ID: 1003115856

View in Genome Browser
Species Human (GRCh38)
Location 6:3283625-3283647
Sequence TCCAGGCAGCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 951
Summary {0: 1, 1: 1, 2: 18, 3: 110, 4: 821}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003115856_1003115863 -5 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115863 6:3283643-3283665 CTGGACAGGACCCCAGGGCCAGG 0: 1
1: 0
2: 7
3: 52
4: 503
1003115856_1003115869 13 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115869 6:3283661-3283683 CCAGGTTCTCACTGCCTCTTGGG 0: 1
1: 0
2: 2
3: 25
4: 275
1003115856_1003115861 -10 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115861 6:3283638-3283660 GCTGCCTGGACAGGACCCCAGGG 0: 1
1: 0
2: 7
3: 26
4: 265
1003115856_1003115874 27 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115874 6:3283675-3283697 CCTCTTGGGCGCCTCGGGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 96
1003115856_1003115875 28 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115875 6:3283676-3283698 CTCTTGGGCGCCTCGGGGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1003115856_1003115867 12 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115867 6:3283660-3283682 GCCAGGTTCTCACTGCCTCTTGG 0: 1
1: 0
2: 2
3: 28
4: 238
1003115856_1003115872 23 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115872 6:3283671-3283693 ACTGCCTCTTGGGCGCCTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1003115856_1003115871 22 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115871 6:3283670-3283692 CACTGCCTCTTGGGCGCCTCGGG 0: 1
1: 0
2: 2
3: 14
4: 142
1003115856_1003115870 21 Left 1003115856 6:3283625-3283647 CCTTCCTCCTGCTGCTGCCTGGA 0: 1
1: 1
2: 18
3: 110
4: 821
Right 1003115870 6:3283669-3283691 TCACTGCCTCTTGGGCGCCTCGG 0: 1
1: 0
2: 1
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003115856 Original CRISPR TCCAGGCAGCAGCAGGAGGA AGG (reversed) Intronic
900165214 1:1241773-1241795 GCCAGGGAGCAGCAGCATGATGG + Intergenic
900383544 1:2398065-2398087 TTCAGGCAGGAGCAGGGGGCGGG + Intronic
900410517 1:2510539-2510561 TGCAGGCAGCAGCACGGGGGAGG - Intronic
900537138 1:3184453-3184475 TCGAGGCAGCCACAGAAGGAGGG + Intronic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900574689 1:3377245-3377267 TCCTGGCAGCAGCAGGAGACGGG + Intronic
900709102 1:4101234-4101256 TCCAGGCAGCAGCAGGGGAGGGG - Intergenic
900971279 1:5993511-5993533 TCCTGGGAGCAGCAGCAGGTAGG - Intronic
900975515 1:6013794-6013816 CCCGGGCAGCAGCAGGGGGTGGG - Intronic
901016843 1:6236650-6236672 TCCAGGGAGCCGCAGAGGGAGGG - Intergenic
901176477 1:7303054-7303076 TCCCAGCAGCACCAAGAGGAAGG - Intronic
901296055 1:8161720-8161742 GCCACGGAGCAGCAGGAGGAAGG - Intergenic
901319521 1:8330869-8330891 TCCCGGACGCAGCCGGAGGAGGG + Exonic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
902200600 1:14830722-14830744 TCAAGACAGCACCAGGGGGATGG + Intronic
902227243 1:15004142-15004164 TCCAGACAGCACCATGAGGTTGG - Intronic
902362044 1:15947191-15947213 TCCACTCAGCAGCAGGACGCAGG + Intronic
902464669 1:16608678-16608700 TCCAGGCACCCTCAGGAGGACGG + Exonic
902482398 1:16718765-16718787 AACAGGCAGCACCCGGAGGAAGG - Intergenic
902527401 1:17068187-17068209 TCAAGGCAGTGGAAGGAGGAAGG + Exonic
902550235 1:17214938-17214960 ACCAGGAAGAGGCAGGAGGAGGG - Intronic
902840367 1:19070395-19070417 TCCCAGCAGCACCAAGAGGATGG - Intergenic
902842306 1:19082725-19082747 TGCAGGCAGCAGAAGCAGGCAGG - Intronic
903489634 1:23718635-23718657 TCCAGGCAGCAGGAACAGCAAGG + Intergenic
904300441 1:29550292-29550314 TTCATGCAGCAACAGGAAGAAGG + Intergenic
904321969 1:29703700-29703722 TCCAGGAAGGAGCAGCAGCAAGG - Intergenic
904393109 1:30198710-30198732 TCTTGGCAGCATCAGGAGGCTGG + Intergenic
904590955 1:31615089-31615111 TCAAGCCAGCAGCAGGAGCCAGG - Intergenic
904607128 1:31704106-31704128 GCCAGGGAGGAGGAGGAGGAGGG + Exonic
904652356 1:32014664-32014686 GCCCGGCAGCCGCAAGAGGAGGG - Intronic
904832089 1:33311865-33311887 TCCAGGGAGGAGGAGAAGGATGG + Intronic
905168345 1:36096652-36096674 CCCAGCCCGCAGCAGGTGGAAGG + Exonic
905174508 1:36127284-36127306 GGCAGGCAGCAGAAGGGGGAAGG - Intergenic
905212188 1:36381980-36382002 TCCTGGGGGCAGGAGGAGGATGG - Intronic
905488741 1:38327189-38327211 GCCAGGCAGCAGGAGGAGGTGGG + Intergenic
905525546 1:38635916-38635938 TCCAGTCAGCAGTAGGAAGATGG + Intergenic
905681163 1:39872006-39872028 TCCTGGCTCAAGCAGGAGGATGG - Intronic
905695760 1:39972483-39972505 CCCAGGCAGCTGAAGCAGGAGGG + Intergenic
905732921 1:40308412-40308434 CCCTGGCACCAGCAGGAGGGAGG + Intronic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906401382 1:45507387-45507409 TCCTGGCAGCGGTAGGTGGAAGG - Exonic
907046983 1:51305445-51305467 TCCAGGCAGAGGGAGCAGGAAGG - Intronic
907368615 1:53982634-53982656 TCCAGGCTGCAGCACAGGGAAGG + Intergenic
907912562 1:58839860-58839882 GCCAGGCAAAGGCAGGAGGAGGG - Intergenic
909236236 1:73155463-73155485 TCCAGGCTGAGGCAGGAGAATGG - Intergenic
909445881 1:75747734-75747756 TACAGACAGCAACAGGAGCATGG - Intronic
910186223 1:84543496-84543518 GCAAGGCTGGAGCAGGAGGAAGG + Intergenic
910262036 1:85302441-85302463 TCCAGCCAGCAGCATGTGCAGGG + Intergenic
910314664 1:85868609-85868631 TACAGGGAGTACCAGGAGGAAGG - Exonic
911830222 1:102541279-102541301 ACAGGGCAGGAGCAGGAGGAAGG + Intergenic
911853185 1:102844001-102844023 TCCAAGAAGCAGCAAGAGAATGG + Intergenic
912501756 1:110127246-110127268 TCCTGGCACCAGCAGGAAGTGGG + Intergenic
912587888 1:110783450-110783472 ACCAAGCAGCAGCAGGAAAAGGG - Intergenic
912705887 1:111911908-111911930 TCCAGGCTGCAGCACAGGGAAGG + Intronic
913022222 1:114799623-114799645 TCATGGCTGGAGCAGGAGGAAGG + Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913346874 1:117818364-117818386 TCCAGGCAGCAGCAGCACCCTGG + Intergenic
913673164 1:121116928-121116950 GCCGGGCAGCAGCAGGCGCACGG + Intergenic
913993427 1:143635679-143635701 TCCAGACACCCTCAGGAGGACGG + Intergenic
914024942 1:143904289-143904311 GCCGGGCAGCAGCAGGCGCACGG + Intergenic
914218520 1:145656209-145656231 TGCAGCCAGCAGCAGCAGGCTGG - Intronic
914409604 1:147413634-147413656 TCCAGGCCACAGCACAAGGAGGG - Intergenic
914471079 1:147978900-147978922 TGCAGCCAGCAGCAGCAGGCTGG - Intronic
914663372 1:149812009-149812031 GCCGGGCAGCAGCAGGCGCACGG + Exonic
914667528 1:149843330-149843352 GCCGGGCAGCAGCAGGCGCACGG - Intronic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914668239 1:149850460-149850482 GCCGGGCAGCAGCAGGCGCACGG + Intronic
914673006 1:149886326-149886348 GCCGGGCAGCAGCAGGCGCACGG + Exonic
915447299 1:155981064-155981086 TCCAGCCAGAAGCTGGAAGAAGG + Intronic
915570608 1:156743399-156743421 CCCAGACAGCAGCAGGAACAGGG + Exonic
916128522 1:161591880-161591902 AGCAGGCAGGAGCAGAAGGAAGG - Intronic
916612832 1:166409930-166409952 TCCAGGCACCAGCGGGGGTATGG + Intergenic
916865182 1:168848819-168848841 TGCAGGAAGCTGCAGGAAGAAGG - Intergenic
916890271 1:169106646-169106668 CCAAGGCAGGAGCAGGAGGAGGG - Exonic
917805901 1:178613575-178613597 TCCAGGCAGGAGAAGGCTGAGGG + Intergenic
917826695 1:178829350-178829372 ACCAGGCCACAGCAGGAGGTGGG + Intronic
918106753 1:181422046-181422068 TCCAGGCAACGGCAGGAGCCAGG - Intronic
918258669 1:182774169-182774191 CCCAGGCAGGTGCAGGAGCAGGG - Intergenic
918414134 1:184289405-184289427 TCCAGGCAGCAGCAGCACCTCGG - Intergenic
918523062 1:185436109-185436131 GCCAGGCTGCAGCAGGTGGATGG - Intergenic
919897074 1:202015629-202015651 TCCAGGTGTCTGCAGGAGGAAGG - Exonic
920077562 1:203348238-203348260 CCCTGCCAGCAGCAGGAGGGAGG + Exonic
920833141 1:209483106-209483128 TCCAGGCTGGAGCTGAAGGAAGG + Intergenic
921003527 1:211069015-211069037 TTCTGGCAGCAGGAGGAGAAAGG + Intronic
921070462 1:211654134-211654156 TCCAGGCAGTGGGAGGAGGGGGG + Intergenic
922732166 1:227954424-227954446 TCTATGCAACAGCAGCAGGAGGG - Intergenic
922742700 1:228023103-228023125 TCCAGGGAGCAGGAGGAGGAGGG - Intronic
922813755 1:228434272-228434294 TCCAGGCTGTGGCAGGAGGCGGG - Intergenic
922817215 1:228458422-228458444 GCCGGGCAGCAGCAGGCGAACGG - Exonic
922817942 1:228464279-228464301 GCCGGGCAGCAGCAGGCGCACGG + Intergenic
922902621 1:229148407-229148429 CCCAGGGAGCAGCTGGAGGTGGG - Intergenic
923103719 1:230838072-230838094 TCCAGGCAGAAGGTGGAGGCAGG + Exonic
923390603 1:233511341-233511363 GCCAGGGGGCAGGAGGAGGAGGG + Intergenic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
923724644 1:236495561-236495583 TCGAGGCAGCAGGTGGAGGAGGG - Intergenic
924617274 1:245622707-245622729 TCCTGGCAGTAACAGGAGGCAGG + Intronic
