ID: 1003116982

View in Genome Browser
Species Human (GRCh38)
Location 6:3289553-3289575
Sequence GGATTTACACGCCTGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003116969_1003116982 18 Left 1003116969 6:3289512-3289534 CCTGGACCTCATGGGCACGTGGT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG 0: 1
1: 0
2: 1
3: 2
4: 111
1003116973_1003116982 12 Left 1003116973 6:3289518-3289540 CCTCATGGGCACGTGGTGGGGAG 0: 1
1: 0
2: 1
3: 21
4: 169
Right 1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG 0: 1
1: 0
2: 1
3: 2
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003116982 Original CRISPR GGATTTACACGCCTGGGCTG GGG Intronic
902865460 1:19274727-19274749 GGATTCAAACTCCTGGGCTCAGG - Intergenic
903772720 1:25774104-25774126 GGATTTATTGGCCTGGGGTGAGG - Intronic
904080364 1:27868804-27868826 GCAGATACACGCCTGGCCTGTGG - Intergenic
910782642 1:90956768-90956790 GGATTTGAACTCCTGGGCTCAGG - Intronic
912476072 1:109935766-109935788 GGTTGTCCAGGCCTGGGCTGGGG + Intergenic
918708788 1:187701902-187701924 GGATTACCACGCCTGGCCAGAGG + Intergenic
921287798 1:213624601-213624623 GGATGGTCAGGCCTGGGCTGGGG + Intergenic
921568609 1:216751491-216751513 GGGTTTGCACAGCTGGGCTGAGG - Intronic
1071733590 10:88272927-88272949 GGATTGAAACTCCAGGGCTGGGG - Intergenic
1072465362 10:95657439-95657461 GGATTTGAACTCCTGGGCTCAGG - Intergenic
1075789548 10:125073920-125073942 CGGTTTCCACGCCTGGGCCGTGG - Intronic
1083959885 11:66008763-66008785 GGTTTTCCACAGCTGGGCTGAGG + Intergenic
1084072375 11:66744793-66744815 GGAGTTCCAAGCCCGGGCTGAGG + Intronic
1085822650 11:79809533-79809555 GCATTTACACGTCTTGGCTCAGG + Intergenic
1090629365 11:128632898-128632920 GGATGTGCACACCTGGCCTGAGG + Intergenic
1101851701 12:108408523-108408545 GGATTCATTGGCCTGGGCTGGGG + Intergenic
1104457203 12:128924823-128924845 TGATTTCCAAGCCTGGGCGGGGG - Intronic
1116890040 14:50259191-50259213 GGATTAAAACTCCTGGGCTCAGG + Intronic
1119174256 14:72557564-72557586 GGAATTAGAGGCCTGGGGTGGGG - Intronic
1120826799 14:88963385-88963407 GGTTTTAAACTCCTGGGCTCAGG - Intergenic
1122130569 14:99602831-99602853 GGATTTCCAAGGCTGGGATGAGG + Intronic
1122814638 14:104306496-104306518 GGATTTTCATGCCTGCACTGGGG + Intergenic
1127760629 15:62135980-62136002 GCATTTACAAGGCTGGCCTGGGG + Intergenic
1134561526 16:15214310-15214332 GGATTCAAACTCCTGGGCTCAGG - Intergenic
1134922063 16:18125936-18125958 GGATTCAAACTCCTGGGCTCAGG - Intergenic
1136775177 16:32867971-32867993 GGAACTAAAGGCCTGGGCTGGGG + Intergenic
1136895440 16:33993541-33993563 GGAACTAAAGGCCTGGGCTGGGG - Intergenic
1137454189 16:48605722-48605744 GTGTTTACACCTCTGGGCTGGGG - Intronic
1138396353 16:56707881-56707903 GGATTTACATGCCTTGCCTTTGG + Intronic
1142177350 16:88651226-88651248 GGAACTCCCCGCCTGGGCTGGGG - Intergenic
