ID: 1003117471

View in Genome Browser
Species Human (GRCh38)
Location 6:3292903-3292925
Sequence CTCTGTTGGTGAAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 213}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003117471_1003117487 25 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117487 6:3292951-3292973 CTGCTGACCCGCTGGGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 183
1003117471_1003117478 -9 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117478 6:3292917-3292939 CCAACAGAGGGAGGGAAAGGAGG 0: 1
1: 0
2: 4
3: 74
4: 754
1003117471_1003117481 17 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117481 6:3292943-3292965 TGATGACCCTGCTGACCCGCTGG No data
1003117471_1003117488 30 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117488 6:3292956-3292978 GACCCGCTGGGAGGAGGGCACGG No data
1003117471_1003117486 24 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117486 6:3292950-3292972 CCTGCTGACCCGCTGGGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 247
1003117471_1003117483 21 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117483 6:3292947-3292969 GACCCTGCTGACCCGCTGGGAGG No data
1003117471_1003117482 18 Left 1003117471 6:3292903-3292925 CCAGCTTCTCTTCACCAACAGAG 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1003117482 6:3292944-3292966 GATGACCCTGCTGACCCGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003117471 Original CRISPR CTCTGTTGGTGAAGAGAAGC TGG (reversed) Intronic
900639881 1:3683642-3683664 CTCTCATGGTGAAGAGTACCAGG + Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901369597 1:8785523-8785545 CTCTGTTGGAGAATGGAACCAGG - Intronic
902093329 1:13922078-13922100 ATCTGATGTTGAAGAGAAACTGG + Intergenic
902364628 1:15963908-15963930 CTCTTTTGGTAAAGACAGGCTGG - Intronic
905011883 1:34752871-34752893 CTCTGTTTGAGAAAAGAGGCTGG - Intronic
905641160 1:39590975-39590997 GTTTGTTGCTGAAGATAAGCTGG + Intergenic
906291164 1:44620013-44620035 CTCTGCTGGTGAACAGAAACAGG - Intronic
906953937 1:50357232-50357254 CTGTGTTGGTGACGTGTAGCTGG - Intergenic
907585821 1:55616920-55616942 CTTTGTTGGGGAAGTGAAGTTGG - Intergenic
908903137 1:68979247-68979269 CTCAGTTTCTGAAGAAAAGCAGG - Intergenic
909960496 1:81834972-81834994 CTCTGTTCGTGAAGGGAAAAAGG - Intronic
910842446 1:91573480-91573502 TTCAGATGGAGAAGAGAAGCAGG - Intergenic
912675230 1:111674057-111674079 TTCTGTTGCTGTAGAAAAGCTGG + Intronic
913314906 1:117541316-117541338 CTCTGTTTGTGGAGAAAAGAAGG + Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
913669052 1:121078024-121078046 GTCTGTAGGTGATGTGAAGCAGG - Intergenic
914020797 1:143865429-143865451 GTCTGTAGGTGATGTGAAGCAGG - Intergenic
914659293 1:149773371-149773393 GTCTGTAGGTGATGTGAAGCAGG - Intergenic
915722666 1:157995742-157995764 CCCTGTTGGAGCAGAGAAGTGGG - Intronic
915943683 1:160135060-160135082 CTGCGGTGGTGAAGAGAGGCAGG + Intronic
916217226 1:162407619-162407641 CTGTGTCAGTGAAGACAAGCAGG + Intronic
916405879 1:164497445-164497467 CACTGCTGGTGCTGAGAAGCAGG + Intergenic
917222284 1:172744806-172744828 CTCTGTGGGATAAGTGAAGCAGG - Intergenic
917726328 1:177830748-177830770 TTCTGTTGGGGGAGAGAAACTGG + Intergenic
917743262 1:177982434-177982456 CTCTCTTGGGGAAGGGAGGCAGG + Intronic
917905681 1:179585574-179585596 ATCTGTTGGGGATGAGAATCTGG + Intergenic