924934527 1:248756805-248756827 AGCAGGCAGCAGAACGAGGAAGG - Intergenic
1062826848 10:576218-576240 CCCAGGCAGCTGCAGAAGGAAGG + Intronic
1063156041 10:3379942-3379964 TCCAGGTAACAGCAGGAGCAGGG + Intergenic
1063213516 10:3903251-3903273 GCCAGGCAGCAGATGGAGTACGG + Intergenic
1064000628 10:11661200-11661222 TGCAGGCACCAGCAGGAGCAGGG + Intergenic
1064248203 10:13686245-13686267 TACAGGGAGGAGAAGGAGGAAGG + Intronic
1064259741 10:13775703-13775725 TCCAGGCTGGAGCAGGAGGTTGG + Intronic
1064682875 10:17828974-17828996 TGGAGCCAGCATCAGGAGGAGGG - Intronic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1065932447 10:30491650-30491672 GCCAGGCAGGAGAATGAGGATGG + Intergenic
1066206948 10:33198844-33198866 TGCAGGAAGCAGCAGGAAAAGGG + Intronic
1066446928 10:35492023-35492045 TCCAGGCAGGAAGGGGAGGATGG - Intronic
1066687347 10:37993571-37993593 TCCAGGCAGTGGCATGGGGATGG - Intergenic
1067007895 10:42681969-42681991 CCCAGACAGCTTCAGGAGGAGGG + Intergenic
1067200991 10:44171949-44171971 TGCAGGCAGCGCAAGGAGGAGGG + Intergenic
1067355808 10:45525217-45525239 ACCATGCAGCATCAGGATGATGG - Intronic
1067828700 10:49597659-49597681 TCCAGCCAGCAGCAGGTGCTAGG + Intergenic
1068284205 10:54913462-54913484 TCCAGGCAGAAGAATGTGGAAGG + Intronic
1069417550 10:68214340-68214362 TCCAGGCAGAGGCAGAAGAAAGG - Intergenic
1069660712 10:70121587-70121609 TCCTGGCGGAGGCAGGAGGAGGG - Intronic
1069987679 10:72295602-72295624 TCCAGGGAGCAACAGGAGCCAGG + Intergenic
1070281653 10:75053296-75053318 TCCAGGCAGAGGAAGCAGGATGG - Intronic
1070823378 10:79376048-79376070 AGCAGGAAGCAGCAGGAGGCAGG + Intergenic
1070891316 10:79943892-79943914 CCAAGTCAGCAGCAGGAAGATGG + Intronic
1070972852 10:80581833-80581855 TCCAGGCAGGAGCAGGTGTCAGG - Intronic
1071233501 10:83616996-83617018 TCCAGGTAGCAGTAGTAGAAAGG - Intergenic
1071465348 10:85934791-85934813 GCCAGGCAGCTCCAGGAGGGAGG + Intronic
1071522499 10:86339954-86339976 GACAGGCAGCACCAGGAGGACGG + Intronic
1072611103 10:97018255-97018277 ACCTGGCAGGAGCAGGAAGAAGG + Intronic
1072644964 10:97246759-97246781 GGGAGGCAGAAGCAGGAGGATGG + Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1073332289 10:102678225-102678247 ACCTGGCAGCAGCAGGGGGAAGG + Intronic
1073498723 10:103917583-103917605 TCCAGGCTGCATCAAGAGGCAGG + Exonic
1073498960 10:103918628-103918650 TCCCGCCACCAGCAGGAGGAGGG - Intergenic
1073917055 10:108417776-108417798 TCCAGGGAAAAGGAGGAGGAAGG - Intergenic
1075643130 10:124079695-124079717 TGGAGGCAGCACCAGGAGGGAGG + Intronic
1076443001 10:130493065-130493087 CCCAGGCTGCAGCAGGAAGAGGG - Intergenic
1076625941 10:131822126-131822148 TCCAGGCAGCAGAGGGTGCAGGG + Intergenic
1076671662 10:132124201-132124223 GCAAAGCAGCAGCAGAAGGACGG - Intronic
1076695454 10:132245191-132245213 TACAGCCAGGAGCAGGAGGGAGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077229475 11:1452183-1452205 TAAAGCCAGCAGCAGGACGAAGG - Intronic
1077271962 11:1685593-1685615 TCCTGGGAGCAGGAGGAGGGTGG - Intergenic
1077483272 11:2826528-2826550 TCGGGGAAGCAGCAGCAGGAGGG - Intronic
1077503150 11:2918209-2918231 AGCAGGCAGGAGCGGGAGGAAGG + Intronic
1077610142 11:3638967-3638989 TCAAAGCAGCTGAAGGAGGATGG + Intronic
1077722668 11:4643858-4643880 TGCAGGAAGAAGCAGAAGGAGGG + Exonic
1077870453 11:6258325-6258347 GACAGGCAGTACCAGGAGGAAGG + Intergenic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1078085737 11:8232163-8232185 TGCAGGGAGGAGAAGGAGGAGGG - Intronic
1078131621 11:8618714-8618736 GCCAGCCAGCAGCAGGTGGGCGG - Intronic
1078464168 11:11538338-11538360 GGCAGGGAGCAGCTGGAGGAGGG + Intronic
1078464261 11:11538801-11538823 AGGAGGCAGCAGCAGGAGTAAGG - Intronic
1080261295 11:30352428-30352450 GCCCGGCAGCATCAGCAGGAGGG + Intergenic
1081209104 11:40309938-40309960 TCCAGGCAGGGCCAGCAGGAGGG - Intronic
1081540664 11:44032460-44032482 TCCAGGCAGCTGCAGGGTGCGGG + Intergenic
1081557475 11:44178771-44178793 TCTAGGCAGTAGGAGGAAGATGG - Intronic
1081702253 11:45159245-45159267 CCCAGGAGGCAGCAGGCGGAGGG - Intronic
1081722856 11:45302838-45302860 TCCATCCAGCAGCAGGAGACAGG - Intergenic
1082179491 11:49101121-49101143 TCCAGGAAGCAACTGGAAGAAGG - Intergenic
1082768635 11:57188185-57188207 CCCAGGCAGCAGGCTGAGGATGG + Exonic
1083159001 11:60842939-60842961 TCCAGGCTGCAGCAGGGCAAAGG - Intronic
1083291747 11:61694412-61694434 TCCATGCTGTGGCAGGAGGAAGG + Intronic
1083616345 11:64028414-64028436 TCCACGCTGCAGAGGGAGGAGGG + Intronic
1083749196 11:64752138-64752160 TCCAGTCAGCCCCAGGAGGATGG + Intronic
1083975117 11:66112308-66112330 TCCAAGCAGCAGCAGAAGGCAGG - Intronic
1084113830 11:67030449-67030471 CCCAGGGTGCAGCAGGATGAGGG - Intronic
1084181063 11:67446270-67446292 TCCAGACGGCAGCAGGAGACTGG + Intergenic
1084661704 11:70550106-70550128 CCCAGGCAGGAGTAGGAAGAGGG - Intronic
1088313589 11:108485385-108485407 TCAAGGCTGAGGCAGGAGGATGG + Intronic
1088853002 11:113720769-113720791 TCGAGGCAGCACTAGGGGGATGG + Intergenic
1089628224 11:119765171-119765193 ACCAGGCAGGAGAAGGAGGCTGG - Intergenic
1089757246 11:120695929-120695951 TCCATGGACCAGTAGGAGGAGGG + Intronic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1090977245 11:131688521-131688543 GCCTGGGAGCAGCAGGCGGAGGG - Intronic
1091171919 11:133527050-133527072 CCCAGGCAGCTGCAGGCAGATGG + Intronic
1091316697 11:134618892-134618914 TGCAGGAAGCAGCAGGATTAGGG + Intergenic
1091334384 11:134755448-134755470 TCCAGGCAGCAGCGCATGGATGG + Intergenic
1091369676 11:135047630-135047652 TCCAGGCCAAAGCAGGAGGTGGG - Intergenic
1091470114 12:719168-719190 TCACGGCAGGAACAGGAGGAAGG - Intergenic
1091719613 12:2803273-2803295 GGCAGGCAGCCGCAGGAGTAGGG - Exonic
1091805721 12:3354647-3354669 TCCAGCCAGTAGCCGGAGGCTGG + Intergenic
1092004038 12:5054093-5054115 TCCAGGAAGCTGCAGGAGCAGGG + Intergenic
1092957996 12:13567725-13567747 TCCAGGCAGCAGGAATAGTATGG + Intronic
1093122227 12:15284751-15284773 TCCAGGCAGCAACTTAAGGAGGG + Intronic
1093586447 12:20842971-20842993 TCAGGACAGCAGCAGGAAGAGGG - Intronic
1094288085 12:28816799-28816821 TCCAGGCAGCAGCAGTACTCTGG - Intergenic
1094535683 12:31320816-31320838 TTCAAGCAGGAGCAGGGGGAAGG + Intronic
1095313412 12:40728385-40728407 TCCAGGCAGGAACAAGGGGAAGG + Intronic
1095930745 12:47622936-47622958 TGGAGGCTGAAGCAGGAGGATGG + Intergenic
1095952972 12:47791479-47791501 TCCAGGGTGCAGGAGGAGGCTGG + Intronic
1096143231 12:49259854-49259876 TCCTGGGAGCAGGAGGAGGCAGG + Intronic
1096193382 12:49634061-49634083 TTCCTGCAGCAGCTGGAGGAGGG + Exonic
1096279733 12:50242471-50242493 TCCAGGAAACAGGAGGAGGCCGG - Intronic
1096397202 12:51275312-51275334 TCCTGGCAGCAGCACAAGGTGGG - Intergenic
1096492476 12:52020374-52020396 GCCAGGGAGCAGTAGGAGGAGGG + Intergenic
1096597946 12:52709131-52709153 TCCAGACAGCAGCGGGAAGCAGG + Intergenic
1096745183 12:53722185-53722207 TACAGGCAGCAGAAGGAGAAGGG + Intronic
1096865939 12:54562851-54562873 TCCAGACACCAGAAGGAGGCAGG - Intronic
1096866062 12:54564036-54564058 TCCAGACACCAGAAGGAGGTGGG + Intronic
1097130967 12:56810461-56810483 GCCAGTCAGCAGCAGCAGCAGGG + Intergenic
1098065808 12:66614856-66614878 TCCAGGCAGAAGGAGTAGCAAGG - Intronic
1098416733 12:70243341-70243363 TCCAGGCGGCAGCGGAAGGTGGG - Exonic
1098951048 12:76640801-76640823 GCCAGGCTGGAGCAGGAGGCAGG - Intergenic
1100195374 12:92239099-92239121 TCCAGGTAGAAGGAAGAGGAAGG - Intergenic
1100860698 12:98803374-98803396 TCCAGGGAGCGGGAGAAGGAGGG - Intronic
1101446605 12:104741281-104741303 TCCAGGCAGGGGTAGGAGGAGGG + Intronic
1101732777 12:107440359-107440381 TCCAGGCAGAAGCAGAAGCACGG - Intronic
1101737961 12:107477226-107477248 TACAGGCAACAGCAGGAGGGAGG - Intronic
1101816641 12:108150888-108150910 GCCAGGCTGCACCAGGAGGCTGG - Intronic
1101832614 12:108271172-108271194 TCAAGAGACCAGCAGGAGGATGG - Intergenic
1101909231 12:108850031-108850053 TCCAGGAAGGAGCTGGGGGAGGG + Intronic
1102160837 12:110767338-110767360 TCCAGGAAACATCAGGAAGAGGG - Intergenic
1102167208 12:110816110-110816132 TCCAGGCAGCAAGGGAAGGAGGG - Intergenic
1102407059 12:112682657-112682679 TCCAGCCAGCAGCAGAGAGATGG + Intronic
1103097718 12:118145365-118145387 TCCTGGAAGAAGCAGGAGGGAGG + Exonic
1103324654 12:120112334-120112356 CCCAGGCAGGAGCAGGAGGAAGG - Intronic
1103544440 12:121689932-121689954 TCCAGGCATCAGTAAGAGTATGG - Intergenic
1103793823 12:123490043-123490065 TCCAGGCAGGAGAAGGAGAAAGG - Intronic
1103898992 12:124293785-124293807 GCCCTGCAGCAGCAGGAGTAAGG - Intronic
1103953453 12:124564581-124564603 TTCAGACAGCGGCAGGAGGAGGG + Intronic
1103973547 12:124687592-124687614 TGCAGGCAGCTGGAGGAAGAGGG - Intergenic
1104088088 12:125493873-125493895 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088123 12:125493972-125493994 TCCAGGGAGAAGAGGGAGGAGGG - Intronic
1104088141 12:125494040-125494062 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088162 12:125494108-125494130 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088184 12:125494177-125494199 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088219 12:125494280-125494302 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088311 12:125494543-125494565 TCCAGGGAGGAGAGGGAGGAGGG - Intronic
1104088362 12:125494707-125494729 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088406 12:125494828-125494850 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088420 12:125494862-125494884 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088454 12:125494964-125494986 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088466 12:125494998-125495020 TCCAGGGAGGAGAGGGAGGAGGG - Intronic
1104088565 12:125495307-125495329 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104205930 12:126638416-126638438 TCAAGGCCAGAGCAGGAGGAAGG + Intergenic
1104273211 12:127301248-127301270 TCCAGACAGAAGCAGGAGAGGGG - Intergenic
1104480431 12:129103172-129103194 TCCAGGCTGGAGGAAGAGGAGGG + Intronic
1104574822 12:129957459-129957481 CCCGGGAAGCAGCAGGCGGAAGG + Intergenic
1104726385 12:131078079-131078101 GCCCTGAAGCAGCAGGAGGAGGG - Intronic
1104736638 12:131139347-131139369 TCCAGACAGCAGCAAGGAGAGGG - Exonic
1105038573 12:132944157-132944179 TCCGGAAAGCAGGAGGAGGAAGG - Intronic
1105274553 13:18906954-18906976 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1105283187 13:18981777-18981799 GCCAGGGAGCAGAAGGAGGATGG + Intergenic
1105496918 13:20938528-20938550 TCCAGGCATTAGCACGAAGATGG + Intergenic
1105592976 13:21811541-21811563 TCAGGGCAGGAGGAGGAGGAGGG + Intergenic
1106099109 13:26679254-26679276 AGCAGGCAGGAGGAGGAGGAGGG - Intronic
1106234933 13:27853561-27853583 TCCAGCCAGCGGGAGGAGAAGGG + Intergenic
1107260607 13:38486010-38486032 TCCAGGTAGCTGCATGGGGATGG + Intergenic
1107605943 13:42056870-42056892 TAAAGGCAGGAGCAGGAAGAAGG - Intronic
1107826440 13:44332730-44332752 TGGAGGCAGCAGCAGCAGCAGGG - Intergenic
1108956660 13:56166767-56166789 TCCAGGCAGAAGCCGGCTGAAGG - Intergenic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1110391664 13:74981606-74981628 TCCAAGCAGAGGCAGGAAGAAGG - Intergenic
1111051316 13:82885642-82885664 GCATGACAGCAGCAGGAGGAAGG + Intergenic
1112391279 13:98986636-98986658 TCTAGGCAGCAGGATGAGAAAGG - Intronic
1113254746 13:108495313-108495335 TCCTGGGAGCAGGAGGAGAAGGG - Intergenic
1113260655 13:108558688-108558710 TACAGGAGGCAGCAGGAGCAAGG - Intergenic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114139574 14:19894881-19894903 TCCAGGGAGCAGCAGAGGCAGGG + Intergenic
1114223588 14:20718467-20718489 TCCAGACAGCAGAAAAAGGATGG - Intergenic
1114562947 14:23606552-23606574 CCAAGGCAGAAGCAGGAGGTAGG - Intergenic
1114645805 14:24255477-24255499 TACTGGCAGCGGCAGGATGATGG - Exonic
1114730937 14:24991956-24991978 CCCAGGGAGAAGCAGCAGGAAGG - Intronic
1116080126 14:40161567-40161589 ACCTGGCAGCAGCAAGAAGAAGG - Intergenic
1116751562 14:48892333-48892355 TCCAGGAAGCATCAGGAACATGG + Intergenic
1117081290 14:52154797-52154819 AAAAGGCAGCAGCTGGAGGAGGG + Intergenic
1117189428 14:53275969-53275991 CCCAGGCAGCAGCAGTACTATGG + Intergenic
1118101788 14:62614082-62614104 TCCAGGAACCAGCAGGAGGAAGG + Intergenic
1118807424 14:69250336-69250358 TCTAGGGAGCAGCAGGAGGATGG - Intergenic
1119408036 14:74410948-74410970 TCAAAGCAGCTGAAGGAGGAAGG - Intronic
1119472362 14:74908023-74908045 TCCAGGAACCCCCAGGAGGAAGG + Intronic
1119601328 14:75979151-75979173 TCCAGGCAGCCACAGGAAGCTGG + Intronic
1119616574 14:76102651-76102673 TCCATGCTGGGGCAGGAGGAAGG + Intergenic
1119768158 14:77203807-77203829 CCCTGGCAGCAGCAGGAGGTGGG + Intronic
1119821062 14:77616582-77616604 TCCTGGCAGCACCAGGCGCAAGG + Exonic
1121109805 14:91304338-91304360 TTCAGGAAGCAGAAGCAGGAGGG + Intronic
1121322178 14:92998370-92998392 CCCAGGCATCAGCAGGAGGGTGG - Intronic
1121668849 14:95692766-95692788 TCCATTCAGCAGCAGGACGTCGG + Intergenic
1122208978 14:100162736-100162758 GCCAGGCAGCAGCAGGGGTGGGG + Intergenic
1122348825 14:101076332-101076354 TCCTGGCAGGTCCAGGAGGAAGG + Intergenic
1122391088 14:101385122-101385144 TCCAGGCTGCAGCACAAGGAAGG - Intergenic
1122579832 14:102764599-102764621 CCCAGGAAGCTGCTGGAGGAGGG - Intergenic
1122738638 14:103858119-103858141 TCAGGGCAGCAGCAGGTGCAGGG - Intergenic
1122771701 14:104100598-104100620 TCCAGGGAGCAGCAGGAAGAAGG - Intronic
1122967467 14:105138047-105138069 GCCAGGCAGCAGCAGCTGGGTGG - Intergenic
1123003842 14:105311984-105312006 TCCTGGCAGGAGAAGGAGTAGGG + Exonic
1123125688 14:105944396-105944418 TCAAGGCAGCAGCAGCCCGAGGG - Intergenic
1123214061 14:106790542-106790564 TCCTGTCAGCTGCAGGAGGCGGG - Intergenic
1123687141 15:22806788-22806810 TCCTGGCAAAAGAAGGAGGAGGG + Intronic
1123759762 15:23423149-23423171 TCCAGGCTGCAGCAGGAACCTGG + Intergenic
1124258389 15:28164382-28164404 TCCATGCAGAGGCAGGAGCAAGG - Intronic
1124630138 15:31331511-31331533 CCCAGGCAGCAGCATCAGGGAGG - Intronic
1125605912 15:40939824-40939846 ACCCTGCAACAGCAGGAGGAAGG - Intergenic
1126142574 15:45450166-45450188 TCCAGGCAGGGACAGGAGAAGGG - Intergenic
1127119597 15:55759562-55759584 CCCAGGCTGCAGCAGGGAGATGG - Intergenic
1127262720 15:57337762-57337784 TCCAGGCTGGGGCAGGAGGAGGG + Intergenic
1127280912 15:57491856-57491878 TGCAGGAAGGAGGAGGAGGAGGG - Intronic
1127730967 15:61801660-61801682 TCCTGGAAGCATGAGGAGGAGGG - Intergenic
1128145529 15:65330581-65330603 TCCAGGCAGCAGGATGGGGCCGG + Exonic
1128304874 15:66591809-66591831 GCCAGGCAGCAGCAGGAAGAGGG - Intronic
1128697553 15:69779960-69779982 TCCATGTACCAGCAGGGGGAAGG - Intergenic
1128726384 15:69991460-69991482 CCCAGGCAGCAGCGGGTGGGGGG + Intergenic
1128836703 15:70814669-70814691 TGCAGGAAGCAGCAGGATGCTGG + Intergenic
1129261093 15:74367721-74367743 TTGAGCCTGCAGCAGGAGGAAGG - Exonic
1129322445 15:74782542-74782564 GCCAGGCAGAGGCAGGGGGACGG - Exonic
1129672635 15:77615811-77615833 GCCCAGCACCAGCAGGAGGATGG + Exonic
1130063310 15:80584831-80584853 GCCAGCCAGAAGCAGGAGGCTGG - Intronic
1130174164 15:81550224-81550246 TGATGGCAGCAGCAGCAGGAGGG + Intergenic
1130303620 15:82698836-82698858 TCCAGGCCCCTGCAGGAGAAGGG + Intronic
1130305335 15:82709444-82709466 TCCAGGCCGCAGGAGGGGGCCGG + Intronic
1130839436 15:87683995-87684017 TCCTGGCAGCAGAATGAGAATGG + Intergenic
1130848222 15:87767430-87767452 TTCAGGCAGCAGCAAGACCATGG + Intergenic
1131390452 15:92043884-92043906 ACCAGGGAGAAACAGGAGGAGGG - Intronic
1131612096 15:93976047-93976069 TGAAGGCAGCACCAAGAGGATGG - Intergenic
1131829536 15:96345220-96345242 TCTAGGGAGCCCCAGGAGGATGG - Intergenic
1132240267 15:100252483-100252505 GCCAGGAAGCAGGAGGAGCACGG + Intronic
1132352131 15:101146438-101146460 TCCAGGCAGGAAGAAGAGGAAGG - Intergenic
1132353157 15:101153106-101153128 CCCAGACAGCTGGAGGAGGAAGG - Intergenic
1132387545 15:101411148-101411170 ATCAGGTAGCAGCAGGAGGCGGG + Intronic
1132498726 16:275615-275637 TCCAGGCCGCAGCTGGCGGCGGG + Intronic
1132570535 16:642122-642144 CCCACGCAGCAGCAGGTGGAGGG + Exonic
1132748363 16:1446241-1446263 TCGGGGCAGCAGCAGGGGCAAGG + Exonic
1132941652 16:2511519-2511541 GCCAGGCAGCGGCAGGGGCAGGG + Intronic
1133129114 16:3665267-3665289 TCTCCCCAGCAGCAGGAGGAGGG - Exonic
1133191924 16:4140130-4140152 TCCAGGCAGAAAGAAGAGGAAGG - Intergenic
1133749660 16:8714656-8714678 GCCAGGCCGCTGCCGGAGGAAGG + Intronic
1134067766 16:11240228-11240250 CCCAGGCCTCAGCAGGAGCATGG - Intergenic
1134212467 16:12289245-12289267 CCCATGCAGCAGGAGGAGAAGGG + Intronic
1134344756 16:13379459-13379481 GGCAGGCTGGAGCAGGAGGAGGG - Intergenic
1135113742 16:19709436-19709458 TGCAGGCCGCAGCCTGAGGATGG - Intronic
1135196583 16:20399732-20399754 TTCAAGCAGGAGCTGGAGGAGGG - Intronic
1135290539 16:21233953-21233975 TGCAGACAGCAGCAAGAGGCAGG + Intronic
1135326752 16:21530969-21530991 TCCAGGCAGAGGCTGGAGGCAGG - Intergenic
1135920628 16:26645909-26645931 TCCAGGCAGCAGCGGGAGAAGGG + Intergenic
1135991274 16:27220295-27220317 CCCAGGGAGCAGCATGTGGAAGG + Intronic
1136337007 16:29616383-29616405 TCCAGGCAGAGGCTGGAGGCAGG - Intergenic
1136791062 16:32968488-32968510 TCCACGAAGGAGCAGAAGGAGGG - Intergenic
1136878751 16:33885444-33885466 TCCACGAAGGAGCAGAAGGAGGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1139318953 16:66097470-66097492 TCTGGGCAGCAGCTGGAAGATGG + Intergenic
1139679903 16:68553417-68553439 TCCAGGAATCAGAAGGAGGGTGG + Intronic
1139909795 16:70390659-70390681 TCCAGACAGCAGCAGGAGAGAGG - Intronic
1139939085 16:70591830-70591852 TCAGGGCAACAGCAGGGGGAAGG - Intronic
1140035620 16:71369238-71369260 TCATGGCAGCTGCATGAGGAGGG + Intronic
1140219392 16:73032974-73032996 GCCAGGCAGCAGGAGCAGGATGG + Intronic
1140334742 16:74094771-74094793 TCCAGGCAGAAGGAGCAGCAAGG - Intergenic
1141268427 16:82517853-82517875 TCCAGACAGGAGCAAGGGGAAGG + Intergenic
1141609622 16:85174049-85174071 TCCAGGCAGCTGGTGGAAGAGGG - Intronic
1141622436 16:85243584-85243606 TCTATGCAGCAGCAGGAGCTGGG + Intergenic
1141665897 16:85464929-85464951 TCATGGCAGCATCAGGGGGAGGG + Intergenic
1141980582 16:87547638-87547660 ACAAGGCAGCAGCAGGAGGCTGG - Intergenic
1141996567 16:87639816-87639838 TCCAGGAAGCAGCAGGTGCCCGG + Intronic
1142039803 16:87885719-87885741 TCCAGGCAGAGGCTGGAGGCAGG - Exonic
1142427993 16:90010981-90011003 TCCAGGAAGCAGCTGAGGGAAGG - Intronic
1142967529 17:3590703-3590725 TCCAGTCAGCAGGGGGAGGCAGG + Intronic
1143149957 17:4801581-4801603 TGGTGGCAGCAGCAGGGGGAGGG + Intergenic
1143413540 17:6728043-6728065 TCCAGAAGGCAGCAGGAGGGAGG - Intergenic
1143491751 17:7289270-7289292 TCCAGGCAGCAAGTGGGGGATGG + Intronic
1143631913 17:8144553-8144575 TCCGGGCTGCAGCCAGAGGAGGG - Intronic
1143651096 17:8264703-8264725 TGCAGGAAGCAGCAGGGGCAGGG + Intronic
1143942456 17:10556778-10556800 TACAGGCATCAGCAGGAGGAAGG - Intergenic
1144106226 17:11988339-11988361 TCCAGGCAGCAGCACAGGAAGGG + Intronic
1144504838 17:15821242-15821264 TCCGGGAAGCAGCTGGAGCAGGG - Intergenic
1144636139 17:16910469-16910491 TCCAGGAAGCAGCTGGAGCAGGG - Intergenic
1144645932 17:16973358-16973380 TGCAGGAAGCAGCTGGAGCAGGG + Intergenic
1144707810 17:17380947-17380969 TCCTGGCAGCCTCAGGAGGCCGG - Intergenic
1144728686 17:17514595-17514617 CCCGGGCAGCAGCAGGATCAGGG - Intronic
1144827830 17:18116263-18116285 TCCAGGCAGGAGCAGGTTGTGGG + Intronic
1144951175 17:18994315-18994337 TCCAGGCTGCAGCACAGGGAGGG + Intronic
1145169011 17:20639125-20639147 TCCGGGAAGCAGCTGGAGCAGGG - Intergenic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145203575 17:20968564-20968586 TCCAGGAAGCAGCTGGAGCAGGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145902902 17:28499507-28499529 TCCAGGCTGCGGCAGGTAGATGG + Intronic
1145916428 17:28576715-28576737 CCCAGGTAGCAGGACGAGGATGG + Intronic
1145917150 17:28581401-28581423 CCCAGGTAGCAGGACGAGGATGG - Intronic
1145937296 17:28722142-28722164 CCCAGGCTGAAGCAGGAGAATGG + Intronic
1146013512 17:29214507-29214529 GCCATGCAGAAGCAGGAAGATGG + Intergenic
1146260371 17:31416668-31416690 CCCCTGCAGCAGCAGGAGAAGGG + Intronic
1146460479 17:33042247-33042269 GCCAGGCAGAGGCAGGAGGAGGG - Intronic
1146635487 17:34501310-34501332 CCCCTGCAGCAGCAGGAGGAAGG + Intergenic
1146956539 17:36939369-36939391 ACCAGGGAGCAGGAGGAAGAGGG + Intronic
1147034552 17:37670576-37670598 TCTCGGGAGAAGCAGGAGGAGGG + Intergenic
1147420727 17:40321056-40321078 TCCAGACAGCAGCCAGAGGGTGG - Intronic
1147657034 17:42096897-42096919 TCCAGGAACCAGCAGGGGGCAGG + Intergenic
1147663272 17:42129020-42129042 CCCAGGCAACGGCAGGAGAAGGG + Intronic
1147917981 17:43900115-43900137 GGCAGGGAGCAGGAGGAGGAAGG - Intronic
1148716157 17:49717628-49717650 GCCAGGCTCCAGGAGGAGGAGGG + Exonic
1148852060 17:50560304-50560326 TTTGGGCAGCAGCCGGAGGACGG - Intergenic
1149012015 17:51866575-51866597 TCCAGGGTGCAGAAGGAGCAAGG - Intronic
1149365669 17:55941079-55941101 ACCAGCCAGCATCAGGATGATGG + Intergenic
1149524326 17:57342265-57342287 TCCCTCCATCAGCAGGAGGATGG + Intronic
1149653292 17:58292491-58292513 TAGTGGCAGCAGCAGGAGAAGGG + Intergenic
1150558439 17:66274721-66274743 TCCAGGCTGCAGCCGGATGATGG - Intergenic
1150712876 17:67546647-67546669 TCCAGGAACCTGCAGGAGGCAGG + Intronic
1151084147 17:71361812-71361834 GACAGGCAGCAGCAGCAGCAGGG - Intergenic
1151384631 17:73747605-73747627 GCCAGGCAGAAAAAGGAGGAAGG - Intergenic
1151456087 17:74226573-74226595 TCGGGACAGCAGCAGGAGAAGGG + Intronic
1151874804 17:76861554-76861576 TCGTGGCAGGAGCAGGAGGAAGG + Intergenic
1152008683 17:77697612-77697634 CCCAGGCAGCTGGGGGAGGAGGG + Intergenic
1152010421 17:77709816-77709838 TCCAAGGAGCAGCAGGAGAGAGG + Intergenic
1152024912 17:77802720-77802742 TCTAGGTAGCAGAAGGGGGAGGG - Intergenic
1152373078 17:79902541-79902563 TCCAGGAAGCAGGGGGTGGAAGG - Intergenic
1152418082 17:80175874-80175896 GCCAGGAAGCAGGAGGAGGGTGG - Intronic
1152518000 17:80837336-80837358 ACCAGGGAGCAGCAGGGGGGAGG + Intronic
1152606947 17:81296119-81296141 TCCAGGCTGCTGGGGGAGGACGG + Intergenic
1152742889 17:82026093-82026115 GCCAGGCAGAACCAGCAGGAGGG - Intronic
1152860155 17:82691829-82691851 TCCAGGCAGGGGTAGAAGGAAGG - Intronic
1152879646 17:82807855-82807877 GCCAGCCAGAGGCAGGAGGACGG - Intronic
1152920300 17:83063219-83063241 CCCAAGCAGCAGCTTGAGGAGGG + Intergenic
1153449074 18:5206381-5206403 TCCAGGCAGGAGGAAGAGCATGG - Intergenic
1153575875 18:6521152-6521174 TCCTGAAAGCAGCAAGAGGAAGG - Intronic
1153601813 18:6788245-6788267 ACCTGGCCGGAGCAGGAGGAAGG - Intronic
1153940656 18:9973790-9973812 TCCAGGCAGCAGACCCAGGAGGG - Intergenic
1153983676 18:10334161-10334183 GCAAGGCAGCAGTAGGGGGAAGG - Intergenic
1154366694 18:13716743-13716765 ACAAGGCAGCAACAGGAGGCAGG - Intronic
1154466238 18:14644203-14644225 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1155185569 18:23383874-23383896 TCCAAGGAGCGGCAGGATGATGG + Intronic
1155206197 18:23560331-23560353 TCCAGGGAGCAGGAGGAGGTGGG + Exonic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155928709 18:31684751-31684773 GCCAAGCAGCGGCGGGAGGAGGG + Intronic
1155958643 18:31975259-31975281 TCCAAACAGCAGAAAGAGGATGG - Intergenic
1156298087 18:35810642-35810664 TCCAGGCATCAGCAGGGGGAGGG + Intergenic
1156820885 18:41371571-41371593 AACAGGCAGCAGCAGGATTATGG - Intergenic
1157224483 18:45850078-45850100 TCCTGGGAGCAGGAGGAGGCAGG - Exonic
1157304478 18:46507231-46507253 GCCAGGCAGCAGAAGGAAGATGG + Intronic
1157383831 18:47246713-47246735 TCCAGGCTGCTGCAGGAAGACGG - Intronic
1157506229 18:48228574-48228596 TGGAGGCTGCAGCAGGAAGAAGG + Intronic
1157513610 18:48295813-48295835 GCCCAGCAGCAGCAGGAGGGGGG + Intronic
1157692337 18:49693686-49693708 TCCAGGCAGCAGGGAGAGGCAGG + Intergenic
1157974399 18:52310443-52310465 TGCAGGGGGAAGCAGGAGGAGGG + Intergenic
1158001848 18:52628708-52628730 TGCAGGTAGCAGCATGAGTAGGG + Intronic
1159209040 18:65292077-65292099 TTCAGGCAGCAGCAGAAGCAAGG - Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1159914716 18:74178382-74178404 ACCAGGAAGCAGAGGGAGGAAGG + Intergenic
1159971974 18:74666277-74666299 TACAGGCAGCAGCCAGTGGAGGG + Intronic
1160280330 18:77484346-77484368 TTCTGGTAGCAGCAGGAGAAAGG + Intergenic
1160412332 18:78683481-78683503 GCCAGGCAGCAGCAGGAGTGAGG + Intergenic
1160444117 18:78914052-78914074 TCCAGGGACCAGCAGGAGGGGGG - Intergenic
1160445369 18:78923164-78923186 TTCAGGAAGCAGCGGGAGAATGG + Intergenic
1160476141 18:79190036-79190058 TCCCCGCAGCAGCAGCAGGAGGG + Intronic
1160477871 18:79208986-79209008 CCAAGGCAGCAGCATGAAGAAGG - Intronic
1160511518 18:79455902-79455924 TCCACACAGCAGCAGGCGGAGGG + Intronic
1161133262 19:2604365-2604387 TGGAGGCTGAAGCAGGAGGATGG + Intronic
1161220106 19:3114464-3114486 TACAGGGAGCAGCAGGGAGACGG + Intronic
1161297468 19:3527104-3527126 TCCCGTCAGCAGCAAGAGGTGGG + Intronic
1161715493 19:5873951-5873973 ACCAGGTAGCAGCAGGAAGGAGG + Intronic
1162028694 19:7908303-7908325 ACCAGGCAGGAGCAGGGGAAGGG - Intronic
1162306320 19:9876379-9876401 CCCAGGCAGCGGCTGGAGGGAGG + Intronic
1163104764 19:15116795-15116817 CCCAGGCAGAAGGAGGTGGAGGG - Intronic
1163229974 19:15994869-15994891 ACATGGCAGCAGCAAGAGGAAGG - Intergenic
1164039854 19:21484549-21484571 TGGAGGCAGAAACAGGAGGATGG - Intronic
1164557289 19:29263417-29263439 TCCAGGCAGTGTCAGGGGGAGGG - Intergenic
1164669375 19:30063979-30064001 TGCTGGGAGCAGCAGGAGCAGGG + Intergenic
1164754987 19:30682625-30682647 TCCAGGAAGCAGCGTCAGGAGGG - Intronic
1164758037 19:30704839-30704861 TGAAGGCAGCAGCAGCAAGAGGG - Intronic
1164840271 19:31387901-31387923 TCCAGGCGACAGGAGGAGGTGGG - Intergenic
1164984031 19:32635120-32635142 TACAGGGAGCAGCAAGGGGATGG + Intronic
1165093874 19:33400266-33400288 TCCAGGCTGCAGAAGGTGGCTGG + Intronic
1165169054 19:33878234-33878256 GCCAGGCAGCAGCAGACGGGAGG - Intergenic
1165761563 19:38324537-38324559 TCCAGCCAGCAAGAGGAGGGAGG + Intronic
1165771390 19:38382428-38382450 ACCTGGCAGCAGCTGGAGGTGGG + Intronic
1165920591 19:39295495-39295517 GCGAGGCTGAAGCAGGAGGATGG + Intergenic
1166011809 19:39948298-39948320 TCCAGACAGCTGCATGAGTATGG + Intergenic
1166396158 19:42442791-42442813 TAGTGGCAGCAACAGGAGGAGGG + Exonic
1166875766 19:45896358-45896380 GCCAGCCACCAGCAGGAGGTAGG + Intronic
1166944687 19:46389814-46389836 TGCAGGAAGCAGGAGCAGGAAGG - Intronic
1167286675 19:48602309-48602331 GGAAGGCAGCAGCAGGAGGAGGG + Intronic
1167410775 19:49342426-49342448 CCCAGGCATCACCTGGAGGATGG + Exonic
1168116668 19:54224699-54224721 TCCAGGCATCAGCCTGATGAAGG - Intronic
1168119653 19:54244482-54244504 TCCAGGCATCAGCCTGATGAAGG - Intronic
1168168568 19:54571939-54571961 TCCAGGCATCAGCCTGATGAAGG + Intergenic
1168250592 19:55139472-55139494 TGCAGGCAGCAGCTGGAAAAGGG - Intronic
925141713 2:1555075-1555097 TCCAGGCAGAAGCAGGAGGTCGG + Intergenic
925314314 2:2909506-2909528 TCAAGACAGGGGCAGGAGGAGGG + Intergenic
925530173 2:4850541-4850563 TCAAGGCAGCCGGAGGAGGCAGG + Intergenic
925787581 2:7448069-7448091 TGGAGGCAGAAGCAGGAGAATGG - Intergenic
925930930 2:8707276-8707298 TCCAGGCTGAAGCAGGAGGATGG - Intergenic
925965019 2:9056678-9056700 AACAGGCAGAAGTAGGAGGATGG + Intergenic
926216620 2:10909530-10909552 GCCAGGCAGAAGCAGGAGCGAGG - Intergenic
926383555 2:12314585-12314607 GAGATGCAGCAGCAGGAGGAGGG - Intergenic
927721945 2:25388760-25388782 TGCCGGCAGCAGCGGGGGGAGGG - Intronic
927743898 2:25598200-25598222 TCCAGGTAGAAGAAGGAGGAAGG - Intronic
927744408 2:25603751-25603773 TCCAGTCAGTAGAAGGAGGTTGG + Intronic
927860750 2:26558595-26558617 GCCAGGCAGGAGCAGCGGGAAGG + Exonic
928415963 2:31091952-31091974 ACCAGGCAGAAGAAGGTGGAAGG + Intronic
928706607 2:33956291-33956313 TCCAGACAACAGCAAGAGGTTGG - Intergenic
929445610 2:41998506-41998528 TCTAGGCAGCTGCAGGGGAATGG + Intergenic
929926666 2:46217920-46217942 CCCTGGCAGCAGCAGCAGCATGG - Intergenic
930161000 2:48156040-48156062 TGCAGGCACCAGCAGCAGGCAGG - Intergenic
930691922 2:54373301-54373323 CCCAGGCGGCAGCATGAGGAAGG - Intronic
930753013 2:54950191-54950213 ACCAGGCAGCAGAACGAGCATGG + Intronic
930949855 2:57127217-57127239 TCCAGGCAAGAGCAGGGGGACGG - Intergenic
931116798 2:59174188-59174210 TCCTTGCAGCCACAGGAGGAGGG + Intergenic
931224881 2:60321015-60321037 TCCAGGCAGCAGCAGCACACAGG + Intergenic
931321954 2:61180539-61180561 GCCAGGCAGCAGCCAGAGGACGG + Intronic
931707887 2:64962593-64962615 AGCAGGCAGCAGAAGGTGGAAGG - Intergenic
932083914 2:68740437-68740459 TCCAGTGTGCAGCAGGAGAAGGG - Intronic
932169734 2:69543059-69543081 TCCAGGGAGCAGGAAGAAGATGG + Intronic
932702870 2:74002937-74002959 TCCAGGCGGCAGCTGGAGGCAGG + Intronic
934917759 2:98314118-98314140 TCCAGGCTGCAGCATAGGGAGGG + Intergenic
935853055 2:107243899-107243921 TCCAGGTAGAAGCAGGAGTCAGG + Intergenic
935881582 2:107571004-107571026 TCCAGGAAGGAGCAGAAGGCTGG - Intergenic
935948321 2:108305941-108305963 TCCAGGACTCAGCAGCAGGAGGG + Intronic
936092864 2:109512195-109512217 GCCAGGGCCCAGCAGGAGGAGGG - Intergenic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
936165618 2:110116836-110116858 ACCAGGGAGCAGCAGGGGGCAGG - Intergenic
937231794 2:120402199-120402221 TGCAGGCAGCAGCGTCAGGAGGG - Intergenic
937346341 2:121128117-121128139 CCTAGGCAGCAGCATGTGGAAGG - Intergenic
937815974 2:126251248-126251270 CCCAGGCAGCAGCAGGAGCTGGG + Intergenic
938139916 2:128787062-128787084 CCCAGCCAACAGCAGGAGGCAGG - Intergenic
938146010 2:128835443-128835465 GCCAAGCAGCAGCAGGAGAGGGG - Intergenic
938312657 2:130302944-130302966 CTCAGGCACTAGCAGGAGGAGGG - Intergenic
938799010 2:134742960-134742982 GCCAGGCACTAGCAGGAGAAAGG + Intergenic
939052128 2:137319914-137319936 GCCAGGCAAGAGCAAGAGGAGGG - Intronic
939057590 2:137382891-137382913 TCCAGGCAGCAGCAGCATCCTGG - Intronic
939095319 2:137827352-137827374 TCCAGGTACCAAGAGGAGGATGG + Intergenic
939817589 2:146915421-146915443 GCAAGGCATCAGAAGGAGGAAGG + Intergenic
940640529 2:156341590-156341612 TCCGGGCAGCAGAAAGGGGATGG + Intronic
940848013 2:158661902-158661924 CACAGGCAGCAGCAGCAGGAGGG - Intronic
941806236 2:169714157-169714179 TCCAGGCAGCAGCAGTACTCTGG + Intronic
941865655 2:170331791-170331813 TGCAGGCAGCATCTGGAAGATGG - Intronic
942157733 2:173148665-173148687 TCCAGGCATCGTCAGGAGGTTGG - Intronic
943458252 2:188135559-188135581 TTAATGCAGCAGCAAGAGGAGGG - Intergenic
944215263 2:197248105-197248127 TCCCTGCAGCAGCAGTAGGCAGG - Intronic
944491665 2:200263775-200263797 GCATGGCAGGAGCAGGAGGAAGG - Intergenic
945779945 2:214156697-214156719 CCCAGGTTGCAGCAAGAGGATGG + Intronic
946250370 2:218407729-218407751 TACAGGCTGAAGCGGGAGGATGG - Intergenic
946414176 2:219531259-219531281 GTCAGGCTGAAGCAGGAGGATGG + Intronic
946627405 2:221628587-221628609 GCCAGGCAGTAGCTGGAGGTGGG - Intergenic
947399052 2:229714349-229714371 TCCGAGCAGCAGCAGCAGCAGGG + Exonic
947546094 2:231011477-231011499 GACAGGCAGCTGCAGGAGGATGG - Intronic
947871360 2:233440657-233440679 GCCAGGCAGCAGCAGAAAGGTGG + Intronic
947910965 2:233800436-233800458 TCCAGGCAACTGGAAGAGGAAGG - Intronic
947955725 2:234189185-234189207 AAGAGGCAGCAGCAAGAGGATGG + Intergenic
948329392 2:237153137-237153159 TCCTGAAAGCAACAGGAGGAAGG - Intergenic
948742479 2:240056904-240056926 AGCAGGCTGCAGCAGGAGGGAGG + Intergenic
948778184 2:240300781-240300803 CCCAGGCCACAGCAGGAGAACGG + Intergenic
948901426 2:240958585-240958607 TCCAGGCAGCAGCAGGCGGCTGG - Intronic
948992892 2:241563728-241563750 TCCTGACAGCAGCAGGAGCCAGG + Intronic
1168865816 20:1085618-1085640 TCCAGGCAGGAGGAGGAGGTAGG + Intergenic
1168876878 20:1177912-1177934 TCCACTCAGCAGCCAGAGGAAGG - Intronic
1170982305 20:21226255-21226277 GCCAGGCAGGAGCAGCAGGAAGG - Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171392718 20:24811757-24811779 CACAGGCAGCATCAGGAGGGTGG - Intergenic
1171392854 20:24812238-24812260 GGCAGGCAGCATCAGGAGGGTGG - Intergenic
1171460503 20:25295490-25295512 TCCAGACAGGACCAGGTGGATGG + Intronic
1171481807 20:25460288-25460310 TCCAGTCAGCATCAGGAAGCTGG - Intronic
1171847020 20:30283517-30283539 TCCAGGCATGTGCAGGTGGAAGG - Intergenic
1172304695 20:33872458-33872480 TCCAGGCTGGAGAAGGAGCAAGG + Intergenic
1172449287 20:35010432-35010454 TCCAGCCAGCACCTGCAGGAGGG + Intronic
1172604256 20:36204000-36204022 TCCTGGCAGCAGGAGGGGGAAGG - Intronic
1172779138 20:37425352-37425374 TCCTGGGAGCAGCTGGAAGAAGG + Intergenic
1172841991 20:37907565-37907587 TCCAGACAGGGGCAGGTGGATGG + Intronic
1173024895 20:39298757-39298779 GCTGGGCAGCTGCAGGAGGATGG - Intergenic
1173314031 20:41927562-41927584 TTCAGGAAGCAGCAGGCTGATGG - Intergenic
1173381999 20:42553833-42553855 ACCAAGCAGCAGTAGCAGGATGG + Intronic
1174514616 20:51082442-51082464 TCCAGGCATCAGAAGGAAAAAGG + Intergenic
1174540937 20:51288672-51288694 TCCAGAAAGCAGCAGAAGGCAGG - Intergenic
1174703837 20:52635967-52635989 TCCAGGCAGCAGAAAGAGAAAGG - Intergenic
1174761481 20:53210868-53210890 TCCAGGCAGCAGGATGACAAAGG + Intronic
1175264216 20:57692730-57692752 TCCAGGCAAGAGGAGGTGGACGG - Intronic
1175380145 20:58557283-58557305 TCCACTCAGCAGCCGGAGCAAGG - Intergenic
1175644421 20:60658825-60658847 TCGGGGGAGCAGCAGGGGGAGGG + Intergenic
1175656425 20:60775064-60775086 GCCAGGCAGGAGTTGGAGGAAGG - Intergenic
1175695352 20:61099286-61099308 TCCAGCCAGGGGCTGGAGGAAGG + Intergenic
1175853162 20:62104529-62104551 GCCCGGCAGCAGTAGGAGGGGGG + Intergenic
1175867083 20:62184625-62184647 TGGAGGCAGGAGCAGGAGGCCGG - Intronic
1175944907 20:62554135-62554157 ACCAGGCAGCAGTGGCAGGAAGG + Intronic
1175995966 20:62812534-62812556 TCCAGGAAGGTGGAGGAGGAAGG + Exonic
1176070543 20:63224054-63224076 TCCACGCAGCAGAGGGAGCAGGG - Intergenic
1176131926 20:63499828-63499850 TCCCAGCAGCAGCCGGAGGTCGG - Intergenic
1176297329 21:5081080-5081102 ACCAGGCAGCTGCAGGACCAGGG - Intergenic
1176358498 21:5973019-5973041 CCCGGGCAGCAGCAGGCGCACGG + Exonic
1176385576 21:6137346-6137368 TCCGGGCAGCCTGAGGAGGAGGG - Intergenic
1176519137 21:7811985-7812007 ACAAGGCAGCAGGAGCAGGAGGG - Intergenic
1176808350 21:13514393-13514415 CCCAGGCACCAGCAGGAGGAGGG + Intergenic
1177768551 21:25488278-25488300 TACAGGCAGCAGCAAGTGCAGGG - Intergenic
1178398134 21:32260583-32260605 GCCCGGGAGAAGCAGGAGGAAGG + Intergenic
1178535071 21:33403896-33403918 GCTGGGCAGCAGCAGGAAGACGG + Intronic
1178653165 21:34441998-34442020 ACAAGGCAGCAGGAGCAGGAGGG - Intergenic