1203077595 16_KI270728v1_random:1130080-1130102 GGAACTAAAGGCCTGGGCTGGGG + Intergenic
1143872551 17:9967422-9967444 GGATTGTCACGCCTGGGGAGGGG - Intronic
1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG + Intronic
1146577403 17:34006771-34006793 AGATTTACACTCCTGGGCATAGG + Intronic
1147690852 17:42313519-42313541 GGATTCCCTCGGCTGGGCTGGGG + Exonic
1149050311 17:52296611-52296633 GTATTTCTAAGCCTGGGCTGTGG + Intergenic
1150135460 17:62692769-62692791 GGATCAACAGGCCTGGGCCGGGG - Exonic
1151657573 17:75502903-75502925 GGATCTCCACCGCTGGGCTGTGG + Exonic
1156244825 18:35288142-35288164 GGAATTACACGCTTGGGCCATGG + Intronic
1160903454 19:1440714-1440736 GGAGCTACACACCTGGGCTTGGG - Exonic
1162318994 19:9959839-9959861 GGATTTGCAGAGCTGGGCTGAGG + Exonic
1163767361 19:19170984-19171006 GGATTTAGAGTTCTGGGCTGGGG - Intronic
1163785312 19:19272119-19272141 GGATTTGCCCACCTGGGTTGAGG - Intronic
1164585845 19:29475558-29475580 TGATTTAAACGCCTGGATTGTGG + Intergenic
1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG + Intronic
1167473625 19:49688340-49688362 GGTTTTAGGGGCCTGGGCTGGGG + Exonic
1168008718 19:53512625-53512647 GGATCCCCACCCCTGGGCTGCGG + Intergenic
926387356 2:12349873-12349895 GGATTCACACACATGAGCTGAGG - Intergenic
934518778 2:95006256-95006278 AGGTTTTCAAGCCTGGGCTGGGG + Intergenic
936501569 2:113070757-113070779 GGTTTTTCAGGCCTGGGGTGGGG - Intronic
937066750 2:119023468-119023490 TGATTCACTCTCCTGGGCTGTGG + Intergenic
940951220 2:159676596-159676618 GGACTTGGACGCCTGGGCTCAGG - Intergenic
943121108 2:183737232-183737254 GGTTTCACACTCCTGGGCTCAGG + Intergenic
948494069 2:238334473-238334495 GAATGTACAGGCCTGGCCTGCGG + Intronic
1171071610 20:22074103-22074125 TGATTTAGTAGCCTGGGCTGAGG + Intergenic
1171449326 20:25224970-25224992 GGATTTGCACGCCTGGTGTTAGG - Intronic
1172160080 20:32861680-32861702 GGTTTTGCACTCCTGGGCTCAGG - Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176990086 21:15485162-15485184 GGATTTCCACGCTAGGGCTAAGG - Intergenic
1179788017 21:43740738-43740760 GGTTGTATACACCTGGGCTGAGG + Intronic
1179894083 21:44351676-44351698 GGTTCTGCACCCCTGGGCTGAGG + Intronic
1182794036 22:32977364-32977386 GGATTTCCACACATGGGATGAGG + Intronic
1183065453 22:35359705-35359727 GGAGTTTCACAGCTGGGCTGGGG - Intergenic
1184933017 22:47695466-47695488 GGATTTCCAACCCTGGTCTGGGG + Intergenic
950674316 3:14545398-14545420 GTGTTCACATGCCTGGGCTGTGG - Intergenic
952070613 3:29630672-29630694 GGATTCAAAGGCCTGGGATGGGG - Intronic
954211239 3:49098658-49098680 GGATTTAAGCGCCTGGCTTGGGG - Exonic
954750857 3:52812852-52812874 TGATTTTCACACCTGTGCTGAGG - Intergenic
964739451 3:159950252-159950274 GGCTTTCCAAGCCTGGGGTGAGG - Intergenic
966925464 3:184641767-184641789 TGATCTACCCGCCTTGGCTGTGG + Intronic
982395417 4:154910526-154910548 GGGTATGCACGCCTAGGCTGAGG - Intergenic
