ID: 1003117192

View in Genome Browser
Species Human (GRCh38)
Location 6:3290866-3290888
Sequence GGGAGACTTCCCGAAGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003117185_1003117192 4 Left 1003117185 6:3290839-3290861 CCCCTACTGGGGAGCTAAAAAAG 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1003117181_1003117192 28 Left 1003117181 6:3290815-3290837 CCTGGCATGTCTTCATGGAGTAA 0: 1
1: 0
2: 3
3: 12
4: 151
Right 1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1003117187_1003117192 2 Left 1003117187 6:3290841-3290863 CCTACTGGGGAGCTAAAAAAGAA 0: 1
1: 0
2: 2
3: 24
4: 230
Right 1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1003117186_1003117192 3 Left 1003117186 6:3290840-3290862 CCCTACTGGGGAGCTAAAAAAGA 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003117192 Original CRISPR GGGAGACTTCCCGAAGCGGA GGG Intronic
900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG + Exonic
905690000 1:39936216-39936238 GCAAGACTTCCCGAAGAGGCAGG - Intergenic
913148281 1:116013906-116013928 TGGAGACTTCCAGAAGAGAAAGG - Intronic
920496677 1:206459910-206459932 GGGAGGATTCCCGTAGCGCAAGG - Intronic
921190118 1:212700562-212700584 GGGTGAATTCCCGGAGCGGAGGG + Intergenic
921443596 1:215218302-215218324 TGGAAACTTCCCCAAGAGGATGG + Intronic
921882609 1:220272072-220272094 GGGTGTCATCCCGGAGCGGAGGG + Intronic
1063383295 10:5600304-5600326 GGGTGACTTCCCGAAACACAGGG - Intergenic
1070706992 10:78646966-78646988 GGAAGACTTCCTGGAGGGGATGG - Intergenic
1071640424 10:87301606-87301628 AGGAGCCTTCTCGAAGCGGCGGG + Intergenic
1071654811 10:87436339-87436361 AGGAGCCTTCTCGAAGCGGTGGG - Intergenic
1072272001 10:93785986-93786008 GGGAGATTTGCTGCAGCGGAGGG - Intronic
1079773630 11:24496728-24496750 GAGAGACTTCCAGACGCGTAGGG - Intergenic
1085518109 11:77122987-77123009 GGGATAGTTCCCAAAGCTGAGGG - Intronic
1091679011 12:2512848-2512870 GGGAGATTTCCAGAAGCTGCGGG + Exonic
1095992450 12:48045354-48045376 GCCATACTTCCGGAAGCGGATGG - Exonic
1096771716 12:53939613-53939635 GGGAGACTTCCAGAGGTGGGCGG - Exonic
1100315537 12:93441658-93441680 GGGAGACTTCCGGCCGCGGCGGG - Intronic
1115499293 14:34035193-34035215 GGGAGACTTCCCAAACCAGAGGG + Intronic
1121949837 14:98161983-98162005 GGAAGAATTCCCGAACTGGAGGG + Intergenic
1132462110 16:60635-60657 GGGTGACTTGTAGAAGCGGAGGG - Intronic
1143106906 17:4534620-4534642 GGCAGGCTTCCCGAAGTGCAGGG - Intronic
1143598888 17:7931425-7931447 GGGAAACTTTCTGAAGTGGAAGG - Intronic
1144707977 17:17382304-17382326 GGGGGAATTCCCCAAGAGGAAGG + Intergenic
1148153675 17:45410838-45410860 GGAAGAGTTCCCAAAGAGGAAGG + Intronic
1148797058 17:50201998-50202020 GGGAGACTTCCAAAGGTGGAAGG + Intergenic
1148831012 17:50431437-50431459 GGGAGACTTCCCAAAGAGCCTGG + Intronic
1166326220 19:42052727-42052749 AGGAGGCTTCCCCAAGCGGCTGG - Intronic
933216829 2:79640235-79640257 GGGAGACTTCCTAAAGAGGTTGG + Intronic
936241237 2:110790287-110790309 AGGAGACATCCTGAAGTGGAAGG - Intronic
947863426 2:233379214-233379236 GGAAGACTTCCCGAAGGTGGTGG + Intronic
1179155528 21:38847764-38847786 GGGCGACTTCCAGAAGCTCAGGG - Intergenic
1179891140 21:44335618-44335640 GGGCGGCTTCCAGAAGGGGAGGG - Intronic
1184100963 22:42341641-42341663 GGGAGGCTGGCAGAAGCGGAAGG - Intronic
952521210 3:34159439-34159461 GAGAGACTTCCCGAAGACCAGGG - Intergenic
952538407 3:34338787-34338809 GAAAGACTTCCCCAAGAGGATGG - Intergenic
956410648 3:68974830-68974852 GGAAGACTTCCCTAAACGAATGG + Intergenic
956410661 3:68974923-68974945 GGAAGACTTCCCTAAACGAATGG + Intergenic
959246421 3:103875396-103875418 AGCAGACATCCCAAAGCGGATGG + Intergenic
969452005 4:7279409-7279431 GAGAGCCTTCCTGAACCGGATGG + Intronic
986307514 5:6526543-6526565 GCGAGATTTCCCGAAGTAGAAGG + Intergenic
995498639 5:112778033-112778055 GGGATATTTCCTTAAGCGGAAGG - Intronic
997192802 5:131954776-131954798 GGAAGACTTCCCAAATCAGATGG + Intronic
1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG + Intronic
1006770320 6:36547480-36547502 GCGCGACTTCCCGGAGCGGCCGG + Intergenic
1015876536 6:137828342-137828364 GGGAGACTTCTCTTAGCTGAGGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024360140 7:48459642-48459664 GGGAGACTTCCTGGAGCTTAAGG + Intronic
1029708144 7:102286246-102286268 GGGCGATTTCCCGCACCGGAGGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1033786515 7:144737741-144737763 GGGAGACTTACCAAAGTGTAGGG - Intronic
1034207864 7:149333535-149333557 GTGAGACTCCCAGAAGAGGAAGG + Intergenic
1035686375 8:1526564-1526586 GCGAGACTTCCCGAGGAGGACGG + Intronic
1039829774 8:41203862-41203884 GGGAGTCTTCCTAAAGAGGAAGG - Intergenic
1050426014 9:5513349-5513371 GGGAGACTTCCCAGAGGGGTAGG - Intronic
1192057395 X:67786473-67786495 GGGAGACTGCTCCAAGCAGATGG - Intergenic