1178758319 21:35375276-35375298 TCCAGGCAGCTGTAACAGGAAGG - Intronic
1179466648 21:41580272-41580294 CACAGCCAGCAGCTGGAGGAGGG + Intergenic
1179737897 21:43400906-43400928 TCCGGGCAGCCTGAGGAGGAGGG + Intergenic
1179765020 21:43565531-43565553 CCCGGGCAGCAGCAGGCGCACGG - Intronic
1179781188 21:43702137-43702159 ACCAGGCAGCAGGGGAAGGAAGG + Intergenic
1179859700 21:44180868-44180890 ACCAGGCAGCTGCAGGACCAGGG + Intergenic
1180141554 21:45896337-45896359 TCCATGCATCAGCAGGCGGATGG - Exonic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1181181484 22:21071489-21071511 GCCAAGCAGCAGCAGCAGCAGGG + Intergenic
1181910324 22:26233484-26233506 TCCTGGCACCATCATGAGGAAGG + Intronic
1181985734 22:26798928-26798950 TCCAGGCTGCCACAGGAGGTCGG - Intergenic
1182442406 22:30372083-30372105 GCCCAGCAGCTGCAGGAGGAAGG + Exonic
1182485390 22:30635895-30635917 GCCAGGCACCGGCCGGAGGACGG + Exonic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1183386952 22:37520068-37520090 CCCAGGCAGGAGCGGGAGTATGG - Intergenic
1183695151 22:39417514-39417536 TCGAGGCTGAAGCAGGAGAATGG + Intronic
1183850768 22:40585395-40585417 TCCAGGGGGAAGGAGGAGGAGGG + Intronic
1183957134 22:41387546-41387568 TACAGGCAGCAGCAGGTTGTGGG - Exonic
1184040586 22:41940845-41940867 TCGAGGCTGCTGCAGGAGGCAGG - Intronic
1184227305 22:43136469-43136491 AGGAGGCAGCAGCTGGAGGACGG - Intronic
1184272909 22:43395046-43395068 TCCAGGCAGCAGCAAGCAGGTGG - Intergenic
1184446060 22:44547594-44547616 GGCAGGCAGCAGCAGGAGCTTGG - Intergenic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
1184694688 22:46132877-46132899 GCCAGGGAGCAGCAGGGGGCTGG + Intergenic
1184712762 22:46262876-46262898 TCCGAGCAGCCGCAGGCGGAAGG + Exonic
1184719171 22:46299608-46299630 CCCAGACAGCAGCATGTGGATGG - Intronic
1184782802 22:46657551-46657573 TCCAGGCAGAGGGAGGAGGCAGG - Intronic
1184821287 22:46910802-46910824 TCCAGGCAGAGGTAGGAGTACGG + Intronic
1184821305 22:46910874-46910896 TCCAGGCAGCGGTAGGAGTACGG + Intronic
1184886919 22:47352128-47352150 TCCAGCCTGCAGCCTGAGGAAGG - Intergenic
1184981215 22:48097150-48097172 TCCAGGCAGCAGGAGTGGCAGGG - Intergenic
1185142994 22:49113616-49113638 TACACACAGCAGCAGGAGGGTGG - Intergenic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
1185181383 22:49365462-49365484 TCCCTGGAGGAGCAGGAGGATGG - Intergenic
1185226467 22:49656511-49656533 GCCAGGCAGCAGATGGCGGAGGG - Intronic
1185373200 22:50470229-50470251 ACGAGGCAGCAGGTGGAGGAAGG + Intronic
949518350 3:4827176-4827198 TCGGGGCAGGAGCAGGAGGGTGG - Intronic
949535225 3:4989916-4989938 TCCAAGCAGGAGAAGAAGGAGGG + Intergenic
950096979 3:10336129-10336151 GCCCGGCTGCAGCAGGAGGAAGG + Intronic
950458495 3:13106697-13106719 CCCATGGAGCCGCAGGAGGAGGG - Intergenic
950660103 3:14461879-14461901 TCTGGGCAGCAGCAGCAGCAGGG - Intronic
950880195 3:16317057-16317079 TCAGGACAGCAGCAGGAGGGTGG - Exonic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
950951679 3:17006601-17006623 TCTAGGCAACAGCAGATGGAGGG + Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952286421 3:31973683-31973705 TCCAGGTAGCAACATGAAGATGG + Intronic
953136100 3:40183065-40183087 TTCAGACAGCAGATGGAGGAAGG + Intronic
953457128 3:43052337-43052359 AGCAGGGAGCAGCAGGAGGCTGG - Intronic
953468557 3:43146818-43146840 CCCAGTCACCAGGAGGAGGAGGG - Intergenic
953538428 3:43793525-43793547 CCCATGCAGGAGCAGGAGGCTGG + Intergenic
953847744 3:46441825-46441847 TCCAAACTGCAGCAGGAAGATGG + Intronic
954288512 3:49636535-49636557 TCCAGGGATCAGCAAGGGGACGG + Intronic
955146200 3:56322683-56322705 TCCAGGCTGCAGCACAAGGAGGG + Intronic
955154017 3:56397906-56397928 TCCAGGCAGCAGAAGAAGGGGGG + Intronic
955352052 3:58200900-58200922 TCCAGGGAGGGGGAGGAGGAAGG - Intronic
955915133 3:63899977-63899999 AGGAGGCTGCAGCAGGAGGATGG + Intronic
955992435 3:64642580-64642602 TCCAGCCTGGAGCAGGAAGAAGG + Intronic
956179253 3:66501647-66501669 TCCAGGCTGCTCGAGGAGGAAGG - Intergenic
957720790 3:83995712-83995734 ACATGGCAGTAGCAGGAGGAAGG + Intergenic
958765082 3:98358163-98358185 TCCAGACTGGAGCAGGAGGGTGG - Intergenic
961098730 3:124180290-124180312 TCAAGGTAGGAGCTGGAGGATGG - Intronic
961368128 3:126414219-126414241 TCCAGGAAGCAGTGGGAGCAGGG - Intronic
961988055 3:131158376-131158398 TCCTGTCAGCAGCAGTAGCAGGG - Intronic
962270482 3:133974619-133974641 TCCAGGGAGCACCAGGAGCATGG - Intronic
962273837 3:133997528-133997550 TCGAGGCAGAAGCTGGAGTAGGG + Intronic
962945701 3:140167302-140167324 TCCAGGCAGAAGAACGTGGATGG - Intronic
963504799 3:146170734-146170756 TCCAGGTAGGAGAAGGATGAAGG - Intergenic
963844808 3:150144395-150144417 TCCAGGCATCAGGAAGAAGAAGG + Intergenic
964416359 3:156452299-156452321 TGGAGACAGCAGCAGGAGTAAGG - Intronic
966971531 3:185049559-185049581 GCCAGGCAGCAGCATGGAGAGGG - Intronic
967170577 3:186820200-186820222 ACGAGGCAGCAGCAGTAGCATGG + Intergenic
967828953 3:193902471-193902493 TCCCAGCAGGAGCAGGAGGGAGG - Intergenic
968471287 4:783516-783538 CCCAGCCAGCAGCATCAGGAAGG + Intergenic
968623351 4:1614580-1614602 TCACCGCAGCAGCAAGAGGACGG + Intergenic
968650318 4:1757782-1757804 TCAAGGCAGGAGAAGGGGGAGGG - Intergenic
968654966 4:1774509-1774531 CCCAGGCCCCAGAAGGAGGATGG + Intergenic
968852061 4:3088289-3088311 GCCAGGCTGAAGCAGGAGAATGG - Intronic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969377176 4:6770652-6770674 TCCAGGTGGCTCCAGGAGGAAGG + Intergenic
969506462 4:7591232-7591254 AGGAGGCAGCAGCAGGTGGAGGG - Intronic
969518282 4:7660864-7660886 TGGAGGCAGCACCAGGGGGAGGG + Intronic
969566081 4:7979042-7979064 TCCAGACAGCACCAGGTGGGTGG - Intronic
969590875 4:8121338-8121360 TCCTGGAAGCAGCAGGAGCTGGG - Intronic
969860534 4:10032308-10032330 TCCAGGCAGAAGGAGCAGCAAGG + Intronic
970447911 4:16139616-16139638 TCCAGGATGCATGAGGAGGATGG + Intergenic
971216163 4:24664045-24664067 TTCAGGCAGGAAAAGGAGGAGGG - Intergenic
971244693 4:24917301-24917323 GCCAGGCAGCAGGGGGTGGAAGG + Intronic
972344033 4:38177710-38177732 ACCAGGGAGCAGCAAAAGGAGGG + Intergenic
972427072 4:38943487-38943509 AACAGGCAGCAGCAGCTGGAAGG - Exonic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975762567 4:77633532-77633554 TCCAGGCAGCAGCAGCACCTTGG + Intergenic
976386889 4:84470399-84470421 TCCAGCCAGCAGATGGAGCAAGG + Intergenic
976390689 4:84501179-84501201 GCCAGGAAGCTGCGGGAGGATGG + Intergenic
976462473 4:85328317-85328339 TCAAGGCAGTAGCAGCAGAATGG - Intergenic
976590607 4:86845826-86845848 CCCAGGCAACTGCAAGAGGATGG + Intronic
978785756 4:112607834-112607856 TGGAGGCTGAAGCAGGAGGATGG + Intronic
981608205 4:146563096-146563118 GCCAGGTAGCAGCAGGCTGATGG - Intergenic
983106467 4:163692438-163692460 TCTGGGCAGCAGCAGCATGAAGG + Intronic
984557564 4:181233685-181233707 ACCAGGCAACATCAGGAGGTGGG + Intergenic
984598918 4:181704290-181704312 GCAAGGCAGAATCAGGAGGAAGG - Intergenic
985084163 4:186296012-186296034 AACAGGCTGAAGCAGGAGGATGG + Intergenic
985657010 5:1137532-1137554 TCCAGGCAGGTTGAGGAGGAGGG - Intergenic
985843485 5:2327154-2327176 TTCAGTCAGCAGCAGGAGGGTGG + Intergenic
985938903 5:3118486-3118508 TCCGGGCAACTGCAGAAGGAGGG - Intergenic
986032141 5:3904812-3904834 CCCAGGGGGAAGCAGGAGGAAGG + Intergenic
986299999 5:6470921-6470943 TCCCATCAGCAGCAGGAGGCTGG + Intronic
986361251 5:6980426-6980448 TGCAGTCAGCAGTGGGAGGAAGG - Intergenic
987034567 5:14006889-14006911 TGGAGGCAGCAGCAGGAGGCAGG - Intergenic
988862891 5:35303320-35303342 TCCAGTCAGAAGAAGCAGGAGGG + Intergenic
990490430 5:56297985-56298007 TCAAGGAAGCAGTGGGAGGAAGG - Intergenic
991058062 5:62341539-62341561 GGGAGGCAGAAGCAGGAGGATGG - Intronic
992260296 5:74963455-74963477 TCCAGGCAGAAAGAGGAAGAAGG - Intergenic
993228704 5:85204261-85204283 GCAAGGCACCAGCAGGAGTAGGG + Intergenic
993552511 5:89291305-89291327 TACAATCATCAGCAGGAGGAAGG + Intergenic
993828795 5:92727468-92727490 TCCAGGCAGCAGGAGGAGGAGGG - Intergenic
994060501 5:95471641-95471663 TACAGGCAGTAGCAGGTGGCTGG + Intronic
994953488 5:106497221-106497243 TCCAGGCTGGAGAAGGGGGATGG - Intergenic
995082513 5:108069802-108069824 TTCAGGCATCTGCATGAGGAAGG - Intronic
995837326 5:116411531-116411553 ACAAGCCAGCAGGAGGAGGAAGG - Intronic
995842061 5:116452033-116452055 TCCAGGCAGCATCTGAAGCAAGG - Intronic
995973098 5:117997117-117997139 TTCAGGCAGCACCACAAGGAAGG - Intergenic
996621684 5:125512520-125512542 TCCAGTCAGCAGGAAGAAGATGG - Intergenic
996770465 5:127080331-127080353 TCCAGGCAGCAGGAGTAGCAGGG + Intergenic
997868328 5:137484319-137484341 GCCAGGCACTAGCATGAGGAAGG + Intronic
