ID: 1003116441

View in Genome Browser
Species Human (GRCh38)
Location 6:3286814-3286836
Sequence CTGGGTGCAGGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 0, 2: 9, 3: 114, 4: 1030}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003116441_1003116453 7 Left 1003116441 6:3286814-3286836 CCAGCTTCCCTCCCTGCACCCAG 0: 1
1: 0
2: 9
3: 114
4: 1030
Right 1003116453 6:3286844-3286866 CCCCGACCCACTCACGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1003116441_1003116460 29 Left 1003116441 6:3286814-3286836 CCAGCTTCCCTCCCTGCACCCAG 0: 1
1: 0
2: 9
3: 114
4: 1030
Right 1003116460 6:3286866-3286888 GAGGCCGAGCTGCAGGAGTGAGG 0: 1
1: 0
2: 2
3: 42
4: 401
1003116441_1003116459 22 Left 1003116441 6:3286814-3286836 CCAGCTTCCCTCCCTGCACCCAG 0: 1
1: 0
2: 9
3: 114
4: 1030
Right 1003116459 6:3286859-3286881 GGTTGAGGAGGCCGAGCTGCAGG 0: 1
1: 0
2: 2
3: 23
4: 280
1003116441_1003116450 1 Left 1003116441 6:3286814-3286836 CCAGCTTCCCTCCCTGCACCCAG 0: 1
1: 0
2: 9
3: 114
4: 1030
Right 1003116450 6:3286838-3286860 CCACCTCCCCGACCCACTCACGG 0: 1
1: 0
2: 5
3: 33
4: 278
1003116441_1003116456 10 Left 1003116441 6:3286814-3286836 CCAGCTTCCCTCCCTGCACCCAG 0: 1
1: 0
2: 9
3: 114
4: 1030
Right 1003116456 6:3286847-3286869 CGACCCACTCACGGTTGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003116441 Original CRISPR CTGGGTGCAGGGAGGGAAGC TGG (reversed) Intronic
900001403 1:16826-16848 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
900021123 1:187348-187370 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
900101753 1:964916-964938 CTGGCTGCAGGAAGGGATGCGGG - Intronic
900103895 1:974130-974152 GAGGGAGCAGGGAGGGAAACAGG + Intronic
900143088 1:1146646-1146668 CTGGGCAGAGGGCGGGAAGCGGG + Intergenic
900182162 1:1315827-1315849 GCGGGGGCAGGGAGGGAGGCGGG + Intronic
900238807 1:1605105-1605127 CTGGGCGCTGGGAGGGCAGGAGG - Intergenic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900325085 1:2104670-2104692 CTGGGAGGAGAGAGGGAGGCTGG + Intronic
900371520 1:2334227-2334249 CTGGGTGGTGGGGGGGCAGCAGG + Intronic
900403189 1:2481213-2481235 CTGGCTGGAGCAAGGGAAGCTGG + Intronic
900662056 1:3789680-3789702 CAGGGGACAGGAAGGGAAGCGGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
900797303 1:4716108-4716130 CTGGGTGCAGAGAGGAAACGTGG + Intronic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
901801799 1:11712463-11712485 CTGGGTACTGGGAGGGAACCTGG + Intronic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902129139 1:14243533-14243555 CTGGGTGAAGGTAGGTGAGCAGG + Intergenic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902615338 1:17620591-17620613 CTGGCTGCAGGCAGGGCAGTGGG + Intronic
902994042 1:20210059-20210081 GTGGGGGCAGAGAGGGGAGCTGG + Intergenic
903279716 1:22243679-22243701 CTGCCTGCAGGGAGGGACGCTGG + Intergenic
903519186 1:23934547-23934569 CTGGGTGCAGTGATGGGTGCCGG - Intergenic
903576077 1:24340691-24340713 CTGGAGGCAGGCAGGGAGGCAGG - Intronic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904025956 1:27503979-27504001 CAGGGTGCAGGGATGGGAGATGG + Intergenic
904034618 1:27551983-27552005 CAGGGGGCCGGGTGGGAAGCAGG + Exonic
904211110 1:28887410-28887432 CAGGGTGCAGGGAGGGGCGTGGG + Intronic
904355949 1:29939959-29939981 CTGGGTGCAGGGATGCATGGAGG - Intergenic
904370719 1:30045948-30045970 CTGGGCTCAGGGATGGAGGCTGG - Intergenic
904378733 1:30097285-30097307 CTGGGAGCAGGCAGGGATTCTGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904565347 1:31425275-31425297 CTGAGTGCAGGCAGGGAAACTGG - Intronic
904567587 1:31436940-31436962 CTGGGTCCTGGGTGGGCAGCTGG - Intergenic
904611493 1:31728365-31728387 CTGGCAGCAGGGAGGGATGTGGG - Intronic
904985099 1:34539216-34539238 CTGGGTGGGGGAAGGGAGGCTGG - Intergenic
905121308 1:35684206-35684228 CTGGGGGCAATGAGTGAAGCTGG - Intergenic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905294780 1:36947306-36947328 CTGGGTGCAGGTAGTGATGGGGG - Intronic
905389585 1:37627812-37627834 AGGGGTGCAGGGAGGGATGAAGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906059172 1:42937117-42937139 GTGGGAGCAGGGAAGGAAGAGGG - Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906190240 1:43894248-43894270 CTGGGTGGAGGGGGGTATGCCGG + Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906319029 1:44805421-44805443 CAGGGTGCTGGGGAGGAAGCTGG + Intronic
907318708 1:53589361-53589383 CTGGGTGCTGGGAGGGGCGGGGG - Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
907461152 1:54606383-54606405 CTGAGTGCAGGCAGGGGAGTGGG + Intronic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
908319782 1:62967874-62967896 CTAGGAGCAGGGAGGAAAGAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908513835 1:64872206-64872228 CTGGGTGGAGGCAGGGATGCTGG + Intronic
908788921 1:67761797-67761819 GAGGGTGCAGGGAGAGAGGCAGG + Intronic
909398538 1:75198241-75198263 CTGGGTGCAGGGATGGTAGTGGG + Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910981325 1:92961878-92961900 CTGGGCGCAGCGCGGGGAGCCGG - Intergenic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911871823 1:103108560-103108582 CTGGGAGCAGGGAGGGGAGTGGG - Intergenic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912948992 1:114107471-114107493 CTGGAGGCAGGGAGGAAACCAGG + Intronic
913115855 1:115696180-115696202 TTGGGTGCAGGGAGGCAGGCAGG + Exonic
913224441 1:116686727-116686749 CTTGTTTCAGGGAGAGAAGCTGG + Intergenic
913997191 1:143661132-143661154 CTGGTTGCAGGGAGCGAAAGTGG + Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914684504 1:149966332-149966354 CTGAGTGGAGGGAAGGAATCAGG - Intronic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
914899650 1:151704978-151705000 CTGGCTGCAGTGTGTGAAGCTGG + Intronic
915089695 1:153415832-153415854 CAAAGTCCAGGGAGGGAAGCAGG - Intergenic
915095813 1:153461308-153461330 CAAAGTCCAGGGAGGGAAGCAGG + Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915457776 1:156052117-156052139 CTAGGTGGAGGGACTGAAGCTGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916378118 1:164178337-164178359 CAGGGTGCAGCCAGGGGAGCCGG - Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916620257 1:166489280-166489302 GTGGTTACAGGGAGGGAAGGGGG - Intergenic
916756307 1:167773394-167773416 AGGGGTGGAGGGAGGGAATCAGG + Intronic
917967062 1:180185543-180185565 CTGGGGGCAGGAGGGGAAGCAGG - Intronic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
920304113 1:205007947-205007969 CTGGGAGCAGGAGTGGAAGCAGG + Intronic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
920495702 1:206453541-206453563 CTGAGTGCAGGGAGTGGGGCGGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920732769 1:208503386-208503408 CTGGGAGCAAGGAGGGGAGTTGG + Intergenic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
921924869 1:220703207-220703229 GAGAGTGCAGGGAGGGAAACAGG + Intergenic
922200021 1:223393620-223393642 CCGGGTGCGGAGAGCGAAGCTGG + Exonic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922467266 1:225852932-225852954 CTGGGTGCACTGAGTGAAGCAGG - Intronic
922729494 1:227942341-227942363 CTGGGTGCAGAGCAGGAAGGAGG + Intronic
922894057 1:229087402-229087424 CTGGCTGCAGGGAGGTGACCGGG - Intergenic
923012185 1:230096625-230096647 ATGGGAGCAGGGAGGGAGGTTGG - Intronic
924146900 1:241085952-241085974 CTTGGAGCAGCAAGGGAAGCAGG - Intronic
924612189 1:245582921-245582943 CGGGGTGCAGGGAGAGAGGAAGG - Intronic
1062974410 10:1672738-1672760 GTGCGTGGAGGGAGGGAGGCAGG - Intronic
1063124059 10:3124594-3124616 CCAGGTGCAGGCAGGGAAGGGGG - Intronic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1063762336 10:9094090-9094112 GCGGGTGGAGGGAGGGAAGAGGG + Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1064167848 10:13001771-13001793 CAGGGGGCAGGGCGGGAGGCGGG - Intronic
1065251816 10:23823265-23823287 CTGAGAGCAGGCAAGGAAGCAGG - Intronic
1065907661 10:30272413-30272435 CTTGGTGCAGGGAGGGGCGTCGG + Intergenic
1066054019 10:31663518-31663540 CTGGTGGCAGGCAGGGCAGCTGG - Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066306088 10:34142582-34142604 CGGGGGGCAGGGAGGGAGGGAGG + Intronic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067321367 10:45224212-45224234 CCGGGTGCAGGGAGGGGATGGGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067713862 10:48671943-48671965 CTGGGAGCAGCGCGGGAAGAGGG - Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1067850628 10:49751680-49751702 CTGGCTGCAGGGAGGAGAGTTGG - Intronic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069917054 10:71793661-71793683 CTGGGAGCTGGGAGGGAGGTGGG - Intronic
1069979300 10:72241175-72241197 TGGGGTACAGAGAGGGAAGCAGG + Intergenic
1070356398 10:75644618-75644640 GTGGGTCCAGGGAAGGATGCAGG + Intronic
1070514101 10:77187651-77187673 CAGGGGGCAGGCAGAGAAGCAGG + Intronic
1070609718 10:77925440-77925462 CTGGGTGCAGGAACGGATACTGG - Intronic
