ID: 1003115171

View in Genome Browser
Species Human (GRCh38)
Location 6:3278859-3278881
Sequence TGCCGTCCACATTTAGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003115171_1003115173 -5 Left 1003115171 6:3278859-3278881 CCCGGCACTAAATGTGGACGGCA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1003115173 6:3278877-3278899 CGGCACTGACAAGCAGTGAGAGG No data
1003115171_1003115175 15 Left 1003115171 6:3278859-3278881 CCCGGCACTAAATGTGGACGGCA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1003115175 6:3278897-3278919 AGGACTCCCCTTACTCACACGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1003115171_1003115179 28 Left 1003115171 6:3278859-3278881 CCCGGCACTAAATGTGGACGGCA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1003115179 6:3278910-3278932 CTCACACGGGAGTCACATACAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1003115171_1003115174 14 Left 1003115171 6:3278859-3278881 CCCGGCACTAAATGTGGACGGCA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003115171 Original CRISPR TGCCGTCCACATTTAGTGCC GGG (reversed) Intronic
900956827 1:5891478-5891500 TGCCGTCCTGCTTTAGGGCCAGG - Intronic
905144844 1:35880134-35880156 TGCTGTCCTCCTTTAGTGCTTGG - Intronic
908479992 1:64530058-64530080 TGCCTTCCTCTTTTATTGCCAGG - Intronic
918022986 1:180712671-180712693 TGGCGTGCACCTGTAGTGCCAGG + Intronic
923527190 1:234781568-234781590 TGCTCTCTACATTTAGAGCCTGG + Intergenic
1069116763 10:64516738-64516760 TGCCTACCACATTTAGTTTCAGG + Intergenic
1072196851 10:93123499-93123521 TGCCGACCACTTTTAGTGCTAGG + Intergenic
1078931333 11:15914002-15914024 TGCCGCCTACTTCTAGTGCCAGG + Intergenic
1085399249 11:76225703-76225725 TGCCCTCCACCTTCACTGCCAGG + Intergenic
1086407395 11:86510051-86510073 TGACCTCCACATTTCTTGCCAGG + Intronic
1093561782 12:20551643-20551665 GGCCTTCCACATCTACTGCCTGG + Intronic
1094074514 12:26458177-26458199 TGCCATCTTCATTTTGTGCCTGG - Intronic
1104065973 12:125306280-125306302 TGCCGGCCACATTTAGCTCTTGG + Intronic
1107015334 13:35704382-35704404 TTCCTTCCACATTTAGTAGCTGG + Intergenic
1117450748 14:55847177-55847199 TGCAGCTCACATGTAGTGCCAGG + Intergenic
1120180665 14:81339401-81339423 TGCCATCCACCTTGCGTGCCAGG - Intronic
1120942203 14:89959136-89959158 TGCCGTTCTGATTGAGTGCCAGG + Intronic
1122779504 14:104137764-104137786 TGCCGGCGACATTTGGGGCCCGG + Intergenic
1139060457 16:63244612-63244634 TGCAATCCACCTCTAGTGCCAGG + Intergenic
1139698110 16:68689717-68689739 CTCTGTCCCCATTTAGTGCCAGG - Intronic
1142110799 16:88330034-88330056 TGCCATCCACATGAAATGCCAGG + Intergenic
1144777293 17:17791316-17791338 TGCCTTCCTCATTTAGTGTCTGG - Intronic
1148020816 17:44552240-44552262 TGCCGTCACCATTTCTTGCCTGG + Intergenic
1155296320 18:24387739-24387761 TTCAGTCCACATTTAGTGGATGG - Intronic
1159902766 18:74063523-74063545 TGCTTTCCACATTTAGGGCATGG + Intergenic
1161555786 19:4941872-4941894 GGCCTTCCACATCTACTGCCTGG + Exonic
1164995796 19:32719940-32719962 TTCCCTCCACCTTTAGCGCCTGG - Intronic
1167632455 19:50633769-50633791 TGCCAACCTCATGTAGTGCCTGG - Intronic
928072108 2:28227382-28227404 TGCTGTCCACATTGAGAACCTGG + Intronic
942259073 2:174139519-174139541 TGCCTTCTTTATTTAGTGCCTGG + Intronic
945556245 2:211280028-211280050 TGCAGTCCTAATTCAGTGCCTGG - Intergenic
1169933178 20:10855900-10855922 TGCCTTCTACATTTAGTGCTAGG + Intergenic
1173363568 20:42365947-42365969 TCCCTTCCACACTGAGTGCCAGG + Intronic
1176240581 20:64074083-64074105 TGCCTTCCCCACCTAGTGCCTGG + Intronic
1179422854 21:41249943-41249965 TGCCGGCCACCTTTTGTCCCTGG + Intronic
1181017364 22:20079019-20079041 TTCCTTCCACATTTATTGACAGG + Intergenic
1183407887 22:37639467-37639489 GGCCGTCCACAGGTTGTGCCCGG - Exonic
1184512951 22:44943680-44943702 TGGGGTCCACATTCAGTGGCCGG + Intronic
958993486 3:100874329-100874351 TGACCTCCACATTTATTCCCTGG + Intronic
961068545 3:123898463-123898485 TGCAGTCTTCATTCAGTGCCAGG + Intronic
969872646 4:10114518-10114540 TGCAGTCCACATTGACTTCCAGG - Intronic
972263902 4:37440318-37440340 TGCCGTCCACATGTAGCACATGG + Intronic
985602179 5:841125-841147 TCCCTTCCTTATTTAGTGCCAGG + Intronic
985602282 5:841499-841521 TCCCTTCCTTATTTAGTGCCAGG + Intronic
992750625 5:79857457-79857479 TGCAGCCCACATATAGTGACAGG - Intergenic
998674564 5:144392571-144392593 AGCCATCCACATTTCTTGCCTGG - Intronic
999714588 5:154350102-154350124 AGCCGTGAACATTTAGTCCCTGG + Intronic
1000990824 5:167909867-167909889 TGCCTTCCAAAGTTAATGCCTGG + Intronic
1003115171 6:3278859-3278881 TGCCGTCCACATTTAGTGCCGGG - Intronic
1006958808 6:37904811-37904833 TGACATCCACATTATGTGCCAGG - Intronic
1007819246 6:44548583-44548605 TGCTGTCCTCGTTTAGGGCCAGG - Intergenic
1012910965 6:105117606-105117628 TGCCCTCACCATTCAGTGCCAGG + Intronic
1022839497 7:34149595-34149617 TGATGTGAACATTTAGTGCCAGG + Intronic
1031076226 7:117215485-117215507 AGGCATCCACATATAGTGCCTGG - Intronic
1040486450 8:47876786-47876808 TTCCTTCTAAATTTAGTGCCTGG - Intronic
1040639939 8:49321388-49321410 TGCCTTCCACAATTTCTGCCAGG - Intergenic
1043370560 8:79585692-79585714 TGCCCTTCACATTTAAGGCCAGG - Intergenic
1047368905 8:124238686-124238708 TGCTGTGCACATACAGTGCCAGG + Intergenic
1048034040 8:130660017-130660039 TGGTGTCCACATGTAGTGTCTGG + Intergenic
1050577970 9:7018619-7018641 TTCCATCCACAGTTACTGCCTGG + Intronic
1055841578 9:80512033-80512055 TGCCGTCCACGTGGAGTGCTGGG - Intergenic
1058927199 9:109678217-109678239 TGCCGTCCACTTTCAGTGAGGGG - Intronic
1193278694 X:79623045-79623067 TACCCTCCACATTCACTGCCAGG + Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic