ID: 1003115174

View in Genome Browser
Species Human (GRCh38)
Location 6:3278896-3278918
Sequence GAGGACTCCCCTTACTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003115167_1003115174 23 Left 1003115167 6:3278850-3278872 CCTGACCTTCCCGGCACTAAATG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data
1003115172_1003115174 13 Left 1003115172 6:3278860-3278882 CCGGCACTAAATGTGGACGGCAC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data
1003115169_1003115174 18 Left 1003115169 6:3278855-3278877 CCTTCCCGGCACTAAATGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data
1003115171_1003115174 14 Left 1003115171 6:3278859-3278881 CCCGGCACTAAATGTGGACGGCA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003115174 Original CRISPR GAGGACTCCCCTTACTCACA CGG Intronic
No off target data available for this crispr