1070720623 10:78754404-78754426 CTGGGAGCAGGGAAACAAGCAGG + Intergenic
1070751263 10:78965318-78965340 CTGGGGGCAGGGCGGGGAGGAGG + Intergenic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072035575 10:91560460-91560482 CTGGAGGCAGGGAGGCCAGCTGG - Intergenic
1072087290 10:92093193-92093215 CTGGGTGCAGAAAGGGAACCTGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1073243054 10:102070707-102070729 CTGGGTGAAGGCGAGGAAGCAGG + Intergenic
1073301573 10:102474095-102474117 CTGGGTCCAGTGACGGAAGGTGG + Intronic
1073303379 10:102484578-102484600 CTGGGTACGGGGAGGGAACTTGG - Intronic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074270407 10:111947926-111947948 GTGGGAGGAGGGAGAGAAGCAGG + Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1075102364 10:119515481-119515503 CAAGGTGCAGGCAGGGAAGTCGG + Intronic
1075268316 10:121025549-121025571 GTGGGTGTAAGGAGGGGAGCAGG + Intergenic
1075310972 10:121413063-121413085 CTGGGTACAGGTAGAGATGCTGG - Intergenic
1075595289 10:123724895-123724917 CTGGGTGCTGGGAGAGAAGGTGG + Intronic
1075664440 10:124220700-124220722 CTGGGTGCAGGGCTGGCAGAGGG - Intergenic
1075948354 10:126456841-126456863 CCAGGAGCAGGGAGGGAGGCTGG + Intronic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076401520 10:130188609-130188631 CTGGGTGCAGGGTGGAGTGCTGG + Intergenic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076692433 10:132230656-132230678 CTTGCTGCTGGGGGGGAAGCTGG + Intronic
1076727703 10:132421235-132421257 CAGGGTGCAGGGAGCCCAGCGGG - Intergenic
1076739578 10:132476660-132476682 CTGGGTCCAGGCTGGGACGCTGG + Intergenic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076833242 10:133007405-133007427 CTGGGGGCTGGGAGGGGAACAGG - Intergenic
1076941702 10:133614491-133614513 CTGGTCCCAGTGAGGGAAGCTGG - Intergenic
1076942414 10:133618608-133618630 CTGGCCCCAGTGAGGGAAGCTGG - Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077135423 11:995746-995768 CTAGGTGGAGGGAGGGGAGAGGG - Intronic
1077179865 11:1207435-1207457 CTGGGGGCAGGGAGGTCACCAGG + Intergenic
1077375866 11:2204893-2204915 CTGGGGGCAGGAATTGAAGCAGG - Intergenic
1077471334 11:2762086-2762108 CTGGGAGCAGGCAGGGAACGGGG - Intronic
1077492717 11:2869617-2869639 CTGCGCGCAGGGATGGACGCTGG + Intergenic
1077673877 11:4181005-4181027 CCTGGTGCAGGGAGGCAACCTGG - Intergenic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1078351899 11:10601781-10601803 CTGGTGGCAGTGAGGGCAGCAGG + Intronic
1078388210 11:10911736-10911758 TTGGGTGCAGGGACTGAGGCGGG + Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078757527 11:14224908-14224930 CTGGGTGCAGGGAGTAAAACGGG + Intronic
1079085570 11:17442621-17442643 GGGGGTGCAGGGACAGAAGCAGG - Intronic
1079593938 11:22217787-22217809 ATGGGAGGAGGGAGAGAAGCAGG + Intronic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081581050 11:44352242-44352264 CTTTGTGGAGGGAGTGAAGCTGG + Intergenic
1081690582 11:45075108-45075130 CTGGGCTCAGGGGGGGCAGCGGG + Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1083052284 11:59788014-59788036 CTGGCTGAAGCGTGGGAAGCAGG - Intronic
1083211949 11:61193765-61193787 CTGGGTGCTGGGGGGCAAGGCGG + Intergenic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083312116 11:61789282-61789304 AGGGGTGCAGGGAGAGAAGGAGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083326164 11:61873986-61874008 CTGGGGGCAGGCAGCGATGCGGG + Intronic
1083657681 11:64237529-64237551 CTGGGTGCAGCGTGGGCAGAGGG - Exonic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083972017 11:66084053-66084075 CTGGGGACAGGGTGGGCAGCAGG + Intronic
1084086791 11:66858614-66858636 CTGGGTGCTGGAAGGCCAGCGGG + Exonic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084319102 11:68363728-68363750 CTGCCTGCAGTCAGGGAAGCGGG - Exonic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085695395 11:78700232-78700254 TAGGATGCAGGGAGGGCAGCAGG + Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1086455380 11:86955158-86955180 CTGGGAGCAGCGCGGGCAGCCGG - Exonic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1088590041 11:111395375-111395397 CCGGGAGCAGGGATGGGAGCAGG - Intronic
1088824599 11:113483216-113483238 CTGGGGGCATGGAGGGACACAGG - Intergenic
1089083537 11:115797758-115797780 CTGGAGGCAGGGAGGTCAGCTGG + Intergenic
1089299172 11:117488168-117488190 CTGGGTGCAGGGCCGGATGGAGG - Intronic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089656066 11:119947828-119947850 TTGGGTGCAGCCAGGGAGGCTGG + Intergenic
1089683417 11:120132217-120132239 GAGGGTGCTGGGAGGGAAGCGGG - Intronic
1089798961 11:121007823-121007845 CTGGGTGCAGGTCGGCAAGGAGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091360664 11:134976554-134976576 CTGGGTGGAGGGAGGGTGCCCGG - Intergenic
1091678608 12:2510166-2510188 CTGGGCCCAGGGACTGAAGCCGG - Intronic
1091686965 12:2569462-2569484 TTGGTTGCTGGGAGGGAAGATGG - Intronic
1091882142 12:3988744-3988766 ATGGGTGCAGGGAGGATTGCTGG - Intergenic
1091915338 12:4269208-4269230 CGGGGGGCGGGGAGGGAGGCGGG + Intergenic
1092067728 12:5605748-5605770 CAAGGTGCAGGGAGGGGAGGAGG + Intronic
1092118360 12:6025771-6025793 GTGGCTGCAGGGTGGGAAGGAGG - Intronic
1092177317 12:6419127-6419149 CTGGGTGCTGGGCAGGATGCGGG - Intergenic
1092693389 12:11141791-11141813 TTGGGTGGAGGGAGGGAGACAGG + Intronic
1093082811 12:14832602-14832624 CTAGGTGCAGGGAAGGAAATAGG - Intronic
1093191657 12:16081838-16081860 CTGGGCCCAGCTAGGGAAGCTGG + Intergenic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094167692 12:27459469-27459491 CAGGGTGCAGGATGGGAAGAAGG + Intergenic
1094472491 12:30816792-30816814 CTGGGAGCTGGGAGGGGAGCAGG + Intergenic
1095087689 12:38075462-38075484 TGGGGTGCAGGGAGGGAGGAGGG + Intergenic
1095943711 12:47741629-47741651 GTGGGGGAAGGGAGGGAGGCCGG + Intronic
1096098985 12:48957432-48957454 CTAGGTGGAGGGAAGGAAGGAGG - Exonic
1096271221 12:50167491-50167513 CGGGTTGCAGTGAGGGAAGTGGG - Intronic
1096493047 12:52023418-52023440 CTGGGATCTGGGAAGGAAGCAGG + Intronic
1096518849 12:52172994-52173016 CTGGGGGCGGGGAGGAGAGCAGG - Intronic
1096580307 12:52580796-52580818 GTGGGCCCAGGGAGGGAAGCTGG - Intergenic
1096616141 12:52834524-52834546 CTGGGGGCAGGGGGAGAAGGTGG - Intergenic
1096694593 12:53340535-53340557 CTGGGTGGGGGTAGGGATGCTGG - Intronic
1096751092 12:53759272-53759294 CTGGGTAGAGGGTGGGAGGCTGG - Intergenic
1096806268 12:54143034-54143056 GTGGGTGCAAGGAAGGAAGAAGG + Intergenic
1096864574 12:54554662-54554684 GTGGCTGGAGGGAGGGAAGCAGG + Intronic
1096871706 12:54596656-54596678 ATGAGTCCAAGGAGGGAAGCAGG - Intergenic
1097089845 12:56496197-56496219 TTGCCTCCAGGGAGGGAAGCTGG - Intergenic
1097730563 12:63123653-63123675 CTGGGTGCCTGGATGGGAGCAGG - Intergenic
1100921335 12:99491530-99491552 GTGGGTGGAGGGTGGGAAGAGGG - Intronic
1101100282 12:101384689-101384711 CTGGGGGCAGGAAGGAAAGGAGG + Intronic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1101637844 12:106560986-106561008 CTGGCTGATGGGAGGTAAGCAGG + Intronic
1102073536 12:110041820-110041842 CTGAGTGCAGGGCAGGATGCAGG + Exonic
1102225831 12:111227685-111227707 CTGGGGGCAGGGAGTGATGGAGG + Intronic
1102587500 12:113933409-113933431 CTGCGTGCAGTGAGGGCAGGAGG + Intronic
1102672048 12:114628466-114628488 GTGGTTGCAGAGATGGAAGCAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103859958 12:124004238-124004260 CTGGGTGGAGGGAGGGCATAAGG + Intronic
1103983366 12:124751052-124751074 CTGGGAGCAGGTAGTGAGGCAGG - Intergenic
1104051486 12:125197145-125197167 GAGGGTGCAGGGTGGGAGGCGGG - Intronic
1104591104 12:130085295-130085317 CAGGGAGCAGTGAGGGAAGCAGG - Intergenic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1104667692 12:130659000-130659022 CATGGTGGAGGGAGGGAGGCTGG - Intronic
1105307996 13:19182317-19182339 CCGGGTGCTGGGTGGGAAGGTGG - Intronic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107016270 13:35710073-35710095 GTGGGTGCAGGAAGTGAAGGGGG + Intergenic
1107835571 13:44410102-44410124 CCACGTGGAGGGAGGGAAGCAGG - Intergenic
1107988885 13:45799699-45799721 CTGCTTGCAGGGAGAGGAGCGGG - Intronic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109864632 13:68246711-68246733 GTGGGTGGAGGGTGGGAAGAGGG - Intergenic
1110362926 13:74648197-74648219 CTGGATGGAGGGAGATAAGCTGG - Intergenic
1112047914 13:95616244-95616266 CTGGGTGCAGGGTGGAAACGTGG + Intronic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1112813123 13:103242213-103242235 GTGGGAGGAGGGAGAGAAGCAGG - Intergenic
1113036191 13:106052460-106052482 CAGGGAGCAGGGAGGGCCGCGGG - Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1113200886 13:107866956-107866978 CTGGGTGCAGGGGGCGATGGTGG + Intergenic
1113654322 13:112058436-112058458 CTAGGTGCAGGGGAGGAGGCCGG - Intergenic
1113697103 13:112354473-112354495 CTGGCCCCAGGGAGGGAGGCCGG - Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113741249 13:112713971-112713993 CTGGGGCCAGGAATGGAAGCTGG - Intronic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1113769446 13:112898896-112898918 GTGGGTGCAGGGCCTGAAGCAGG - Intronic
1113888658 13:113725097-113725119 CAGGGTGCAGGCTGGGAGGCCGG + Intronic
1113942405 13:114025111-114025133 GGGGGGGCAGGGAGGGAGGCCGG - Intronic
1114237488 14:20835349-20835371 CGGGGTGTAGGAAGGGAAGTGGG + Intergenic
1114658396 14:24329700-24329722 TAGGGTGCAGGGAGGGGAGCTGG - Intronic
1114698056 14:24645895-24645917 GTGGGAGGAGGGAGAGAAGCAGG + Intergenic
1114950376 14:27743275-27743297 CTGGCTACACTGAGGGAAGCAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116389381 14:44374918-44374940 CAGGAAGCAGGAAGGGAAGCAGG - Intergenic
1116577388 14:46591778-46591800 CTGGGTTCAAGGAGAGTAGCTGG - Intergenic
1118355338 14:65008978-65009000 GGGGGTGCAGGGTGGGATGCAGG - Intronic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1118766087 14:68910082-68910104 CTCGGTGGAGGGAGGGATGCCGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119031604 14:71197107-71197129 GTGGGTGCAGGGAATGCAGCTGG + Intergenic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119731606 14:76954806-76954828 CTGGGAACAGGGAGGAAATCTGG - Intergenic
1119850186 14:77861358-77861380 GTGGGTGGAGGGAGGGGAGCGGG + Intronic
1121011587 14:90523134-90523156 CTGGGAGCAGGGAGGGATGGAGG - Intergenic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1121858334 14:97291285-97291307 CTGGCTGCAGGAAGGGAGTCAGG - Intergenic
1122083591 14:99284220-99284242 CTGGGTGCAGGGAGGTCTGTGGG + Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122126438 14:99581070-99581092 CTGGAGGCAGGGAGGCCAGCTGG + Intronic
1122127279 14:99586195-99586217 CTGGGTGTAGGGAGGGGCGGGGG - Intronic
1122128042 14:99589841-99589863 CTGGGTGCAGGCAGGGGTGTAGG - Intronic
1122155704 14:99749163-99749185 CTGGGTGCACACCGGGAAGCGGG + Intronic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122555948 14:102580173-102580195 CTGGGAGCCGGGAGAGATGCCGG + Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122857555 14:104567189-104567211 GTGGGTGGAGGCAAGGAAGCCGG - Intronic
1122863172 14:104591624-104591646 CTGGGTCCCGGGAGTGAGGCTGG - Intronic
1122877754 14:104676758-104676780 CAGGGGGCAGGGAAGGTAGCCGG - Intergenic
1122894001 14:104746403-104746425 CAGGGTGCAGGGAGGGTGGCTGG - Intronic
1122898564 14:104772556-104772578 CCGGGGCCAGGGAGGGGAGCCGG + Intronic
1122919255 14:104873312-104873334 GTGGGTGCAGGCAGGGGAGGGGG + Intronic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124333109 15:28837257-28837279 CTAGGTCCAGGGAGGACAGCTGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124616989 15:31249070-31249092 CTGGCTGCAGGGAGGGGTGGAGG - Intergenic
1125190441 15:36986518-36986540 CTGGGAGCACTGAAGGAAGCTGG - Intronic
1125600041 15:40910516-40910538 CAGGGTGCAGTGGGGGATGCTGG - Intergenic
1125750076 15:42021905-42021927 CTGAATGCAGGGATGGAACCTGG + Intronic
1125933603 15:43616691-43616713 CTGGGTGCAGAGGGAGGAGCAGG + Intronic
1125946701 15:43716153-43716175 CTGGGTGCAGAGGGAGGAGCAGG + Intergenic
1126048802 15:44668856-44668878 CTGGGCACAGCGAGGGATGCTGG - Intronic
1126066184 15:44827927-44827949 ATGGATGGAGGGAGGGAAGGAGG - Intergenic
1126093648 15:45072636-45072658 ATGGATGGAGGGAGGGAAGGAGG + Intronic
1126467910 15:48977242-48977264 GAGGGTGGAGGGTGGGAAGCTGG - Intergenic
1126475939 15:49065243-49065265 AAGAGTGCAGGGAGAGAAGCAGG + Intergenic
1127629713 15:60815588-60815610 CTGGCTGCAGTGGGGGAAGCTGG - Intronic
1127630060 15:60819922-60819944 CTGGAAGCAGGCAGGGAAGCAGG - Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128541989 15:68542649-68542671 CTGCTTGCAGGGATGAAAGCAGG - Intergenic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128799261 15:70487113-70487135 CTGGGGGCCGGGAGGAAGGCAGG + Intergenic
1129326927 15:74805096-74805118 ACGGATGCAGGGAGGGCAGCAGG + Intergenic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129689875 15:77707122-77707144 CAGGCTGCAGGCAGGGATGCTGG + Intronic
1129886473 15:79041664-79041686 CTGGGCTCAGGGAGGGAACCAGG - Intronic
1130460782 15:84157145-84157167 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic
1131397308 15:92096989-92097011 TTGGGTGCAGTGGTGGAAGCTGG - Intronic
1132371418 15:101302027-101302049 CCGGGCCCAGGGAAGGAAGCTGG - Intronic
1132424908 15:101707688-101707710 CTGGGGGCAGGGCGGGAATGGGG + Intronic
1132452105 15:101974112-101974134 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
1132454788 16:16509-16531 CTGGGTTCTGGGATGGGAGCTGG - Intronic
1132537718 16:491398-491420 CAGCGTGCAGGGTGGGAGGCGGG - Intronic
1132613290 16:828370-828392 CAGGAGGCAGGGAGGGACGCTGG + Intergenic
1132654553 16:1036445-1036467 CTGGGAGCGGGGAGGGACCCAGG + Intergenic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133721890 16:8502442-8502464 GTGGGTGGAGGGAGGGGTGCAGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134027208 16:10963588-10963610 CTGGGTGGAGGGACTGAAGCAGG - Intronic
1134285824 16:12861351-12861373 GTGGGAGGAGGGAGAGAAGCAGG + Intergenic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134629689 16:15747979-15748001 CTGGGTGGAGGAATGGATGCTGG - Intronic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135640275 16:24113813-24113835 CTGAATGCAGACAGGGAAGCAGG - Intronic
1136032282 16:27512242-27512264 CTGGGTGCTGGGAAGGGAACAGG - Intronic
1136294939 16:29296203-29296225 CTGGGCCCAGGGTGGGGAGCAGG - Intergenic
1136540122 16:30924088-30924110 CGGGGTGGGGGGAGGGGAGCTGG + Intronic
1137345382 16:47653208-47653230 CAGGGTGGAGGAAGGGAACCAGG + Intronic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1137670245 16:50274413-50274435 GTGGGTGCAGGTCCGGAAGCTGG + Intronic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1138121830 16:54406288-54406310 GTGGGAGGAGGGAGAGAAGCAGG + Intergenic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138514699 16:57529512-57529534 CTGGGTGAAGGGATTGGAGCAGG - Intronic
1138540293 16:57683782-57683804 CTGCCGGCAGGGATGGAAGCTGG + Intronic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140134640 16:72195164-72195186 CTGGGTGCAGCGATGGCACCAGG + Intergenic
1140152037 16:72377353-72377375 GTGGGAGGAGGGAGAGAAGCAGG + Intergenic
1140200248 16:72889053-72889075 ATGGGTGGAGGGAGGGAGGGAGG + Intronic
1140213900 16:72992331-72992353 ATGGGGGAAGGCAGGGAAGCTGG - Intronic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1141173449 16:81704742-81704764 TGGGGTGTAGGCAGGGAAGCGGG - Intronic
1141431944 16:83974876-83974898 GTGGGTGCAGGGATGAGAGCAGG + Intronic
1141431965 16:83974948-83974970 GTGGGTGCAGGGATGGGAACAGG + Intronic
1141432010 16:83975160-83975182 GTGGGTGCAGGGATGGGAACAGG + Intronic
1141475124 16:84267756-84267778 CTGAGGTCAGGGAGGGAACCTGG + Intergenic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141630301 16:85284004-85284026 ATGGGGGCGGGGAGGGAGGCAGG + Intergenic
1141647209 16:85373906-85373928 CGGGGAGCGGGGAGGGAGGCCGG - Intergenic
1141699976 16:85637918-85637940 GAGGGGGCAGGGATGGAAGCAGG + Intronic
1141764110 16:86047320-86047342 GAGGGTTGAGGGAGGGAAGCTGG + Intergenic
1141854791 16:86673669-86673691 GTGGGTGCATGAAGGGAAGGAGG - Intergenic
1141946011 16:87310713-87310735 CTGGCTGCATGGAGGGAGGTGGG - Intronic
1142020138 16:87777155-87777177 CTGGCAGCAGAGAGGGGAGCAGG - Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142084633 16:88170433-88170455 CTGGGAACAGGGAGGGAATGGGG - Intergenic
1142100833 16:88270212-88270234 CTGGGCCCAGGGTGGGGAGCAGG - Intergenic
1142215151 16:88826314-88826336 CTGGGTACAGGCAGGGAACAGGG + Intronic
1142215165 16:88826363-88826385 CTGGGTACAGGCAGGGAACAGGG + Intronic
1142292979 16:89201218-89201240 CTGGGGGCGGGGAGGGCTGCGGG + Intronic
1142299295 16:89247315-89247337 GTGGGGGCAGGGAGGGCGGCGGG + Intergenic
1142359210 16:89618945-89618967 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359225 16:89618976-89618998 GGGGCTGCAGGGAGGGGAGCGGG - Intronic
1142359254 16:89619037-89619059 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359294 16:89619129-89619151 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359321 16:89619189-89619211 GGGGCTGCAGGGAGGGGAGCGGG - Intronic
1142359362 16:89619280-89619302 GGGGCTGCAGGGAGGGGAGCGGG - Intronic
1142359390 16:89619340-89619362 GGGGCTGCAGGGAGGGGAGCGGG - Intronic
1142359406 16:89619371-89619393 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359421 16:89619402-89619424 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359435 16:89619432-89619454 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359449 16:89619462-89619484 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359475 16:89619522-89619544 CGGGCTGCAGAGAGGGGAGCAGG - Intronic
1142359488 16:89619561-89619583 GGGGCTGCAGGGAGGGGAGCGGG - Intronic
1142359507 16:89619601-89619623 GGGGCTGCAGGGAGGGGAGCGGG - Intronic
1142359530 16:89619664-89619686 AGGGGTGCAGGGAGGGGAGCAGG - Intronic
1142359542 16:89619694-89619716 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142359564 16:89619757-89619779 GGGGCTGCAGGGAGGGGAGCAGG - Intronic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1142987525 17:3705413-3705435 CTGGGCAAAGGTAGGGAAGCTGG - Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143033754 17:3982658-3982680 CTGGGTGGAGGCATGGAGGCTGG - Intergenic
1143163622 17:4886715-4886737 CTGGGGCCAAGGAGGGGAGCAGG - Intronic
1143371123 17:6440122-6440144 GTGGCTGGAGGGAGGGAAGGAGG - Intergenic
1143375251 17:6463408-6463430 ACGAGTGCAGGGAGGGAGGCAGG + Intronic
1143475897 17:7203817-7203839 CTGGGTGAAGGAGGGGAAGAGGG + Intronic
1143482338 17:7234810-7234832 GTGCGTGCAGGGAGTGAAGGTGG + Intergenic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143769148 17:9156957-9156979 GTGGGTGGAGGGAGGGAGGGAGG - Intronic
1143778142 17:9212837-9212859 CTTGGAGCAGGGCGGGGAGCTGG - Intronic
1144109877 17:12021136-12021158 CCGGGAGCGGGGCGGGAAGCCGG - Intronic
1144113610 17:12063977-12063999 CGGGGGGCGGGGAGGAAAGCAGG + Intronic
1144236687 17:13268394-13268416 TTGGGTGCTGTGATGGAAGCAGG - Intergenic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1144675509 17:17159017-17159039 CTGGGAGCAGGGTGGGGATCTGG - Intronic
1144780666 17:17806891-17806913 CTGGGTGCGGGGAGGGGACTGGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145799296 17:27672919-27672941 CTGGGTGCAGTGGTGGAAGGGGG - Intergenic
1145891076 17:28416184-28416206 CTGGGCCCATGGAGGGTAGCTGG - Intergenic
1146602372 17:34229017-34229039 CTTGGTGGACGGGGGGAAGCCGG - Intergenic
1146660080 17:34659788-34659810 CTGGCTGCTGGTAGGGGAGCTGG - Intergenic
1146820903 17:35983001-35983023 ATGGATGGAGGGAGGGAAGCAGG - Intergenic
1146896558 17:36545539-36545561 CGGGGGGCAGGGAGCGGAGCGGG - Intronic
1146949105 17:36893454-36893476 CTGGGTGCAGACAAGGAATCAGG - Intergenic
1146949831 17:36898239-36898261 CTGGGTGCAGACAAGGAACCAGG + Intergenic
1147241407 17:39093177-39093199 CTGGGGGCAGGGACTGAAGTGGG - Intronic
1147322156 17:39653025-39653047 CTGGCTGCTGGGAGGGAATGTGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147401170 17:40180856-40180878 CAAGGTGCAGGGAGGGAGCCAGG - Intronic
1147452452 17:40514175-40514197 GTGGGAGCACGGAGGGAATCAGG + Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147538371 17:41335355-41335377 CAGGGTGCAGGGCAGGATGCTGG + Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147794731 17:43034312-43034334 CTGGCTGGAAGGAAGGAAGCAGG - Intergenic
1147989583 17:44324667-44324689 CTGGGGGCGGAGACGGAAGCGGG - Intronic
1148000426 17:44384410-44384432 CTGGGTGCAGAACGGGGAGCGGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148213930 17:45824369-45824391 TTGAGTGCAGGGCGTGAAGCTGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148291804 17:46458480-46458502 CTGGGTTCTGGAATGGAAGCTGG + Intergenic
1148313994 17:46676185-46676207 CTGGGTTCTGGAATGGAAGCTGG + Intronic
1148466885 17:47870427-47870449 CTGGGTGGAGAGAAAGAAGCAGG - Intergenic
1148585971 17:48780645-48780667 CTGGGCGGAGGGAGAGAAGGGGG - Intronic
1148690844 17:49525997-49526019 CTGGCCGCAGGGAGGGAGACAGG - Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149871571 17:60186726-60186748 CGGGGTGCAGGGATGTAAGTTGG + Intronic
1150004699 17:61462541-61462563 GAGGGTGCAGGGAGGGGAGAGGG + Intronic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151169753 17:72236614-72236636 GGGGGGGCAGGGAGGGAGGCAGG + Intergenic
1151337788 17:73450261-73450283 CTCTGTGCAGGGGTGGAAGCAGG + Intronic
1151507868 17:74541305-74541327 AAGGGTGCAGGGAGGGCATCCGG + Exonic
1151661547 17:75521767-75521789 CTGGCTGCAGGGAGGTGGGCTGG - Exonic
1151712073 17:75812697-75812719 GTGGGTGTAGGGTGGGATGCGGG - Intronic
1151813641 17:76460063-76460085 CTGGATGCAGAGGGGGAAGGGGG - Intronic
1151833272 17:76568304-76568326 CTGGCAGGAGGGAGGGAAGGGGG + Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151893289 17:76963784-76963806 AGGGGAGCAGGGAGAGAAGCCGG - Intergenic
1151975439 17:77481440-77481462 CTGGGTGCAGGGCGGGTGCCTGG - Intronic
1152039268 17:77892484-77892506 GTGGGTGCAGGGTGGGGAGCAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152227695 17:79100213-79100235 TTGGGTGCAGAGTGGGCAGCTGG + Intronic
1152296395 17:79469620-79469642 GTGGGTGGAGGGAGGGAGTCTGG - Intronic
1152390477 17:80001220-80001242 CTGGGTGCAGGCGGAGCAGCTGG + Intronic
1152734544 17:81991014-81991036 CTGGGAGCAGGAAGAGAACCGGG + Intronic
1152888003 17:82863836-82863858 ATGGGGGCAGAGAGGGTAGCAGG + Intronic
1152909991 17:82997882-82997904 GTGGGTGGTGGGAGGGAAGTAGG + Intronic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1152942515 17:83180382-83180404 CTGGAGGCAGTGAGGGCAGCAGG + Intergenic
1154170823 18:12048700-12048722 CTGGCTACAGGAAGGGAAGAAGG - Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155032783 18:21998760-21998782 CTGGGTGTAGGGATGGCAGGGGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155493184 18:26419412-26419434 CCGGCTGCAGGGAGGGACCCTGG + Intergenic
1156458593 18:37308518-37308540 CTGGGGGCAGGGAGATCAGCCGG - Intronic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156895327 18:42239729-42239751 CTGGGTAGAGAGAGGCAAGCGGG - Intergenic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1157815347 18:50725943-50725965 ATGGCTGCAGGGAGCAAAGCCGG - Exonic
1158653097 18:59305216-59305238 CAGGGAGCAGGGAACGAAGCAGG + Intronic
1159497324 18:69222902-69222924 ATTGGTGCAGCAAGGGAAGCTGG + Intergenic
1160013624 18:75125082-75125104 CTGAGTGCAGAGGGGAAAGCTGG - Intergenic
1160517424 18:79486392-79486414 CTGCGGACAGGGCGGGAAGCCGG - Exonic
1160625535 18:80201828-80201850 CAGGGTGCTGGGTGGGAGGCGGG - Intronic
1160816155 19:1036691-1036713 CAGAGAGCGGGGAGGGAAGCCGG - Intronic
1160869720 19:1271677-1271699 CTGGGACCCGGGACGGAAGCTGG - Intronic
1160894147 19:1394973-1394995 CTGGGCGGAGGGAGGGGAGGTGG - Intronic
1160996583 19:1884960-1884982 CTGGGAGCTGGTTGGGAAGCAGG + Intronic
1161041618 19:2113497-2113519 CTGGGGGCAGCGAGGGCAGCTGG - Intronic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1161251180 19:3281164-3281186 CGGCGAGCAGGGAGGGAAACGGG - Intronic
1161398876 19:4058977-4058999 CTGGGAGCAGGGAGGGTAGGAGG + Intronic
1161590506 19:5127212-5127234 CTGGCCTGAGGGAGGGAAGCGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161724558 19:5921030-5921052 CTGGGTGCAGGGAGGGGGTTTGG + Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162095340 19:8306728-8306750 CCGGGGGCGGGGAAGGAAGCAGG - Intronic
1162345779 19:10117189-10117211 CTGGGCTCAGGGAGGGATGGGGG + Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162392199 19:10396330-10396352 GTGGGCGCAGGGGCGGAAGCTGG - Intronic
1162555527 19:11383631-11383653 CCCGGTGGAGGGAGGGAGGCGGG - Intronic
1162591833 19:11597260-11597282 CTGGGTGCAGGGAGGAAACTCGG + Intronic
1162789875 19:13057291-13057313 GTGCTTGGAGGGAGGGAAGCAGG + Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1162905036 19:13818213-13818235 CTGGCTCCCGGGAGGGAAGGGGG - Intronic
1162930265 19:13953988-13954010 CAGCCTTCAGGGAGGGAAGCAGG + Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1162967748 19:14164086-14164108 CTGGGTGGGGGGTGGGGAGCAGG - Intronic
1163000391 19:14363360-14363382 GAGGGTGCTGGGACGGAAGCGGG - Intergenic
1163238375 19:16043198-16043220 ATGGATGCAGGGAGGGATGGAGG + Intergenic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163593011 19:18204798-18204820 CGGGGCGCAGGGAGGGGAGGGGG - Intergenic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1163829453 19:19540828-19540850 CAGGATGCAGGGAGAAAAGCAGG + Intronic
1163838023 19:19587925-19587947 CTGGGTGAAGGGAGAGGAGGGGG + Intronic
1164609247 19:29621089-29621111 GTGGATGCAGGGAGGCCAGCGGG - Intergenic
1164681005 19:30133745-30133767 CAGGGTGCAGAGAGGTATGCTGG + Intergenic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165279656 19:34785372-34785394 CTGGCTGCAGAGAGGAGAGCAGG - Intergenic
1165807931 19:38593143-38593165 TAGGGAGCAGGGATGGAAGCAGG + Intronic
1165823434 19:38691991-38692013 CTGGCTGCAGGGAGGGGGCCGGG + Intronic
1165926311 19:39328229-39328251 CTGGGTCCCGGGAGGGAAGGAGG - Intergenic
1165994345 19:39833582-39833604 CTGGGTGGGGGGCGGGACGCCGG - Exonic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166239624 19:41481034-41481056 CGGGCTCCAGGGAGGGCAGCTGG + Intergenic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166287259 19:41838808-41838830 CTCGGTGCTGGGAGTGGAGCTGG + Intronic
1166301243 19:41913204-41913226 CGGGGAGCGGGGAGGGAGGCTGG - Intronic
1166329400 19:42069676-42069698 CTGGGTGGAGAAAAGGAAGCCGG + Intronic
1166390513 19:42406646-42406668 TTGGGAGCAGGGAGGGCAGGTGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166730988 19:45058970-45058992 ATGGGTGCAGGGATGGATGAAGG - Intronic
1167095664 19:47373798-47373820 GTGGGTGCAGGGTGGGATTCTGG - Intronic
1167145560 19:47679557-47679579 CAGGCTGCAGGGTGGGCAGCTGG - Exonic
1167172734 19:47843978-47844000 CTGGATGCTGAGAGGGAAGGCGG - Intergenic
1167262900 19:48469151-48469173 CGGAGTGCAGGCAGGGCAGCAGG - Exonic
1167311591 19:48740434-48740456 CTGGGTCCTGGGATGGAAGATGG + Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1167563002 19:50237718-50237740 CTGGGTGCAGGTGGGGACACAGG - Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167870988 19:52370071-52370093 CGGGGTGGAGGGAGCGATGCGGG - Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168584054 19:57578580-57578602 CGGGCTGCAGGGACGCAAGCAGG + Intronic
925120769 2:1416010-1416032 CTTGGGGCATGGATGGAAGCTGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925310007 2:2875486-2875508 CTGGGTCCAGGGAGGTGACCTGG - Intergenic
925346387 2:3174967-3174989 CTGGAGGCAGGTGGGGAAGCAGG + Intergenic
925725423 2:6866118-6866140 CCGGGTGCATGGAGGGGGGCGGG + Intronic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926150000 2:10420172-10420194 CTGGGAGCTGGGAGGGGACCTGG - Intronic
926225680 2:10965355-10965377 CCTGGTGCAGGGAGGGCAGCAGG - Intergenic
926728196 2:16014713-16014735 CTGGCTGCAGTGAGAGAAGATGG - Intergenic
926842774 2:17101010-17101032 ATGGGAGAAGGGAGGGACGCAGG + Intergenic
926980448 2:18561761-18561783 ATGGGTGGAGGGTGGGAAGTGGG - Intronic
927519555 2:23690606-23690628 CCGGGCTCAGGGTGGGAAGCAGG + Intronic
927709045 2:25313985-25314007 CTGGGCGCCGGGAGGCAGGCTGG + Exonic
927754605 2:25698658-25698680 GGGGGTGCAGGGAGTGCAGCTGG + Intergenic
928174469 2:29024461-29024483 AAGGGTGCAGGGAGGGAGGGAGG + Intronic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928449221 2:31364125-31364147 CTGGGTGCAGGGGCGGCTGCAGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929835999 2:45400250-45400272 CTGGGGGCAGGAAGGGCAGGAGG + Intronic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
930087567 2:47508684-47508706 CTGGCTGCAGGGAACGCAGCGGG + Intronic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
930724983 2:54673906-54673928 CTGGGCGCTGGGCGGGAACCTGG + Intergenic
931755975 2:65374928-65374950 CTGGGAGAGGGGAGAGAAGCGGG + Intronic
931771934 2:65504914-65504936 CTGGTTGCAGTGAGGGAAAATGG - Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932718502 2:74120658-74120680 CTGGGTCCAGGCAGGCAAGTGGG - Intergenic
933099994 2:78243063-78243085 CTGGGTGGAGGCTGGGAAGAAGG - Intergenic
933250668 2:80025169-80025191 ATGGGTACAGGGTGGGTAGCGGG + Intronic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934514693 2:94979202-94979224 GTGGGAGGAGGGAGGGAATCAGG + Intergenic
934559692 2:95306760-95306782 CTTGGTGCTGGGAGAGAAGCTGG - Intronic
934576016 2:95402169-95402191 CTGGGCGCAGGTGGGGAAGTGGG - Intergenic
934638193 2:96010026-96010048 CTGGGCGCAGGTGGGGAAGTGGG - Intergenic
934795458 2:97095384-97095406 CTGGGCGCAGGTGGGGAAGTGGG + Intergenic
935225269 2:101047249-101047271 CTGGGAGCAGGGAGGGTAGGGGG - Intronic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935626249 2:105174492-105174514 ATGGGGGCTGGGAGGGAAGGAGG + Intergenic
935953161 2:108349414-108349436 ATGGATGCAGGGATGGATGCAGG + Intergenic
935979619 2:108613883-108613905 CTGACAGCAGGGAGGGGAGCAGG - Intronic
936275049 2:111088631-111088653 TAGGGTGCAGGGTGGGAAGAGGG + Intronic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
936568322 2:113596588-113596610 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937231030 2:120398359-120398381 CTGGGGCCAGGATGGGAAGCAGG + Intergenic
937583383 2:123516610-123516632 TTGGATGCAGAGAGGGAAGGGGG - Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
937768811 2:125694923-125694945 CTGGCTGCAGGGAGAGAAGAAGG + Intergenic
937950840 2:127387350-127387372 CTGGGCGCCGGGAGGGGGGCTGG - Intronic
937977927 2:127593036-127593058 CTGGGGCCGGGGAGGGCAGCGGG - Intronic
938026468 2:127953385-127953407 CTGGGAACAGGGATGGAATCGGG - Intronic
938229703 2:129647740-129647762 GTGGGAGAAGGCAGGGAAGCAGG + Intergenic
938262497 2:129905747-129905769 CTGGATGCAGGGATTGAAGCTGG - Intergenic
938285880 2:130116483-130116505 GTGGGAGGAGGGAAGGAAGCAGG - Intronic
938429725 2:131222419-131222441 GTGGGAGGAGGGAAGGAAGCAGG + Intronic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938722202 2:134076743-134076765 CTGGCTGCAGTGGGGGAGGCAGG - Intergenic
939121673 2:138125009-138125031 CTGGGTGCAGGAAGGGGATCTGG - Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
939875946 2:147577920-147577942 CTTGGTGGAGGGATGGAAGTAGG - Intergenic
941677118 2:168355720-168355742 CTGGGTGCAGGGTGAGAAGATGG - Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
941987421 2:171522756-171522778 GGGGGTGCGGGGAGGAAAGCGGG + Intronic
943585566 2:189735224-189735246 CAGGGTCCAGAGAGTGAAGCAGG - Intronic
944163029 2:196686745-196686767 GTGGGTGGAGGGAGAGAATCAGG - Intronic
945033515 2:205685675-205685697 CCCGGGGCAGGGAGGGAGGCAGG - Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945541897 2:211098269-211098291 GTGGGTGGAGGGAGGGAGGGAGG - Intergenic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946434265 2:219641553-219641575 CAGGGAGCAGGGAGGGCTGCAGG + Intronic
946452852 2:219795797-219795819 CTGGGTCCAGGGAGGGGATCAGG + Intergenic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948423219 2:237873109-237873131 CTGGCTGGTGGGAGGGGAGCAGG + Intronic
948536115 2:238648787-238648809 CTGGGTGCAGGAATGGGAGATGG - Intergenic
948859407 2:240745651-240745673 CTGGGTGCTGGGCAGGGAGCAGG - Intronic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
949050398 2:241894785-241894807 CAGGGTGCAGGGAGGCAGGCGGG - Intronic
1168844450 20:934377-934399 CAGGGTCCAGGGAGAGAAGAGGG - Intergenic
1168937239 20:1675966-1675988 AGGGAGGCAGGGAGGGAAGCAGG - Intergenic
1169040833 20:2494019-2494041 CTGGCTGCAGGGAAACAAGCTGG - Exonic
1169080671 20:2796273-2796295 CAGGGTTCATGGAGGGCAGCAGG + Exonic
1169189623 20:3649950-3649972 CTGTGTGCAGGGATGGCAGGAGG - Exonic
1169214502 20:3785518-3785540 CACGGTGCCGGGAGGGAAGAAGG + Exonic
1169819249 20:9690623-9690645 CTAGATCCAGGGTGGGAAGCAGG - Intronic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170940962 20:20847832-20847854 ATGGATGCAGGGATGGGAGCCGG + Intergenic
1171188465 20:23141147-23141169 TCTGGTGCGGGGAGGGAAGCTGG - Intergenic
1171214160 20:23340115-23340137 CTGGGAGCAGGAAGGGATACTGG + Intergenic
1171398909 20:24859091-24859113 TTGGGTGCATGGAGGCCAGCTGG + Intergenic
1171456631 20:25276146-25276168 CTGGGAACATGGAGGGTAGCAGG + Intronic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1172687787 20:36770021-36770043 TGGGGTGCAGGGAGGGAGGAGGG + Intronic
1172694270 20:36811202-36811224 CTGAGTTCAGGGAGGAAACCAGG - Intronic
1172768114 20:37361789-37361811 CTGTGTGCAGGTAGAGATGCCGG + Intronic
1172768129 20:37361889-37361911 CTGTGTGCAGGTAGAGATGCCGG + Intronic
1172768134 20:37361917-37361939 CTGTGTGCAGGTAGAGATGCCGG + Intronic
1172768143 20:37361981-37362003 CTGTGTGCAGGTAGAGATGCTGG + Intronic
1173104868 20:40124254-40124276 CTGAGTGCAGGGAGTGGTGCTGG - Intergenic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173494987 20:43512163-43512185 AGGGGTGCAGGAAAGGAAGCAGG + Intronic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173586642 20:44187492-44187514 CTGCGCGCAGGGAGGGCACCGGG + Exonic
1173851074 20:46218728-46218750 TTGGAAGCAGGGAGGGCAGCAGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174180666 20:48672419-48672441 CTGGCAGCAGGGAGGGCAGTAGG - Intronic
1174777712 20:53361055-53361077 CTGGGGGCTGGGCGGGCAGCGGG - Intronic
1174799717 20:53553226-53553248 CTGGGTGCAGGGTTGGAACTTGG + Intergenic
1174882248 20:54292655-54292677 ATGGGGGCAGGGAGGGATGGAGG + Intergenic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175084216 20:56445335-56445357 CTGGGCTGAGGCAGGGAAGCAGG - Intronic
1175117256 20:56691370-56691392 CTGGGGGCAGGGAAAGGAGCTGG - Intergenic
1175159292 20:56995913-56995935 CTGGGTGAAGCCAGAGAAGCAGG + Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175369998 20:58481764-58481786 CTGGGTGGAACGAGGGAGGCTGG - Intronic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175418284 20:58815954-58815976 CTGGGGGCAGTGAGGGCTGCAGG + Intergenic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175528833 20:59659997-59660019 CTGGGGGCAGGGAAGACAGCTGG - Intronic
1175625193 20:60483892-60483914 CTGGGAGCAGGAGAGGAAGCAGG + Intergenic
1175802782 20:61810592-61810614 ATGGGAGCAGGGCGGGAGGCAGG - Intronic
1175812381 20:61865152-61865174 CCGGATGCAGCGAGGGATGCAGG - Intronic
