072817 7:5238685-5238707 CAGACAGAGCTGTGCGCGCCAGG - Intergenic
1020142612 7:5620831-5620853 CAGAGGGAGCTGAGGCTCCCAGG + Intronic
1023375933 7:39554981-39555003 CATACAGAGCTGAGTGGGCCGGG - Intergenic
1026463654 7:70635506-70635528 CAGGGAGAGCTTAGGAACCCAGG - Intronic
1026586761 7:71661782-71661804 CAGGGAGAGCTGAGGGACTTTGG + Intronic
1026684335 7:72495286-72495308 CAGTCAGAGCTGGAGGACCTTGG - Intergenic
1026848245 7:73709434-73709456 CAGACAGAGCGGCCGGCCCCAGG - Intronic
1027459721 7:78437048-78437070 CAGACTGAGGTGTGGGAGCCTGG + Intronic
1028838261 7:95397711-95397733 CTCACAGAGCTGAGGGGCCTGGG + Intergenic
1028996581 7:97106980-97107002 CAGGCAGAGCTGTGGGAGCATGG - Intergenic
1030514131 7:110519712-110519734 AAGTCAGAGCTGAGTGAGCCTGG - Intergenic
1033926947 7:146473804-146473826 GAGACAAACCTGTGGGACCCAGG - Intronic
1035475571 7:159141825-159141847 CAGAGAAAGCTGAGGGACAAAGG + Intronic
1036078455 8:5526428-5526450 CAGACAGCACTGAGGGGCCAGGG + Intergenic
1036129807 8:6098563-6098585 CAGAGAGAGCAGAAGCACCCAGG - Intergenic
1036643731 8:10599659-10599681 CAGGCAGAGCTGAGTTCCCCAGG + Intergenic
1036658330 8:10691870-10691892 CGGACTGAGCTGGGGGACCCAGG - Intronic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1039998600 8:42557257-42557279 AGGACAGAGCTCAGGGACTCTGG + Intergenic
1040928949 8:52714331-52714353 CTGTCAGAGCCGAGGGGCCCAGG + Exonic
1047343005 8:124000908-124000930 TAGAGAGGGCAGAGGGACCCAGG + Intronic
1048205981 8:132415544-132415566 GTGACAGTGCTCAGGGACCCAGG + Intronic
1048327643 8:133451522-133451544 GTGACTGAGCTGAGGGCCCCAGG + Intergenic
1048404552 8:134106704-134106726 CACACACAGCATAGGGACCCTGG - Intergenic
1048504969 8:135012993-135013015 TGGACATAGCAGAGGGACCCTGG - Intergenic
1049169590 8:141151170-141151192 CAGATGGAGCTGAGGGACCAGGG + Intronic
1049208929 8:141376440-141376462 CAGGAAGAGGTGAGGGAGCCTGG + Intergenic
1049332700 8:142063645-142063667 CAGACAGGGCTGAGGGCTCCTGG + Intergenic
1049422586 8:142523496-142523518 TAGACATAGCTGAGGGCCCAGGG + Intronic
1050083295 9:1938270-1938292 CACAGAGTGCTGAGGGACACAGG + Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1051572561 9:18576924-18576946 CAGACAGAGCTGGGAGTCTCTGG - Intronic
1052599088 9:30600617-30600639 TGCACAGAGCAGAGGGACCCTGG + Intergenic
1052820873 9:33137192-33137214 CAGACAGAGCTGAGGGTGAAGGG - Intronic
1055730639 9:79276495-79276517 CAGACAGTGCTGAGGGAATCTGG + Intergenic
1056271121 9:84948980-84949002 CAGGAAGAGCTAAGGTACCCAGG + Intronic
1057039867 9:91840179-91840201 GAATCAGAGCGGAGGGACCCGGG + Intronic
1057825401 9:98369129-98369151 CAGCCACAGCTGAGGAACACTGG + Intronic
1057863665 9:98662520-98662542 CAGAAAAAGCTGAGGACCCCAGG + Intronic
1057906098 9:98984613-98984635 CAGACAGAGCTTAGGGAATGTGG + Intronic
1060086048 9:120702816-120702838 CAAACACATCTGAGGAACCCTGG + Intronic
1061373084 9:130208860-130208882 CACACAGAGCTGTGTGACCTGGG - Intronic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1061856234 9:133443344-133443366 GAGACAGAGCGTCGGGACCCTGG - Intronic
1061884897 9:133586477-133586499 CAGAAAGAGCACAGGGACCATGG + Intergenic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1062277703 9:135738574-135738596 CTGAGAGGGCTGAGGGAGCCGGG - Intronic
1062347881 9:136123715-136123737 CCCACAGAGCTGAGCCACCCAGG + Intergenic
1062391304 9:136334999-136335021 CAGCCAGGGCTCTGGGACCCCGG + Intronic
1062438315 9:136556893-136556915 CAGACAGAGGGGAGGAGCCCAGG + Intergenic
1189369048 X:40413368-40413390 CAGACAGGACTGAGTGACCTTGG + Intergenic
1189683507 X:43540655-43540677 CTGACAGAGCCAAGGGGCCCAGG + Intergenic
1192134201 X:68581767-68581789 CAGACAAAGCTGATTGACCAAGG - Intergenic
1192498998 X:71636357-71636379 GAGAGAGAGCTGTGGGTCCCCGG + Intergenic
1193248494 X:79259595-79259617 GAAACAGAGCTGTGGGTCCCTGG + Intergenic
1193888775 X:87017268-87017290 CAGAGGGAGATGAGGAACCCTGG - Intergenic
1195129725 X:101840434-101840456 CAGACACAGCTCAGTCACCCAGG + Intronic
1195176513 X:102319389-102319411 CAGACACAGCTCAGTCACCCAGG - Intronic
1195182351 X:102367704-102367726 CAGACACAGCTCAGTCACCCAGG + Intronic
1195202380 X:102564089-102564111 CAGACACAGCTCAGTCACCCAGG - Intergenic
1196053835 X:111333878-111333900 CACAAAGAGATGAGGGTCCCTGG + Intronic
1197039415 X:121917984-121918006 CAGACAGTGCTAAGTGTCCCAGG + Intergenic
1197550076 X:127881003-127881025 CAGGCAGAGCTTAGGGACATAGG - Intergenic
1197583251 X:128311100-128311122 TGCACAGAGCTGGGGGACCCTGG + Intergenic
1197975638 X:132163267-132163289 CACACACAGCTGAGGGACTCTGG - Intergenic
1199472493 X:148210344-148210366 GGCACAGAGCAGAGGGACCCTGG - Intergenic
1200050993 X:153431652-153431674 CATAAAGAGCTGAGGGCCCTCGG - Intergenic
1200063901 X:153495829-153495851 CAGACAGGGCTGAGCCACCCAGG - Intronic
1200066582 X:153506957-153506979 CACACAGCACTGAGGGACTCTGG - Intronic
1200105778 X:153711251-153711273 GGGACAGAGCTGAGAGGCCCAGG - Intronic
1200106351 X:153715403-153715425 CAGACAGGGCTTTGGGATCCAGG + Intronic