ID: 1003115167

View in Genome Browser
Species Human (GRCh38)
Location 6:3278850-3278872
Sequence CATTTAGTGCCGGGAAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003115167_1003115174 23 Left 1003115167 6:3278850-3278872 CCTGACCTTCCCGGCACTAAATG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data
1003115167_1003115173 4 Left 1003115167 6:3278850-3278872 CCTGACCTTCCCGGCACTAAATG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1003115173 6:3278877-3278899 CGGCACTGACAAGCAGTGAGAGG No data
1003115167_1003115175 24 Left 1003115167 6:3278850-3278872 CCTGACCTTCCCGGCACTAAATG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1003115175 6:3278897-3278919 AGGACTCCCCTTACTCACACGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003115167 Original CRISPR CATTTAGTGCCGGGAAGGTC AGG (reversed) Intronic
900603855 1:3515249-3515271 CATTTGGGGCCAGGAAGCTCAGG - Intronic
901800017 1:11703195-11703217 CATTTTGTGCTGGGACCGTCAGG - Intronic
907390223 1:54153217-54153239 CTTTTAGGGCCGGGTAGATCTGG + Exonic
922749024 1:228062185-228062207 CATTCACTGCCCTGAAGGTCTGG - Intergenic
1068267142 10:54666281-54666303 CATTTTGTGGAGGAAAGGTCAGG + Intronic
1074546537 10:114405326-114405348 CATTAAGGGCCTGGAAGGACCGG - Intergenic
1076794347 10:132791443-132791465 CATCTAGTTCCGGGCAGGGCAGG - Intergenic
1084869825 11:72090929-72090951 CATTTAGCTCCAGGAAGATCTGG - Intronic
1099671255 12:85696041-85696063 CATTTATTGCCTGCAAGGTTTGG - Intergenic
1100735730 12:97527862-97527884 CATTTAATGCAGTGAAGTTCTGG + Intergenic
1109016540 13:57022014-57022036 CATTTCTTGCAGGAAAGGTCTGG - Intergenic
1112609983 13:100946449-100946471 CATTAAGTGCCTGGAAGGTGAGG + Intergenic
1114411551 14:22505299-22505321 CATTTAGAGCCGCAAAGGTAAGG - Intergenic
1119265540 14:73261605-73261627 CAGTTAGTGCCGGGATGGGCAGG + Intronic
1143352784 17:6301028-6301050 CATGTAGTGCTGGCAAGGGCAGG + Intergenic
1144656699 17:17041973-17041995 CAGTTAGCGTCGGGAAGGGCTGG - Intergenic
1153947967 18:10033302-10033324 CATTTAATGTCGGGAAGCCCGGG + Intergenic
1155059633 18:22217321-22217343 CTTTTAGTGCTGGGCAGGGCTGG + Intergenic
1155771634 18:29708388-29708410 TATTTATTGCAGGGATGGTCTGG + Intergenic
1159731151 18:72030547-72030569 CATTTATTGCAGGACAGGTCTGG + Intergenic
932515493 2:72343584-72343606 CATTTATTGCAGGGCAGGTCTGG + Intronic
933458499 2:82548230-82548252 AATGTAGTGCCTTGAAGGTCAGG + Intergenic
940766648 2:157796885-157796907 CAGTTAGTGCCAAGAAGGTATGG - Intronic
1173851216 20:46219534-46219556 CATTTAGTGCCGGGAGGCCAAGG - Intronic
1174831595 20:53818467-53818489 CATTTCTTGTAGGGAAGGTCTGG + Intergenic
1182508373 22:30802020-30802042 TATTTAGTTCCGTGAAGGTAGGG + Intronic
1184087756 22:42275437-42275459 CAGTGAGTGCCGGGCAGGTGGGG - Intronic
1185092646 22:48784741-48784763 CATTTTGTGCTGGGAAGATATGG + Intronic
952321380 3:32280987-32281009 CATTTAGAGTCAGGAAGATCTGG - Intronic
965824772 3:172719426-172719448 CATTGAGTGCCAGGAATGTTGGG - Intergenic
968554210 4:1239106-1239128 CATCTGGTTCTGGGAAGGTCAGG - Intronic
982608647 4:157545797-157545819 CATTTAGTGCTGGGAAGAATGGG + Intergenic
993138496 5:84000122-84000144 CATTTATTGCAGGAGAGGTCTGG - Intronic
1003115167 6:3278850-3278872 CATTTAGTGCCGGGAAGGTCAGG - Intronic
1003244463 6:4372259-4372281 CACTTAGTGCCTGTAAGGACAGG - Intergenic
1003560403 6:7175304-7175326 CATTCAGTACCAGGAGGGTCAGG - Intronic
1006392332 6:33765876-33765898 CATTCAGTGCCTGGAAGGTGGGG - Intergenic
1009893863 6:69722262-69722284 CATTTCTTGCAGGGCAGGTCTGG - Intronic
1012005967 6:93713615-93713637 CATTTTGTGGGGGGAAGGTGGGG + Intergenic
1014767306 6:125421779-125421801 CATTTAGTCCAAGGAGGGTCAGG - Intergenic
1022794593 7:33722153-33722175 CATGTTGTGCTGGGAAGATCGGG + Intergenic
1039906822 8:41792388-41792410 CAATTGATGTCGGGAAGGTCTGG - Intronic
1040414580 8:47184831-47184853 CCTGTAGTGCCATGAAGGTCAGG - Intergenic
1053345255 9:37373316-37373338 CATCTTGAGCCTGGAAGGTCAGG + Intergenic
1056761191 9:89416147-89416169 TAGTTAGTGCTGGGAAGGTGTGG + Intronic
1060745100 9:126126090-126126112 GAATTAGGGCCGGGCAGGTCAGG + Intergenic
1062112782 9:134791135-134791157 CATGTGGTGCCTGGCAGGTCTGG - Intronic
1193846446 X:86478269-86478291 CATTTCGTGCAGGACAGGTCTGG + Intronic
1196494169 X:116305140-116305162 CATTTACTGTAGGGAAAGTCTGG + Intergenic
1196660732 X:118266141-118266163 CATTTCTTGTAGGGAAGGTCTGG - Intergenic