1175845042 20:62053739-62053761 CTGGGGGCAGGGTGGGATACGGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176141370 20:63546536-63546558 CTGGGTGAAGGCAGGTGAGCAGG - Intronic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1178520997 21:33288489-33288511 CTAGGTGCAGAGAGGGATACTGG - Intronic
1178605129 21:34029688-34029710 CTGGCTGCAGGAAGCAAAGCTGG + Intergenic
1178641584 21:34348897-34348919 GTGGGAGGAGGGAGGGGAGCAGG + Intergenic
1178685730 21:34709223-34709245 ATGGGTGCTGGGAAGGCAGCAGG - Intronic
1179262769 21:39773108-39773130 GTGGGAGGAGGGAGAGAAGCAGG - Intronic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1179883948 21:44305529-44305551 ATGGGTGCTGGGAGGGAGGCAGG + Intronic
1179948552 21:44697001-44697023 CTGGGTGCTGGATGGGAAGGAGG - Intronic
1179948580 21:44697120-44697142 CTGGGTGCTGGATGGGAAGGAGG - Intronic
1180044539 21:45298735-45298757 CTGGGTGGAGACTGGGAAGCAGG + Intergenic
1180060045 21:45380199-45380221 CTGTGTGCATGGATGGACGCTGG - Intergenic
1180569792 22:16704184-16704206 GTGGCTGCAGGGTGGGAAGGAGG - Intergenic
1181429938 22:22873114-22873136 CTCAGTGCAGGGAGTGATGCAGG + Intronic
1181435988 22:22911159-22911181 CTGGGTGCAGGGAGAAGGGCTGG - Intergenic
1181469194 22:23127531-23127553 CTGGGTCCATCGAAGGAAGCTGG + Intronic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181532982 22:23527649-23527671 CTGGGTGGAGGGAGGGAGTGAGG + Intergenic
1181545212 22:23598609-23598631 CTAGGAGGAGGGAGGGCAGCTGG - Intergenic
1181662447 22:24362244-24362266 GTGGGGGCTGGCAGGGAAGCAGG + Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181801313 22:25349331-25349353 CTAGGAGGAGGGAGGGCAGCTGG + Intergenic
1181815098 22:25431272-25431294 CTAGGAGGAGGGAGGGCAGCTGG + Intergenic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1182093162 22:27609599-27609621 CTGGGGGAAGGGACGGGAGCGGG - Intergenic
1182360789 22:29745264-29745286 CTTGGGGCAGGGAGGACAGCAGG + Intronic
1182619896 22:31613274-31613296 TTGGGTGGAGGGAGGGCACCTGG + Intronic
1182696112 22:32200314-32200336 CTGGGTGCAGGGAGAAGGGCTGG - Intronic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1183362081 22:37387967-37387989 CTGGGAACTGGGAGAGAAGCAGG - Intronic
1183408209 22:37640531-37640553 CTGGGTCCAGGGAGGGGACTGGG + Intronic
1183458611 22:37936243-37936265 CTGGGGGCAGGGAGCCCAGCAGG - Intronic
1183574945 22:38682110-38682132 CGGGGTGCAGAGCGGGAAGCGGG + Intronic
1183737218 22:39650744-39650766 CTGGGAGCAGGGAGGACAGGAGG + Intronic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1183754394 22:39746727-39746749 CAGGGTGCTGGGAGGCCAGCAGG + Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1183968785 22:41460239-41460261 CTGGGTGAAGGGAGAGGAGGGGG + Exonic
1184592361 22:45493563-45493585 CAGGGAGCTGGGAGGGCAGCTGG + Intergenic
1184607381 22:45581883-45581905 CAGGGTGCAGGGAGGGTCGAGGG + Intronic
1184642397 22:45879488-45879510 TAGGGAGGAGGGAGGGAAGCAGG - Intergenic
1184670008 22:46007443-46007465 CTGGGAGCAGGGGGAGATGCCGG - Intergenic
1184717602 22:46290790-46290812 CTAAGTGGAGGGAGGCAAGCTGG - Intronic
1184743442 22:46442480-46442502 CTGGGGGCAGGGAGGGGCCCTGG - Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184763723 22:46560927-46560949 TTGTGTGCAGGGAGAGGAGCTGG + Intergenic
1185050883 22:48553418-48553440 TAGGATGGAGGGAGGGAAGCAGG + Intronic
1185151615 22:49167146-49167168 AGGGGTGGAGGGAGGGAAGAAGG - Intergenic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185398033 22:50602412-50602434 CTGGGTGCTGGGAGTGGAACAGG + Intronic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950526888 3:13529459-13529481 ATGGGTGCAGGAATGGAAGGAGG - Intergenic
950545600 3:13636309-13636331 GTGTGTGCAGGGAGGCACGCGGG + Intronic
950563347 3:13748839-13748861 CGGGGTGCAGGGAGGGGTGGGGG + Intergenic
950565463 3:13767308-13767330 CGAGGTGCAGGGGGAGAAGCGGG - Intergenic
950838396 3:15942616-15942638 CTGGCTGCAGGGAGTGCTGCTGG + Intergenic
950974121 3:17222417-17222439 TTGGGAGCGGGGAGGGTAGCAGG + Intronic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952449062 3:33413763-33413785 GTGGGTGCAGGTAAGGAAGATGG - Intronic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953191379 3:40691086-40691108 CTGGGAGCGGGGATGGAAGGAGG - Intergenic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
953773612 3:45797165-45797187 CTGGGTCCGGGGACGGAATCAGG + Intergenic
954304648 3:49719189-49719211 CTAGGTGCAGGGCGCGCAGCTGG + Exonic
954363270 3:50133598-50133620 GTGGGGGCAGGGAGGGGTGCTGG - Intergenic
954426816 3:50447717-50447739 CAGGGTGCAGGCAGGAAACCTGG - Intronic
954462988 3:50638264-50638286 CCCGGTGCAGGGAGGGAGGATGG + Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
955276954 3:57555953-57555975 CCGGGCGCAGGGAGGAGAGCTGG + Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955967839 3:64407214-64407236 CTGGGTGCAGCAGGGGAAGGCGG - Intronic
956391028 3:68772701-68772723 ATGGGTAGAGGGAGGGGAGCTGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956770665 3:72523230-72523252 TTGGGGGCTGGGTGGGAAGCAGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
960404893 3:117247689-117247711 CTGGGAGCAGGGCATGAAGCTGG + Intergenic
960499726 3:118422693-118422715 CTTGGGGCGGGGAGTGAAGCTGG - Intergenic
960689593 3:120331590-120331612 CTGGGTGCAAAGAGGTAACCAGG + Intronic
961330637 3:126135947-126135969 CTGGGTGTGGTGAGGGGAGCCGG + Intronic
961492147 3:127263620-127263642 CTGGGTGGGGGGTGGGCAGCTGG - Intergenic
961554431 3:127688496-127688518 CTGGGTGCAGGAGAGAAAGCGGG + Intergenic
962378640 3:134879098-134879120 CTGGGTGCAGGAAGGGAGTCAGG - Intronic
962461841 3:135621384-135621406 CTGGCTGCAGCAGGGGAAGCAGG + Intergenic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963119415 3:141763607-141763629 TTGGGGGCAGGGAGGGGTGCTGG - Intergenic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
963516080 3:146309866-146309888 CTGGGTGCAGGGAGAGGAAATGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
964310964 3:155391897-155391919 CTGCATGCAGGGAGTGAAGTAGG - Intronic
964760492 3:160131033-160131055 AAGGGTCCAGGGAAGGAAGCAGG - Intergenic
964808036 3:160633024-160633046 TTGGGTGCAGGAAAGGAAGCAGG - Intergenic
964868446 3:161287548-161287570 GAGGGTGGAGGGTGGGAAGCAGG + Intergenic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965404093 3:168249436-168249458 CTGGGGGCTGGAAGGGCAGCTGG - Intergenic
966440849 3:179942580-179942602 CTGGGTCGAGAGAGGGAATCCGG - Intronic
966501400 3:180645362-180645384 CTGGGTTCTGGGTGGGAAGAGGG - Intronic
966721230 3:183064500-183064522 CGGGGTGCAGGCAGGGGCGCGGG - Intronic
966767992 3:183479417-183479439 AAGGGTGGAGGGAGGGCAGCGGG - Intergenic
967130807 3:186469195-186469217 CTTGCAGCAGGGAGGGAAGATGG - Intergenic
967300404 3:188006893-188006915 CTGGGTGCAGGCCCAGAAGCAGG + Intergenic
967421517 3:189278316-189278338 CTGGGTGGAGAGAGAGCAGCAGG + Intronic
967962820 3:194939399-194939421 CTGGGTGCAGGGGAGGTAGAGGG + Intergenic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
968756247 4:2417873-2417895 CCTGGTGCAGGGAGGGGAGACGG + Intronic
968890690 4:3367005-3367027 CTGGGTCCAGCCAGGGCAGCAGG - Intronic
969307994 4:6336547-6336569 CTGGGTACAGGCAGGGCCGCAGG + Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969566461 4:7981696-7981718 CTCGGTACAGGGAGGGGACCAGG - Intronic
969674186 4:8606137-8606159 CAGGGTTCATGGAGGGCAGCAGG - Exonic
970205522 4:13651878-13651900 CTGGGTGCAAGGAGGAATTCTGG - Intergenic
971274531 4:25183233-25183255 CTGGGGGCAGGGACAGATGCAGG - Intronic
972028517 4:34419623-34419645 ATGAGTGCTGGGAGTGAAGCAGG - Intergenic
972258161 4:37381289-37381311 CTGGGTGGAGTGAGTGAAGGTGG + Intronic
972276269 4:37560676-37560698 CTAGATGCAGGGAGGGAAGCTGG - Intronic
972456808 4:39263213-39263235 CTGAGTGCAAGGAGGTAAGGAGG - Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
973619442 4:52712442-52712464 CGCGGGGCGGGGAGGGAAGCAGG - Intergenic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
976162150 4:82213855-82213877 TGTGGGGCAGGGAGGGAAGCAGG - Intergenic
977671099 4:99696614-99696636 GTGGGTGCAGGGAGGGGTGAAGG - Intergenic
978072688 4:104491800-104491822 CATGGTGCAGGGGGGGAAGAAGG + Exonic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979842423 4:125460415-125460437 GTGGGAGGAGGGAGGGGAGCAGG - Intronic
981354651 4:143774397-143774419 GGGGGTGCAGGGGGGAAAGCTGG + Intergenic
982053276 4:151524811-151524833 TTGGGGGCAGGGAGGACAGCAGG + Intronic
982054684 4:151536444-151536466 ATGGGGGCAGGGAGGGCAGGAGG - Intronic
982131331 4:152231222-152231244 ATGGGGGCAAGGAGGAAAGCAGG - Intergenic
982334577 4:154219921-154219943 GTGGGAGGAGGGAGGGAAGGAGG - Intergenic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
983296214 4:165872603-165872625 GTGGGCGCAGGAAGGGAAGCTGG - Intergenic
983554907 4:169051331-169051353 TTTGGTGCAGGGTGGGAAGGGGG - Intergenic
984251697 4:177343518-177343540 CTGGGGGCAGGGGAGGGAGCTGG + Intronic
984508698 4:180653356-180653378 GTGGGTGGAGGGTGGGAAGAGGG + Intergenic
985487543 5:159895-159917 CTGGAGGCCGGGAAGGAAGCGGG - Intronic
985493693 5:193181-193203 ATGGGTGCTGGGAGGGAGCCTGG + Intronic
985638757 5:1053254-1053276 GTGGGTGCTGGGAGTGAGGCTGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986230504 5:5860408-5860430 CAGGGTCCAAGGAGGGAAACAGG + Intergenic
986391892 5:7294779-7294801 CTAGGTCCAGGGAGGACAGCTGG - Intergenic
986728442 5:10617602-10617624 CTGGCTGCTGGGTGGGAAACAGG - Intronic
986831821 5:11588883-11588905 CGTGGTGCAGGGAGGGAGGAGGG - Intronic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987283456 5:16434699-16434721 CTGGGAGGGGTGAGGGAAGCAGG + Intergenic
989085693 5:37673749-37673771 ATGGGTGAAGGGAGAGAATCGGG - Intronic
989773048 5:45167959-45167981 GTAGGTGAAGGGAGGGAGGCAGG - Intergenic
990752369 5:59030981-59031003 ATGGGTGCAGGGAGAGCATCAGG - Intronic
991676605 5:69094457-69094479 CTGCGCGCAGGGAGGCAGGCAGG - Intronic
992528034 5:77630388-77630410 CTGGGGCCGGGGAGGGAGGCGGG + Exonic
994613797 5:102078352-102078374 ATGCCTGCATGGAGGGAAGCAGG + Intergenic
996739661 5:126787310-126787332 CTAAGTGCAGGGAGGTAAGTAGG + Intronic
996831269 5:127743160-127743182 CTTGGTGGTTGGAGGGAAGCGGG - Intergenic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
997344414 5:133176347-133176369 CTGGGGGCACGGGGGGTAGCGGG - Intergenic
997442633 5:133919349-133919371 CTGGGTGCAGGGCTCCAAGCAGG + Intergenic
997976724 5:138445445-138445467 CTGGGTGCAGGGAGAAAAGGAGG - Intronic
998410050 5:141902994-141903016 CTGGCTACAAGGAGGGAAGGGGG - Intergenic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998957748 5:147454206-147454228 GCGGGTGCCGGGAGGGAAGCCGG - Intronic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1001281442 5:170389156-170389178 CACGGGGCAGGGAGGGAGGCAGG - Intronic
1001560813 5:172667877-172667899 GTGGGAGCAAGGAGGGAAGCGGG - Intronic
1001561780 5:172674554-172674576 CTGGGTGCAGCCTGGGAAGTGGG - Intronic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002192378 5:177485034-177485056 CGTGGTGCAGGGAAGGCAGCTGG - Intronic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002433380 5:179217096-179217118 TTGGGTGGAGTGAGGGGAGCTGG + Intronic
1002461971 5:179378382-179378404 CTGGGTGCAGGGATAGGAGTTGG - Intergenic
1002518736 5:179778251-179778273 CTGGCTGCAGGATGGGAGGCTGG + Intronic
1002896726 6:1383989-1384011 TTGGGGGAAGGGAGGGCAGCGGG + Intergenic
1002898474 6:1392533-1392555 AGGGGAGCAGGGAGGGCAGCTGG - Intronic
1003080054 6:3014502-3014524 GTGGGTGCGAGGAGGAAAGCGGG - Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003127564 6:3367788-3367810 CTGGGTGCATTGATGGAGGCTGG - Intronic
1003390655 6:5710081-5710103 GTGGCTGCAGGGAGGGCTGCTGG - Intronic
1003923455 6:10855495-10855517 CTTGGGGGAGGGCGGGAAGCAGG + Intronic
1004315696 6:14585480-14585502 CTGGGTCCAGGCAGTAAAGCTGG + Intergenic
1005374712 6:25170459-25170481 GTGGGGGCAGTGAGGGGAGCAGG + Intergenic
1005436094 6:25813717-25813739 CTGGGTAGAGGGTGGGAAGAGGG - Intronic
1005826254 6:29633082-29633104 CGGGGAGCCGGGAGGGAAGGAGG + Exonic
1005871112 6:29974998-29975020 CAGGGAGCAGGGAGGGCAACAGG + Intergenic
1005994786 6:30924501-30924523 CTGGGGGCAGGGGGGCAACCAGG - Exonic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006641463 6:35491743-35491765 CTGGGTGGAGGCAGGGATGGGGG + Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1007079656 6:39090434-39090456 AGGAGTGCAGGGAGGGAAGTTGG - Intergenic
1007098886 6:39231133-39231155 CTGGGTACAGGGTGGGTAGGAGG - Intergenic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007375090 6:41451131-41451153 CGGGCAGCAGGCAGGGAAGCAGG + Intergenic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007549958 6:42721663-42721685 CTGGGTGCGGGGAGAGGGGCTGG + Intronic
1007582100 6:42965850-42965872 GTGAGAGCAGGGAGGGAAACTGG + Intronic
1007688296 6:43680546-43680568 ATGGGCCCAGGGAGGGAAACGGG + Intronic
1007916905 6:45569531-45569553 CTGGATGGAGGGAGGGAGACTGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1010659024 6:78547302-78547324 GTGGGAGGAGGGAGAGAAGCAGG - Intergenic
1010676096 6:78745436-78745458 CTGGGGGCAGGGATGGCAGGTGG + Intergenic
1010709091 6:79152022-79152044 TTGGGAGAAGGGAAGGAAGCAGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1013397785 6:109759995-109760017 CAGGGTGCAGGGAGAGTACCAGG + Intronic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1017115932 6:150976243-150976265 CTGGGAGCTGGGAGGGGAGCTGG + Intronic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1018242736 6:161794439-161794461 GGGGGTCCAGGGAGGGAAGAGGG - Intronic
1018669310 6:166166717-166166739 ATGGGTGCCGGGGGGCAAGCCGG - Exonic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018721102 6:166573106-166573128 CCCGGTGCAGGGAGGGCAGGAGG + Intronic
1018741558 6:166732966-166732988 TGGGGTGCAGGGTGGGAGGCAGG + Intronic
1019123834 6:169825927-169825949 CTGAGTGCAGGGAGATAAGCTGG - Intergenic
1019271413 7:151096-151118 CTGGGTCCAGGAAGGGCTGCAGG + Intergenic
1019324643 7:432152-432174 CTGGGTTCAGGGCTGGAAGATGG + Intergenic
1019419796 7:945723-945745 CTGGGAGGAGGGAGGGAAAGAGG - Intronic
1019505464 7:1388339-1388361 CGGGGTCCAGTGAGGGGAGCTGG + Intergenic
1019532536 7:1510973-1510995 CTTGGTCCAGGAAGGGAGGCTGG - Intergenic
1019541967 7:1555641-1555663 CTCGGAGCAGGGAGGGAGCCGGG - Intronic
1019615008 7:1955286-1955308 GTGGGTGCAGGGGCGGCAGCCGG + Intronic
1019670392 7:2274921-2274943 CTTGGTGCAGGCAGGGAGACTGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019801499 7:3091459-3091481 CTGGGTGGTGGGAGGGCTGCTGG + Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1020740708 7:12013246-12013268 TTGGGTGCTGGGAGGAGAGCAGG - Intergenic
1021021026 7:15599225-15599247 CTGGCTGCAGTGAGGCAGGCTGG + Intergenic
1021495763 7:21272999-21273021 CTGGGGGCAGGGAGTCAGGCTGG - Intergenic
1021656874 7:22881620-22881642 CTGGGTGCAGGCAGGGGGGCAGG - Intergenic
1022259548 7:28690982-28691004 CTGGGTGGAGGGAAGGACACAGG + Intronic
1022746538 7:33178488-33178510 CACGGTGCAGGGAGAGAAGTTGG - Intronic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1023768208 7:43531642-43531664 AGGGGTGCAGGGGAGGAAGCTGG - Intronic
1023830540 7:44036653-44036675 CAAGGTGCGGGGAGGGGAGCGGG - Intergenic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1024986930 7:55202336-55202358 CAGGCTGCAGGGTGGGCAGCAGG - Intronic
1025179444 7:56817512-56817534 CTGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026020235 7:66700119-66700141 TTGGGTGAAGGGAGGGACGGAGG + Intronic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026461769 7:70620857-70620879 CAAGGGGCAGGGAGGGAAACTGG + Intronic
1026498250 7:70921741-70921763 CTGGGTGCATGGGAAGAAGCCGG + Intergenic
1026535890 7:71238268-71238290 CTGGTTCCAGGGTGGGAGGCAGG + Intronic
1027769996 7:82394314-82394336 CTAGATGAAGGGAGGGAAGAAGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029540380 7:101179288-101179310 CAGGGGACAGGCAGGGAAGCCGG + Intronic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1029740867 7:102490967-102490989 CAAGGTGCGGGGAGGGGAGCGGG - Intronic
1029758861 7:102590140-102590162 CAAGGTGCGGGGAGGGGAGCGGG - Exonic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1031215040 7:118879555-118879577 CTGGCCTCAGGGAGGGAATCTGG + Intergenic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032198878 7:129805261-129805283 GTGGGTGCAGGGGGAGAGGCAGG - Intergenic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032201414 7:129825444-129825466 CTGGGTAAAGGGAGGGCACCCGG - Intergenic
1032202063 7:129829119-129829141 CTTGGTTCTGGGTGGGAAGCGGG + Intergenic
1032395819 7:131588885-131588907 CTGGGTGCAGGCAGGGTGGCAGG - Intergenic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033385885 7:140874661-140874683 CTGAGAGCAGGGAGAGAACCAGG + Intronic
1033463170 7:141565687-141565709 CTGGATGCAGGGAATGAAGGAGG - Intronic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034266886 7:149785411-149785433 CTGGATCCAGGGAAGGCAGCTGG - Intergenic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034339031 7:150340697-150340719 CTGGGGGGAGGGTGGGGAGCGGG + Exonic
1034368166 7:150569988-150570010 CAGGCTGCAGGGAGGTTAGCAGG + Intronic
1034394083 7:150807022-150807044 CTGGGAGAAGGGGAGGAAGCAGG - Intergenic
1034395371 7:150820338-150820360 GTGGCTGCAGGGAGAGAAGCTGG + Intergenic
1034410987 7:150942133-150942155 CTGGGAGCAGGAACAGAAGCAGG - Intergenic
1034450249 7:151133427-151133449 CCGAGTGCAGGGAGGGAGGGTGG - Intronic
1034513337 7:151553709-151553731 CTGGGTGCAGGCAGAGGAGCAGG + Intergenic
1034531292 7:151697705-151697727 CTGGGTGCAGGGAGGGGGTGTGG + Intronic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1035178914 7:157075242-157075264 GGGGGTACAGGGAGGGAAGGAGG - Intergenic
1035187531 7:157138534-157138556 CGGGGTGCAGGGTGGGGTGCAGG - Intergenic