985578617 5:685205-685227 GGGTCTCCAGGCCTGGGCTGAGG + Intronic
985720101 5:1484482-1484504 GGATTCACTCGCCTGGCCTCAGG - Intronic
988478702 5:31611192-31611214 GGATTCACATGCCTTGTCTGGGG - Intergenic
1000898970 5:166890399-166890421 GGGATTACAAGCTTGGGCTGAGG - Intergenic
1001379829 5:171297495-171297517 GGAGTTACCAGCCTGGGCTTTGG + Intronic
1002154408 5:177265448-177265470 GGTTTTAGGGGCCTGGGCTGGGG - Intronic
1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG + Intronic
1003995862 6:11538376-11538398 TAATTGACGCGCCTGGGCTGGGG + Intronic
1004188034 6:13438774-13438796 GGATGTTCACCACTGGGCTGGGG - Intronic
1009279027 6:61722977-61722999 GGAATTACAGGCATGAGCTGCGG + Intronic
1013210316 6:107981073-107981095 GGTTTTAAACTCCTGGGCTCAGG + Intergenic
1014950390 6:127547622-127547644 GGACTCAAACTCCTGGGCTGAGG + Intronic
1019938572 7:4271896-4271918 AGATTCACCCACCTGGGCTGAGG + Intergenic
1021022183 7:15615307-15615329 GGATTTAAACGTGAGGGCTGGGG + Intronic
1025279148 7:57614452-57614474 GGATTCCCAAGCCTGGGCTCTGG - Intergenic
1025305583 7:57851048-57851070 GGATTCCCAAGCCTGGGCTCTGG + Intergenic
1026857142 7:73762394-73762416 GGATTTGCAGGCATGGGCAGAGG - Intergenic
1030701630 7:112647169-112647191 GAATCTGCACGTCTGGGCTGGGG + Intergenic
1035726340 8:1826492-1826514 GGAGTTACAGACCTGGGTTGAGG + Intronic
1036460707 8:8950070-8950092 GGTTTTGCACGCATAGGCTGAGG - Intergenic
1036613288 8:10368281-10368303 AGATTTACAAGGCTGGGCAGGGG - Intronic
1036989382 8:13575452-13575474 GGATTCCCACATCTGGGCTGGGG + Intergenic
1037111019 8:15164482-15164504 GGAGTAAAACCCCTGGGCTGGGG - Intronic
1038347469 8:26745447-26745469 GCCTTTACTTGCCTGGGCTGAGG + Intergenic
1042590954 8:70398239-70398261 GGACTTAAACTCCTGGGCTCAGG - Intronic
1042964756 8:74338559-74338581 GCACTTCCACACCTGGGCTGTGG + Intronic
1048795365 8:138144617-138144639 AGATTTAAACGCCTTGGCTGGGG - Intronic
1050266424 9:3895277-3895299 AAATTTACAGGCCTGGCCTGGGG + Intronic
1051639830 9:19214335-19214357 GGACTTAAACTCCTGGGCTCAGG + Intergenic
1052927149 9:34027499-34027521 GGTTTTAAACTCCTGGGCTCAGG - Intronic
1057462489 9:95275800-95275822 GGATTTGAACTCCTGGGCTCAGG - Intronic
1059362458 9:113755688-113755710 CAGTTTACATGCCTGGGCTGCGG - Intergenic
1059536493 9:115085962-115085984 GGCTTCACAGGCCTGGACTGTGG - Exonic
1061431197 9:130532511-130532533 GGATTCAAACGCCTGAGCTCAGG + Intergenic
1188025022 X:25199292-25199314 GGATTTACACCTCTGGGCTGAGG + Intergenic
1195308093 X:103605504-103605526 GGGTTTAGACACCTGGGTTGTGG + Intergenic
1197157860 X:123289774-123289796 GGATTTACATGTCTTGGTTGGGG - Intronic
1200106824 X:153718837-153718859 GGATCTTCCCACCTGGGCTGAGG - Intronic
1200391378 X:155950098-155950120 GGATTTAGGGGTCTGGGCTGAGG + Intergenic
1202026089 Y:20525607-20525629 GGAGTTAAACCCCTTGGCTGGGG + Intergenic