ID: 1003115172

View in Genome Browser
Species Human (GRCh38)
Location 6:3278860-3278882
Sequence GTGCCGTCCACATTTAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003115172_1003115180 30 Left 1003115172 6:3278860-3278882 CCGGCACTAAATGTGGACGGCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1003115180 6:3278913-3278935 ACACGGGAGTCACATACAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1003115172_1003115174 13 Left 1003115172 6:3278860-3278882 CCGGCACTAAATGTGGACGGCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data
1003115172_1003115173 -6 Left 1003115172 6:3278860-3278882 CCGGCACTAAATGTGGACGGCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1003115173 6:3278877-3278899 CGGCACTGACAAGCAGTGAGAGG No data
1003115172_1003115175 14 Left 1003115172 6:3278860-3278882 CCGGCACTAAATGTGGACGGCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1003115175 6:3278897-3278919 AGGACTCCCCTTACTCACACGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1003115172_1003115179 27 Left 1003115172 6:3278860-3278882 CCGGCACTAAATGTGGACGGCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1003115179 6:3278910-3278932 CTCACACGGGAGTCACATACAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003115172 Original CRISPR GTGCCGTCCACATTTAGTGC CGG (reversed) Intronic
906663351 1:47598297-47598319 GAGCCTTACACATTTAGTGGTGG - Intergenic
911626198 1:100127716-100127738 GTGCCTCCCACCTGTAGTGCTGG + Intronic
1065687913 10:28303891-28303913 GTGCTGTCCACATTATGTGTTGG - Intronic
1068772662 10:60839272-60839294 GTGCCCTGCACATTTAGGGAAGG - Intergenic
1090971428 11:131646956-131646978 GTTCTGTCCACATTTAATTCTGG - Intronic
1094289095 12:28826009-28826031 GTGCCGCCCACATCGAGGGCGGG + Intergenic
1103844610 12:123892746-123892768 GTGCCGTTGACATTTGGGGCTGG + Intronic
1121243663 14:92447612-92447634 GTGCCGTCCACACTGAGGCCAGG + Intronic
1126790641 15:52218251-52218273 GTGCCGTGCACTGATAGTGCTGG + Intronic
1127812741 15:62578713-62578735 GTAAAGTCCACATTTATTGCAGG + Intronic
1143511075 17:7395225-7395247 GTGCAGTCCACATACAGGGCGGG + Intronic
1147536312 17:41325022-41325044 GTGACCTCCACTTTTAGTGAAGG + Intergenic
1162794763 19:13081169-13081191 GTGGCGTGCACCTGTAGTGCTGG + Intronic
1167324804 19:48817679-48817701 GTGCCAGGCACCTTTAGTGCTGG - Intronic
930845798 2:55902420-55902442 GGGCTGGTCACATTTAGTGCTGG + Intronic
934547298 2:95228695-95228717 ATTCCTCCCACATTTAGTGCAGG + Intronic
935687150 2:105694388-105694410 TTGCCTTCCCCATTGAGTGCAGG + Intergenic
936938892 2:117862774-117862796 GTGCCTTCCAGATTTATTGTGGG + Intergenic
944444583 2:199776493-199776515 GTGCAGGCCACTTTCAGTGCTGG - Intronic
947311296 2:228806446-228806468 GCGCTCTCCACATTCAGTGCTGG - Intergenic
1170797880 20:19565483-19565505 GTGCAATCCACATTCTGTGCAGG + Intronic
1173318754 20:41968716-41968738 GTACCCAGCACATTTAGTGCTGG + Intergenic
1175949029 20:62572657-62572679 ATGCCGTCCACAGTTCCTGCTGG - Intergenic
1176359881 21:5986125-5986147 GTGCCCTCCGCAGTCAGTGCTGG - Intergenic
1177969193 21:27767264-27767286 GTGCTGCCCACATTGAGGGCAGG + Intergenic
1179763637 21:43552425-43552447 GTGCCCTCCGCAGTCAGTGCTGG + Intronic
965483694 3:169251680-169251702 GTGCGGTCCACATTTCATGCTGG - Intronic
1003115172 6:3278860-3278882 GTGCCGTCCACATTTAGTGCCGG - Intronic
1007365878 6:41392347-41392369 GTGACTTCCACATTTGGTGGTGG + Intergenic
1015887421 6:137932163-137932185 GTGGAGTTCACATTTATTGCGGG - Intergenic
1020771009 7:12394541-12394563 CTTCTGTCCACTTTTAGTGCTGG - Intronic
1023626883 7:42124349-42124371 GTGTCGTCCACATTTTCTGCAGG - Intronic
1040586500 8:48748340-48748362 GTGCCTGCCACATTGAGGGCAGG - Intergenic
1050661668 9:7890069-7890091 CTGCCATACACATTTAGTCCAGG + Intergenic
1055841579 9:80512034-80512056 ATGCCGTCCACGTGGAGTGCTGG - Intergenic
1058927200 9:109678218-109678240 TTGCCGTCCACTTTCAGTGAGGG - Intronic
1186648876 X:11537396-11537418 GTGCCGTTGACATTTTGGGCAGG - Intronic
1190729418 X:53215582-53215604 GTGCTGTCAACATGAAGTGCTGG - Intronic
1200282533 X:154789943-154789965 GTGCCACCCACCTGTAGTGCAGG + Exonic