ID: 1003115169

View in Genome Browser
Species Human (GRCh38)
Location 6:3278855-3278877
Sequence GTCCACATTTAGTGCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003115169_1003115174 18 Left 1003115169 6:3278855-3278877 CCTTCCCGGCACTAAATGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data
1003115169_1003115173 -1 Left 1003115169 6:3278855-3278877 CCTTCCCGGCACTAAATGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1003115173 6:3278877-3278899 CGGCACTGACAAGCAGTGAGAGG No data
1003115169_1003115175 19 Left 1003115169 6:3278855-3278877 CCTTCCCGGCACTAAATGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1003115175 6:3278897-3278919 AGGACTCCCCTTACTCACACGGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003115169 Original CRISPR GTCCACATTTAGTGCCGGGA AGG (reversed) Intronic
902926766 1:19700923-19700945 GGCCACATTGGGTGCTGGGAGGG + Intronic
908814917 1:68021886-68021908 ATCCTCATTTAGAGCAGGGATGG + Intergenic
909505696 1:76387243-76387265 GCTTACATTTAGTGCCGAGAGGG - Intronic
915899813 1:159838526-159838548 GTCAACATTATGTGCCAGGAGGG + Intronic
919384168 1:196897838-196897860 GTCCTCATTTAGGGTCGGGGTGG + Intronic
921437521 1:215142973-215142995 GTCCACATTTAGAGCAAGGGTGG + Intronic
923049441 1:230380522-230380544 GTCCACTTGGAGAGCCGGGAGGG - Intronic
1071469756 10:85975433-85975455 ATCCACATTTAGGGCCAAGAGGG + Intronic
1077154550 11:1085546-1085568 TTCCACAGTGTGTGCCGGGATGG + Intergenic
1106216940 13:27710792-27710814 GTCCTCATTCAGGGCTGGGAGGG - Intergenic
1107986275 13:45779090-45779112 CTCCACATTTAGTGACGTCATGG - Exonic
1110541004 13:76707019-76707041 GTGCACATTGAGTGCCATGATGG - Intergenic
1120477013 14:85001397-85001419 GTCAACATCAAGTGCAGGGATGG - Intergenic
1123500528 15:20877660-20877682 GTCCTCTTGTAGTGCAGGGATGG - Intergenic
1123557773 15:21451353-21451375 GTCCTCTTGTAGTGCAGGGATGG - Intergenic
1123594000 15:21888634-21888656 GTCCTCTTGTAGTGCAGGGATGG - Intergenic
1129855636 15:78822796-78822818 GGCCACATTTAATGTAGGGAAGG - Intronic
1202966123 15_KI270727v1_random:178525-178547 GTCCTCTTGTAGTGCAGGGATGG - Intergenic
1138172272 16:54863864-54863886 CTCCAGATTTATTCCCGGGAAGG - Intergenic
1139769294 16:69260293-69260315 GTTCCCATTCAGTGCCAGGATGG + Intronic
1142130075 16:88428297-88428319 GGCCCCATGCAGTGCCGGGAAGG - Exonic
1165181530 19:33975540-33975562 GTCCACATTTCTTGCCTGGATGG + Intergenic
1166094389 19:40530245-40530267 GACCAAATCTAATGCCGGGAGGG - Intronic
939671776 2:145021752-145021774 GCCAACATTTAGTCCCAGGATGG - Intergenic
1169021412 20:2333925-2333947 CTCCACATTTGGGGCAGGGATGG + Intronic
1175687839 20:61044363-61044385 GTCAAAATTTAGTCCCTGGAGGG + Intergenic
978819845 4:112953732-112953754 GTCAAGATTTAGTGCCGACAAGG - Intronic
1003115169 6:3278855-3278877 GTCCACATTTAGTGCCGGGAAGG - Intronic
1012399592 6:98833104-98833126 ATCAACAGTTACTGCCGGGAAGG - Intergenic
1026498438 7:70922837-70922859 GTCCCCATTTGGAGCAGGGACGG + Intergenic
1032756994 7:134900552-134900574 GTACCCATTTAGTGCTGCGAGGG - Intronic
1061178917 9:129012748-129012770 GTCCACCTTCATTGTCGGGAGGG - Intronic
1188089917 X:25952363-25952385 GTCCAGATGTAGTGGTGGGAAGG + Intergenic
1202020509 Y:20459990-20460012 TTCCTCATTTAGTCCTGGGAAGG + Intergenic