1035283358 7:157791570-157791592 GTGGGTGCAGGGAGGGGGGGCGG - Intronic
1035567312 8:650174-650196 CTGAGTGCAGAGAGGAACGCGGG - Intronic
1035785504 8:2256847-2256869 CAGAGAGCAGGGTGGGAAGCAGG + Intergenic
1035807304 8:2464869-2464891 CAGAGAGCAGGGTGGGAAGCAGG - Intergenic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036656588 8:10681159-10681181 CTTGGCGCAGGGAGGGAAGGTGG + Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038581015 8:28749487-28749509 CTGGCTCCATGGAGGGGAGCAGG - Intronic
1038612649 8:29069962-29069984 CTGGGACCAGGGTGGGAGGCTGG + Exonic
1038612669 8:29070014-29070036 CTGGGACCAGGGTGGGAGGCTGG + Exonic
1039804685 8:40987893-40987915 CTGGGTGCAGAGAGATAAGGGGG - Intergenic
1039941916 8:42098508-42098530 CTGGGTGCAGGGAGGGGGATAGG - Intergenic
1040581226 8:48700060-48700082 CTGGGTGCAGTGTGGGCATCAGG + Intergenic
1040901294 8:52419625-52419647 CTGGGTGCAGGGAGAAAAGAAGG - Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041172389 8:55157665-55157687 GAGGGTGCAGGGTGGGAAGAGGG - Intronic
1041202012 8:55458834-55458856 ATGGGTGCAGGATGGGGAGCAGG + Intronic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041467120 8:58168001-58168023 CTGGGTGGGGGGTGGGGAGCTGG - Intronic
1042865016 8:73349395-73349417 AGGGATGCAGGGAGAGAAGCAGG - Intergenic
1043614762 8:82112310-82112332 CTAGGGACAGGGAGGGAAGGAGG - Intergenic
1043993860 8:86788666-86788688 CTGGCTGCAGGGTGGGGACCAGG + Intergenic
1045856404 8:106770019-106770041 CTGGCTGCCGGGAGGGACCCAGG - Exonic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047397422 8:124514259-124514281 TGGGGAGCAGGGAGGGAAGCGGG + Intronic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048332435 8:133479894-133479916 CTGGCTGCAGGGAAGAAACCAGG + Intronic
1048855745 8:138685293-138685315 CAGGGTGCAGCGGGGGAAGAAGG - Exonic
1048963599 8:139599441-139599463 CTGGGTGCAGTGTGTCAAGCAGG + Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049048750 8:140174232-140174254 GTGGGAGGAGGGAGAGAAGCAGG + Intronic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049231712 8:141488235-141488257 GAGGGAGCAGGGAGGGAAGGAGG - Intergenic
1049312155 8:141938935-141938957 CTAGGTGCTGGGAGGCAGGCCGG + Intergenic
1049418745 8:142507509-142507531 CTGGGGGCAGGGAGAGAGACGGG - Intronic
1049446499 8:142633903-142633925 ATGGCTGCAGGGACGGATGCTGG - Intergenic
1049537187 8:143187899-143187921 CTGCCTGCAGTGAGGGAAGGTGG + Intergenic
1049610741 8:143553634-143553656 CTGGGAGGAGGGAGGGAGGCCGG - Exonic
1049676137 8:143890096-143890118 CTGGTTGCAGGAGGGGATGCAGG - Intergenic
1049884208 9:16937-16959 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
1050584632 9:7097627-7097649 CTGGGTGGAGGTAGGTAACCAGG + Intergenic
1052981224 9:34451181-34451203 CTGGCTGCAGGGAGGGACTCTGG - Intronic
1053107718 9:35426478-35426500 CTTGGTGAAGTGAGGCAAGCTGG - Intergenic
1053283212 9:36834956-36834978 CGGGGCCCAGGGAGGGAAGCAGG - Exonic
1055512806 9:77012149-77012171 GCGGGCGCCGGGAGGGAAGCCGG - Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056075258 9:83031854-83031876 ATGGGGGCAGGGATGGAAGGTGG - Intronic
1056232386 9:84559836-84559858 TGGGGTGCAGGCAGGGAAGGAGG - Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1056798537 9:89675471-89675493 CTGGGCACAGGGATGTAAGCCGG + Intergenic
1056939843 9:90945816-90945838 TTGGGTGGAGGGATGGAAGGAGG - Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1058073556 9:100626970-100626992 CTGGGTACAGGGTAGGAAGAGGG - Intergenic
1058431745 9:104926768-104926790 CTGGGCGCAGATGGGGAAGCTGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059436791 9:114282000-114282022 CTGGGTGCAGGGGTGGATGGCGG - Intronic
1059730291 9:117050457-117050479 CTGGGAGCAGGGGAGGAAGCAGG - Intronic
1060277623 9:122193862-122193884 AGGGGAGCTGGGAGGGAAGCGGG + Intronic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1061211876 9:129198374-129198396 GTGGGTGCAGGGAGAGACGCTGG + Intergenic
1061273079 9:129554860-129554882 CTGGGCTCAAGGAAGGAAGCAGG - Intergenic
1061450790 9:130665995-130666017 CTGGGAGCAGAGAGGGACTCGGG + Intronic
1061620186 9:131806875-131806897 CTGGGTCCTGTGAGGGCAGCTGG + Intergenic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1062030826 9:134361219-134361241 CTCGGAGCTGGGAGGGAACCTGG + Intronic
1062114929 9:134803250-134803272 CTGGGAGCAGGGCTGGCAGCTGG - Intronic
1062161823 9:135084776-135084798 GTGGCTGCTTGGAGGGAAGCAGG - Intronic
1062170816 9:135133701-135133723 CAGGGTGCAGGGAGGGTGACTGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062193083 9:135257605-135257627 CTGGGTGCAGGCAAGGAACATGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062272026 9:135714151-135714173 CTGGGGACGGGGAGGGGAGCTGG + Intronic
1062305752 9:135906667-135906689 CTGGGCGCAGGGAGGGACCATGG - Intronic
1062350774 9:136137647-136137669 CTGGGTGCAGGGTGCCCAGCTGG + Intergenic
1062436888 9:136550384-136550406 CTGGGTCCAGGGAGGGTACCAGG - Intergenic
1062447305 9:136600314-136600336 CTGGGGGCAGGGAGGGCCGGGGG + Intergenic
1062538219 9:137030198-137030220 CTGGGCTCAGGGAGGGAGGGCGG - Exonic
1062549089 9:137077808-137077830 CTGGGAGGAGGAAGGTAAGCGGG + Exonic
1062554097 9:137106286-137106308 GTGGATCCAGGGCGGGAAGCAGG + Exonic
1062722176 9:138050253-138050275 CTGGGAGCGGGGCGGGGAGCTGG + Intronic
1062723763 9:138059379-138059401 CTAGGTCCTGGGAGGGAGGCAGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203772144 EBV:54832-54854 CTGGCAGCAGGGAGGCCAGCAGG + Intergenic
1186367390 X:8909871-8909893 ATGGGAGGAGGGAAGGAAGCTGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186664393 X:11703359-11703381 CTGGGTGCAGGAGGGCAAGTGGG - Intergenic
1187018019 X:15349989-15350011 CTCGGGGCAGGGAAGGAGGCAGG - Intronic
1187586780 X:20671742-20671764 CTGGGAGGAGGGAGAGGAGCAGG - Intergenic
1188005842 X:25015346-25015368 CTGGAAGCAGGGAGGGAGGGAGG + Intronic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189446372 X:41085212-41085234 CGGGGTGGAGGGAGAGAAGAGGG + Intergenic
1189487629 X:41445413-41445435 CTTGCTGCAGGGAGAAAAGCAGG - Intergenic
1189545622 X:42039812-42039834 GTGGGAGGAGGGAGAGAAGCAGG - Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190034484 X:47008761-47008783 CTGGGAGGAGACAGGGAAGCAGG + Intronic
1190109047 X:47578194-47578216 TTGGGTGAGGGGAGGGAACCTGG - Intronic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1192035363 X:67557136-67557158 GTGGGAGCAAGGGGGGAAGCAGG + Intronic
1192326021 X:70133246-70133268 CTAAGTGCACGAAGGGAAGCCGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1196974183 X:121140665-121140687 CTTGAAGCAGGGAGGGAGGCTGG + Intergenic
1196982029 X:121225112-121225134 GTGGGTGAAGGGAGAGAATCAGG - Intergenic
1197239024 X:124103563-124103585 TTGGGGGCAGGGTGGGAAGGGGG - Intronic
1197728276 X:129790921-129790943 CTGCCTGCAGGGAGGGTAGGCGG - Exonic
1198216510 X:134560266-134560288 GTGGGTGGTGGGAGGGAACCGGG - Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199298662 X:146187363-146187385 TGGGGTGGAGGGAGGGAAGGGGG - Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1200401595 X:156023219-156023241 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
1200683629 Y:6242442-6242464 ATGTGTCCAGGGAGGGAACCTGG - Intergenic
1200686212 Y:6262734-6262756 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200831884 Y:7693362-7693384 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1200989094 Y:9333650-9333672 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200991751 Y:9353980-9354002 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200994405 Y:9374260-9374282 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1200997068 Y:9394606-9394628 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200999584 Y:9463144-9463166 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201002242 Y:9483452-9483474 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1201004901 Y:9503739-9503761 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201007559 Y:9524066-9524088 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1201010190 Y:9544256-9544278 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201049006 Y:9911944-9911966 ATGTGTCCAGGGAGGGAACCTGG + Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic
1202115011 Y:21464337-21464359 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202119242 Y:21507662-21507684 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202121694 Y:21531202-21531224 GTGTGTCCAGGGAGGGAACCTGG - Intronic
1202157311 Y:21898180-21898202 GTGTGTCCAGGGAGGGAACCTGG + Intronic
1202159758 Y:21921721-21921743 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1202378467 Y:24258035-24258057 CTTAGTTCAGGGTGGGAAGCAGG - Intergenic
1202492315 Y:25412086-25412108 CTTAGTTCAGGGTGGGAAGCAGG + Intergenic