998179378 5:139925827-139925849 GCCAGGCAGGTGAAGGAGGATGG - Intronic
998202857 5:140138972-140138994 TCAGGGTAGGAGCAGGAGGAAGG - Intergenic
998509239 5:142697707-142697729 GGCAGGCTGCTGCAGGAGGAAGG + Exonic
998794317 5:145801894-145801916 CCCAGGCAGTAGCAGTAGCAAGG - Intronic
999388078 5:151169557-151169579 TCCCTGCAGGAGCAGAAGGAAGG + Intergenic
999787256 5:154902576-154902598 TCCAGACTGCAGCAGAAAGAGGG - Exonic
1001006370 5:168054273-168054295 GCCAGCCAGCAGCAGGGTGAAGG + Intronic
1001033037 5:168276612-168276634 TCCAGGCTACAGCAAGGGGAGGG + Intergenic
1001645437 5:173278314-173278336 TCTACGCAGCAGCCAGAGGAGGG - Intergenic
1001673590 5:173494086-173494108 CCCAGCCGGCAGAAGGAGGAAGG + Intergenic
1001776359 5:174331916-174331938 GCCAGGCAGCTGGAGGAGGCAGG + Intergenic
1001942858 5:175753085-175753107 TCCAGGGAGGAGGAGGAGGCAGG + Intergenic
1001993135 5:176133785-176133807 ACCGGGCAGAGGCAGGAGGACGG + Intergenic
1002167625 5:177358195-177358217 TACAGACAGCAGCAGGTGGTAGG + Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002400162 5:178987049-178987071 CCCAGGGACCAGCAGGAGAAAGG + Intronic
1002631973 5:180588299-180588321 TCCAGGAATCTACAGGAGGAAGG + Intergenic
1002684367 5:180996378-180996400 TCCAGGCAGCAGCATGGAGGAGG - Intronic
1002775564 6:325043-325065 TCCAGGCACCAGCAGGGAGAGGG - Intronic
1002850886 6:995512-995534 GCCAGGGAGGAGGAGGAGGACGG + Intergenic
1002904700 6:1438871-1438893 CCCAGGGAGGAGCAGGAGAAGGG - Intergenic
1003115856 6:3283625-3283647 TCCAGGCAGCAGCAGGAGGAAGG - Intronic
1003169020 6:3705883-3705905 TTCAGGCAGCAGAAGGCAGATGG + Intergenic
1003666411 6:8115754-8115776 TCCAGTCAGCAAAAGGAAGAAGG - Intergenic
1003957309 6:11175609-11175631 TCCAAGCAGAAGTAGGAGTAAGG - Intergenic
1004515353 6:16317744-16317766 TGCTGGCAGCAGTGGGAGGAGGG - Intronic
1004702085 6:18088766-18088788 TGCTGACAGAAGCAGGAGGAGGG - Intergenic
1004736450 6:18410786-18410808 GCAAGGCTGGAGCAGGAGGAGGG + Intronic
1005050363 6:21678486-21678508 TCCAGGAAGCTGCAGTGGGAGGG + Intergenic
1005367128 6:25089777-25089799 TCCAGGTCGGAGCAGGAGGATGG + Intergenic
1005428772 6:25731849-25731871 CCCAGGCAGCAGCAGGCGCACGG + Intergenic
1005466788 6:26123590-26123612 TCCGGGAAGCAGCAGGCGCACGG + Exonic
1005475085 6:26199851-26199873 CCCGGGCAGCAGCAGGCGTACGG - Exonic
1005480636 6:26251943-26251965 CCCAGGCAGCAGCAGGCGCACGG - Exonic
1005569631 6:27132436-27132458 CCCAGGCAGCAGCAGGCGCACGG + Exonic
1005571095 6:27146484-27146506 CCCGGGCAGCAGCAGGCGCACGG + Exonic
1005646005 6:27838954-27838976 CCCTGGCAGCAGCAGGCGCACGG - Exonic
1005652061 6:27893755-27893777 CCCGGGCAGCAGCAGGCGCACGG - Exonic
1005664254 6:28034599-28034621 TCAAGTCAGCCGCAGGAAGAAGG + Intergenic
1005859069 6:29887774-29887796 CCCTGAGAGCAGCAGGAGGAGGG - Intergenic
1005875294 6:30006619-30006641 CCCCGAGAGCAGCAGGAGGAGGG - Intergenic
1006043311 6:31272027-31272049 TCCCGAGAGCAGCAGGAGGAGGG + Exonic
1006066028 6:31463229-31463251 TCCCGAGAACAGCAGGAGGAGGG - Intergenic
1006081844 6:31572396-31572418 TCCAGGCAGCAGGTGCAGGAGGG - Intronic
1006292878 6:33153691-33153713 TCCAGTCAGCTGAAGGAGAAAGG - Intergenic
1006407629 6:33854527-33854549 TCCGGGCATCTGCAGGAGGCAGG - Intergenic
1006423661 6:33950671-33950693 TCCTGGCAGGGCCAGGAGGAGGG + Intergenic
1006449149 6:34096020-34096042 TCCCAACAGCAGCAGCAGGAGGG + Intronic
1006452024 6:34110839-34110861 TCCAGGCCTGAGCTGGAGGAAGG - Intronic
1006748642 6:36362920-36362942 TCCAAGATGAAGCAGGAGGATGG - Intronic
1006790377 6:36697502-36697524 CCCAGACAGCAGCAGGTTGATGG - Intergenic
1006981957 6:38154277-38154299 TCCACGCAGCAGGCAGAGGAGGG - Exonic
1007089946 6:39177567-39177589 TCCAGCCAGGAGCAGAAAGATGG + Intergenic
1007254719 6:40520702-40520724 TGCAGGCTGCAGTAGGGGGAGGG + Intronic
1007593153 6:43035634-43035656 GACAGGCAGCAGCAGCAGGCTGG - Intergenic
1010495213 6:76526198-76526220 GGCAGGCAGAGGCAGGAGGATGG + Intergenic
1011042948 6:83051272-83051294 TGGAGGCAGGAGCAGGAGAATGG - Intronic
1012231764 6:96768481-96768503 TGCAGCCAGCAGCAGCAGGCTGG + Intergenic
1013043999 6:106465458-106465480 TCAGGGCTGCAACAGGAGGAAGG + Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1013671868 6:112412451-112412473 TCTAGGCAGGAACAAGAGGAAGG - Intergenic
1014054642 6:116999676-116999698 TTAAGGCTGCAGCAGGAGAATGG - Intergenic
1014215997 6:118753378-118753400 TCCAGGAAGCAGTGGGAGGCTGG - Intergenic
1014308133 6:119767346-119767368 TCCAGACAGCTGAAAGAGGACGG - Intergenic
1015200526 6:130574901-130574923 TCCAGGCAGAAGAAGGAGAAGGG - Intergenic
1015718475 6:136216088-136216110 GATAGGCAGCAGGAGGAGGAAGG + Intergenic
1015723282 6:136269175-136269197 TCCAGGCTACATCAGGAGGTTGG - Intronic
1016692238 6:146951117-146951139 AGCAGGCAGCTGCAGGAGAAGGG - Intergenic
1017127050 6:151076129-151076151 GACAGGCAGAGGCAGGAGGATGG + Intronic
1017223781 6:151996395-151996417 TCCAGGCAGAAGAAGGATCATGG - Intronic
1017569177 6:155724875-155724897 TCCAGGCAGCAGCATAAGAAAGG + Intergenic
1017607289 6:156147798-156147820 TCCAGGGGGCAGCACGAGGATGG - Intergenic
1017884671 6:158588877-158588899 TCTGGGCAGCAGCAGGATGGTGG + Intronic
1018602577 6:165560870-165560892 ACGAGACAGCACCAGGAGGATGG - Intronic
1018668921 6:166163781-166163803 TCCAGGCAGCACTGGAAGGAAGG + Intronic
1018709544 6:166488212-166488234 TTCAGACAGCAGCAAGAGCAGGG - Intronic
1018709552 6:166488276-166488298 TTCAGACAGCAGCAGGAGCAGGG - Intronic
1018709557 6:166488308-166488330 GTCAGACAGCAGCAGGAGCAGGG - Intronic
1018719289 6:166560687-166560709 GGCAGGCACCAGCAGGTGGAGGG + Intronic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018952871 6:168390649-168390671 TGCTGGCAGAAGCAGGAGGAGGG - Intergenic
1019083455 6:169452617-169452639 GCATGGCAGCCGCAGGAGGAGGG + Intergenic
1019101525 6:169634767-169634789 TACAGGCTGAAGAAGGAGGACGG - Intronic
1019428349 7:987668-987690 TCCAGCCAGGAGCAGGAGGGAGG + Intronic
1019494787 7:1332620-1332642 CCCAGGCCACAGCAGCAGGAAGG - Intergenic
1019553533 7:1617100-1617122 TCCAGGCTGGGGGAGGAGGAAGG - Intergenic
1019579828 7:1756006-1756028 GCCAGGCAGCAGCTGGAGCATGG + Intergenic
1019935990 7:4258323-4258345 GCCTGGCAGCTGCAGGAGGAGGG + Intronic
1019964833 7:4490307-4490329 TGCAGGCTGAGGCAGGAGGATGG + Intergenic
1020006316 7:4785311-4785333 TCCAGGCAGGACCGGGAGCAGGG - Intronic
1020757488 7:12221684-12221706 TCCAGCCTGCAGCACAAGGAAGG + Intronic
1021137157 7:16979330-16979352 TCCAGGCAGCTGGAAGTGGAAGG + Intergenic
1021249222 7:18303813-18303835 TCCAGCCAGCAGAACGGGGAAGG - Intronic
1021608771 7:22435877-22435899 TTCTGGCAGAAGCAGGAGTAGGG - Intronic
1022111594 7:27235659-27235681 TCCAGGCAGCACCTGGGGCAAGG + Intergenic
1022468636 7:30668026-30668048 CCCAGGCAGCAGCAGCCCGAGGG - Intronic
1023053737 7:36275206-36275228 TCCAGGAAGCAGGATGAGGATGG + Intronic
1023349761 7:39308846-39308868 TCCTGGCACCCGCAGGGGGAAGG - Intronic
1023835709 7:44066080-44066102 ACCAGGCAGCAGCAGCAGAATGG + Intronic
1023882133 7:44326498-44326520 TCCAGGCAAAAGCAGGGGGCAGG - Intronic
1023905969 7:44521756-44521778 TAAAGGCGGCAGCAGGAGGACGG + Exonic
1024185675 7:46945874-46945896 TCCAGGCAGAGGGAGGAGGAGGG + Intergenic
1024295310 7:47837006-47837028 TGCAGGTAGCGGCTGGAGGAGGG + Exonic
1024610939 7:51063575-51063597 TGCAGACAGCAGTAGGAGGCAGG + Intronic
1024638185 7:51307973-51307995 TTTAGGCAGGAGCAGGAGGAAGG + Intronic
1025231548 7:57206162-57206184 TCCAGGCAGAGGCAGCAGCAAGG - Intergenic
1025276109 7:57581922-57581944 CTCAGGCACAAGCAGGAGGAGGG - Intergenic
1025605788 7:63039013-63039035 CCCAGGAGGCAGCAGGAGGGGGG + Intergenic
1026491593 7:70868523-70868545 TCCAGGGGGCAGGAGAAGGATGG + Intergenic
1026505685 7:70980632-70980654 TCGATGCTGCAGCTGGAGGAAGG - Intergenic
1026678977 7:72451074-72451096 ACCAGGCAGAAGAAGGAGGAGGG + Intergenic
1026970222 7:74463154-74463176 TGCAGGCAGGAGCAGGAGTTAGG + Intronic
1028018114 7:85740099-85740121 TCCAGACAGCAGGAAAAGGATGG - Intergenic
1029479255 7:100802956-100802978 TGAAGGCAGCAGCTGGGGGAGGG + Exonic
1029947809 7:104551800-104551822 CCCAGGGAGAAGCAGGAGAACGG + Intronic
1030084593 7:105805725-105805747 TCCAGGCAGTCGCAGGGGGAGGG + Intronic
1030360363 7:108589199-108589221 TCCAGGCTGAGGCTGGAGGATGG - Intergenic
1030687936 7:112505787-112505809 TCCAGGCCCCAGCAAGAAGAGGG - Intergenic
1031206929 7:118771847-118771869 ACTAGCCAGCAGCTGGAGGATGG - Intergenic
1031538464 7:122963529-122963551 CCCAGGTAGCAGCAGAATGAAGG - Intergenic
1031727112 7:125253617-125253639 TACAGGCAGTAGCAAGAGGCTGG + Intergenic
1031942110 7:127799950-127799972 ACAAGCTAGCAGCAGGAGGAAGG - Intronic
1032080982 7:128858331-128858353 TCCAGGCACCAACATGATGATGG + Exonic
1032091266 7:128912829-128912851 TCCAGGCACCAACATGATGATGG - Intergenic
1032270483 7:130400159-130400181 TCCGGGCAGACCCAGGAGGAAGG + Exonic
1033126986 7:138715108-138715130 TGCAGCCTGCAGCAGGAGCACGG + Intronic
1033962110 7:146928036-146928058 TGCAGGTAGAAACAGGAGGATGG - Intronic
1034202448 7:149290966-149290988 TCCAGGCACCTGCAGGGGGCAGG + Intronic
1034270545 7:149801642-149801664 TGCAGGAGGCATCAGGAGGAAGG + Intergenic
1034392814 7:150800049-150800071 TGCAGGCGGCAGAAGGTGGACGG + Intronic
1034450960 7:151137122-151137144 ACCAGGCTGCAGCAGCTGGAAGG - Intronic
1034475009 7:151276792-151276814 GCCAGGCAGGAGAAGGAGGGGGG + Intronic
1034529049 7:151684107-151684129 TGCAGGCAACTGCAGGAGGCTGG + Intronic
1034960629 7:155362205-155362227 CCCAAGGAGCTGCAGGAGGAGGG + Intronic
1035059793 7:156060522-156060544 TCCAGGCAGCAGCGGGCAGAGGG + Intergenic
1035412047 7:158652300-158652322 TTCAGGAAGCAGCCGGAAGAAGG - Exonic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036032568 8:4990722-4990744 TCCTGGCTTCATCAGGAGGAAGG + Intronic
1036220339 8:6915911-6915933 AGGAGGCAGCAGCAGGAAGAGGG - Intergenic
1036470900 8:9051692-9051714 TCTAGGCAGGACCAAGAGGAAGG - Intronic
1036686290 8:10913862-10913884 TCCCAGCAGCAGCACGAGGCAGG + Intronic
1037601604 8:20400994-20401016 TCCAGGCTGTAGCACAAGGAAGG + Intergenic
1037676662 8:21057067-21057089 TCCAGGCAGAAGCACCAGGAAGG + Intergenic
1037862492 8:22415811-22415833 TCCAAGAAGGACCAGGAGGAGGG + Exonic
1038087546 8:24216642-24216664 TCCTGGGTGCAGCAGAAGGAAGG + Intergenic
1038298164 8:26315749-26315771 GCAAGGCAACAGCAGAAGGAAGG - Intronic
1039097952 8:33907205-33907227 ACATGGCAGCAGGAGGAGGAGGG - Intergenic
1039466389 8:37788160-37788182 TCCAGGCAGGAGGAGGGGTAGGG - Intronic
1039467715 8:37796406-37796428 TGGAGGCAGCCGCAGGAGGATGG - Intronic
1039943663 8:42111981-42112003 TCCAGAAAGCAGCAGGGGAATGG - Intergenic
1040817157 8:51520424-51520446 TCCACGCCGCACCAGGAGGAGGG + Intronic
1041004595 8:53486232-53486254 TCCAGGCAGCAGCAGTACTCTGG - Intergenic
1041138509 8:54788203-54788225 TGCAGGCTGGAGTAGGAGGAAGG + Intergenic
1041167268 8:55102353-55102375 CCGACGCAGGAGCAGGAGGAGGG + Intergenic
1041440489 8:57890727-57890749 TCCAGGCAGTATCCAGAGGAAGG - Intergenic
1041628341 8:60056585-60056607 TCCCAGCAGCAGCTGTAGGAAGG - Intergenic
1041756026 8:61313890-61313912 TCGAGGCAGCAGTGGGAGCAAGG + Intronic
1042767308 8:72337621-72337643 TCCCCGCAGCTGCATGAGGAGGG - Intergenic
1043054517 8:75420786-75420808 GCCAGGCAGCAAGAGGAGAAAGG + Intronic
1043342264 8:79254539-79254561 ACCAGGCATCACCTGGAGGATGG + Intergenic
1043415591 8:80045309-80045331 TCCAGGCAGCTTCAGCAGAAGGG - Intronic
1044532492 8:93323391-93323413 TCCAGGCAGCAGGAGCAGTCAGG - Intergenic
1044932014 8:97260127-97260149 TCCCAGCAGGAGAAGGAGGAGGG + Intergenic
1044932070 8:97260293-97260315 TCCAGCCAGCTGTGGGAGGATGG - Intergenic
1045222869 8:100215627-100215649 TCCAGGCTGAGGCAGGAGAATGG - Intronic
1046174736 8:110560433-110560455 TGCAGGCAGAAGCCTGAGGATGG + Intergenic
1047192983 8:122695464-122695486 GCCAGGGAGCAGGAGGATGAGGG + Intergenic
1047216918 8:122883361-122883383 CCCAGACAGCAGCAAGAGTAAGG + Intronic
1047499238 8:125429657-125429679 GCCCGGCTGCAGCCGGAGGAAGG - Intergenic
1047844830 8:128794506-128794528 CCAAGGCAGCAGCTGGTGGATGG - Intergenic
1048256014 8:132905884-132905906 TCCAGACAGGAGCAGGCAGAAGG + Intronic
1048614191 8:136056573-136056595 TCCAGGCAGAAGAAGAAGCAAGG - Intergenic
1049356767 8:142192946-142192968 AACAGGGAGGAGCAGGAGGAAGG + Intergenic
1049543019 8:143216987-143217009 TTCAGCCAGCAGAAGGAGGAAGG - Intergenic
1049720100 8:144111716-144111738 TCCTGGCAGCAGCGCCAGGAAGG + Exonic
1050262476 9:3854995-3855017 TTCAGGCATCAGCAAGAGGCAGG + Intronic
1051512010 9:17888751-17888773 ACCAGATTGCAGCAGGAGGAAGG - Intergenic
1052098624 9:24415091-24415113 TGCAGACAGCAGAAGGAGGAAGG - Intergenic
1052347594 9:27425974-27425996 TTCACCCAGCAGAAGGAGGAGGG + Intronic
1052382591 9:27788046-27788068 ACAAGACAGCAGTAGGAGGATGG - Intergenic
1052622057 9:30925256-30925278 TCATGGCGGGAGCAGGAGGAAGG + Intergenic
1052998685 9:34565464-34565486 CTCAGGCAGCAGCAGGAGAAGGG + Intronic
1053598360 9:39585862-39585884 TCCAGGCAGCCACAGGAGCTGGG + Intergenic
1053856393 9:42342871-42342893 TCCAGGCAGCCACAGGAGCTGGG + Intergenic
1054714491 9:68543463-68543485 TCCAGGAAGTGGCAGGGGGATGG + Intergenic
1055511039 9:76995794-76995816 TCCTGGAAGGAGCAGAAGGAAGG - Intergenic
1055746201 9:79448059-79448081 TGCAGCCAACAGCAGGAGGCTGG - Intergenic
1055893234 9:81145549-81145571 TCCAGGCAGCTGAGAGAGGAAGG - Intergenic
1055979553 9:81988683-81988705 TGCAGGGAGCAACAAGAGGAGGG - Intergenic
1056158177 9:83860708-83860730 TCCAGTGTGGAGCAGGAGGATGG - Intronic
1056352371 9:85763349-85763371 TCCAGTGTGGAGCAGGAGGATGG + Intergenic
1056475055 9:86945754-86945776 CCCAAGCAGCAGCAGCAAGATGG + Exonic
1056544358 9:87601428-87601450 GACAGGCAGCAAAAGGAGGAAGG + Intronic
1056579543 9:87880830-87880852 CCCCTGCAGCAGCAGGAGCAAGG + Intergenic
1056715925 9:89028040-89028062 TTAAGGCAGTAGGAGGAGGATGG + Intronic
1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG + Intronic
1057200699 9:93138252-93138274 AACAGGCAGGAGCAGGAGGCTGG + Intergenic
1057379026 9:94552905-94552927 CTCAGGCGCCAGCAGGAGGAGGG + Intergenic
1057499433 9:95585064-95585086 TCCAGGCATCATCAGGAGCAGGG + Intergenic
1058959388 9:109978551-109978573 TACAGGCAACATAAGGAGGATGG - Intronic
1059190591 9:112322168-112322190 TCCAGTCTCTAGCAGGAGGAGGG + Intronic
1060175373 9:121493717-121493739 TCTAGGAAGCTGAAGGAGGATGG - Intergenic
1060221478 9:121766282-121766304 CCCAGGCAGGAGGAGGAGCAGGG - Intronic
1060414527 9:123421032-123421054 CCCAGACAGAAGCAGGAGGCAGG + Intronic
1060587429 9:124795247-124795269 TCCAGCCAGGAGCTGGGGGAGGG + Intronic
1060799921 9:126537309-126537331 CCTAGGCAGCAGCAGGAGGCTGG - Intergenic
1060960878 9:127679711-127679733 TCTAGGCAGCAGGAGGTAGATGG + Intronic
1061475713 9:130864668-130864690 TCCAGGTAGTAGGAGGAAGAAGG + Intronic
1061865641 9:133490692-133490714 TCAAGGCTGCAGGAGGAGGATGG + Intergenic
1062137839 9:134939030-134939052 TCCAGGCTGCAGCAGCAGAGGGG - Intergenic
1062160502 9:135077003-135077025 TCTGGGCAGCACCAGGAGAAGGG - Intronic
1062325623 9:136011154-136011176 TCCGGGCAGGAGGAGCAGGAAGG + Exonic
1062454002 9:136627229-136627251 TCCTGGCAGCAGCAGGGAGCTGG - Intergenic
1062488088 9:136791147-136791169 TCCGCGCGGCAGCAGGCGGAGGG - Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203627289 Un_KI270750v1:35411-35433 CTCAGGCACCGGCAGGAGGAGGG - Intergenic
1185448503 X:270983-271005 TCCAGGAAGCAGCTGGACCAAGG + Intergenic
1186505148 X:10085779-10085801 TCCAGGCAGGAGCTGGAGAGGGG - Intronic
1186893815 X:13986560-13986582 TCTGGGCAGCAGGAGGAGAAAGG + Intergenic
1187600571 X:20824821-20824843 TTCAGGCATGAGCAGGATGAAGG - Intergenic
1187728833 X:22232831-22232853 TCCAGGTAGCAGCATAATGACGG - Intronic
1189147019 X:38665783-38665805 GTCAGGCAGCAGCTGGGGGAAGG + Intronic
1189243159 X:39541200-39541222 TCTGGGCTGCAGCAGGAGGGTGG - Intergenic
1189337949 X:40182209-40182231 GCCAGGAAGCAGCAGGAGGTAGG - Intergenic
1189752054 X:44232227-44232249 TCCAGGCACAGGCAGGAGGCAGG - Intronic
1190233978 X:48602045-48602067 TCCCTGCAGCAGCAGAGGGAGGG - Exonic
1190461911 X:50685135-50685157 CCCTGGCAGTAGCAGGACGAAGG + Intronic
1192201908 X:69071519-69071541 TCCAGGCAACAGAGGGAGGTTGG + Intergenic
1192681675 X:73259532-73259554 TCCAGACAGCGGAAAGAGGATGG - Intergenic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1193422329 X:81296194-81296216 GACAAGCAGCAGTAGGAGGATGG + Intronic
1194600341 X:95913188-95913210 CCCAGGCGGCAGCTGGGGGAGGG - Intergenic
1194703023 X:97137724-97137746 GGCAGACAGCAGCAGGAGGCAGG + Intronic
1197321239 X:125033558-125033580 TACAGTAAGTAGCAGGAGGAAGG + Intergenic
1197424065 X:126273268-126273290 TGCAACCAGCAGCAGGAGGCTGG - Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198292051 X:135249191-135249213 TGCATGGAGCATCAGGAGGAAGG - Intronic
1198306868 X:135392088-135392110 TGCACGGAGCATCAGGAGGAAGG - Intergenic
1198958715 X:142161154-142161176 TCCAGAGGTCAGCAGGAGGATGG - Intergenic
1198961205 X:142185554-142185576 TCCAGAGGTCAGCAGGAGGATGG - Intergenic
1199011029 X:142759140-142759162 TCATGGCTGGAGCAGGAGGAAGG - Intergenic
1199754033 X:150847930-150847952 ACCTGGAAGGAGCAGGAGGATGG - Intronic
1200211255 X:154347589-154347611 TGCAGGCAGCACCAGGAGCCAGG + Intergenic