922899134 1:229122860-229122882 CTCTGTTGGGGAGCAGATGCTGG - Intergenic
923290243 1:232538338-232538360 CTGTGTTGGAGAAGAGAAGTGGG - Intronic
924055959 1:240124395-240124417 CTCTCTTGGTGAATGGGAGCTGG - Intronic
1063055603 10:2501359-2501381 CTTTGTTGGTGAGGTGAACCGGG - Intergenic
1063055625 10:2501485-2501507 CTTTGTTGGTGAGGTGAAACGGG - Intergenic
1063055647 10:2501611-2501633 CTTTGTTGGTGAGGTGAAACGGG - Intergenic
1066374122 10:34842137-34842159 CTCTACTGGTGAAAAAAAGCTGG + Intergenic
1067005236 10:42654653-42654675 CTGTGCTGGTGAGGTGAAGCAGG - Intergenic
1067026307 10:42846740-42846762 CTCTGATGCTGAGCAGAAGCTGG + Intergenic
1067817558 10:49493842-49493864 CTTTGGTGGTGTAGAGGAGCAGG - Intronic
1068603498 10:58980123-58980145 TTCTGTTAGTGAGGAGAATCTGG + Intergenic
1071145568 10:82566462-82566484 TTCTGTGGGTGAAAAGAAGAAGG + Intronic
1072450449 10:95535357-95535379 CTCTCTAGATAAAGAGAAGCAGG + Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075401096 10:122162423-122162445 CCCTGTGGGTGAAGACAAGCTGG + Intronic
1077635362 11:3838359-3838381 CTCTGATGGTAAAGACAAGATGG - Intronic
1080476316 11:32595177-32595199 CTCAGTGGATGAAGAAAAGCTGG - Intronic
1081950858 11:47041212-47041234 CAGGGTTGGGGAAGAGAAGCTGG + Intronic
1082023065 11:47551367-47551389 CACTGTTGGTAAAGCAAAGCTGG - Intronic
1082175378 11:49052300-49052322 CTTTGTTAGAGAAGATAAGCTGG + Intergenic
1085552878 11:77391237-77391259 CTTTGTTGATGAATAGAAACTGG - Intronic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1088270633 11:108030717-108030739 CTATGTTCGTGAATATAAGCAGG + Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088873372 11:113911898-113911920 CTCTGTGGGTGAAGAGGATGGGG - Intronic
1090227775 11:125081954-125081976 TTCTGTTGGTGATGAGGAGATGG + Intronic
1090357425 11:126149436-126149458 CTCTTTTGGTGAATAGAGTCTGG - Intergenic
1091227350 11:133965490-133965512 CACTGGTGGTGAGGAGAGGCAGG - Intergenic
1092672801 12:10882603-10882625 CTCTGCTGGTGATGGGAACCAGG - Exonic
1093869233 12:24266923-24266945 CAGTGTTGGTGAATAGAAGTAGG - Intergenic
1095255411 12:40029883-40029905 CTCTGTGGGTGAGCAGAGGCAGG - Intronic
1096459150 12:51812574-51812596 CTGTCCTGGTGATGAGAAGCGGG - Exonic
1097954578 12:65470406-65470428 CTCTGGTGTTAAAGAGAAGGGGG - Intronic
1099259445 12:80359246-80359268 CTCTGTTGTAGAGGAGAAGGGGG + Intronic
1099459252 12:82902568-82902590 CTTTGAAGGTGAATAGAAGCAGG - Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1101936664 12:109063679-109063701 ATCTGTTGGTGAGGAGAAACTGG - Intronic
1102427892 12:112858795-112858817 CTCTGGAGGTGGTGAGAAGCAGG - Intronic
1104881488 12:132074275-132074297 TTTTGTTGTTGAAGAGGAGCCGG + Intronic
1107029819 13:35839175-35839197 CTCTGTAGGGGAACAGAAACCGG + Exonic
1107964494 13:45587025-45587047 CTCTGTCGGTGAGGCGCAGCCGG - Intronic
1108286015 13:48908623-48908645 CACTATTGCTGAAGGGAAGCTGG - Intergenic
1110302143 13:73941059-73941081 ATCTTTTGGTGAAGAAAAGTTGG - Intronic
1111131054 13:83976069-83976091 CTTTGTTGGTGTGGAGAAGCTGG - Intergenic
1111500117 13:89107632-89107654 CTCTCTTAGTGAAGTGAAGGAGG - Intergenic
1112677708 13:101722734-101722756 CTCCGTGGCTGAAGAGCAGCAGG - Exonic
1114635194 14:24183235-24183257 CACTGCTGGTGAGGAGAGGCTGG - Exonic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1116883004 14:50190961-50190983 CTCTGGTGGGGAAGAGAAGAGGG - Intronic
1118915116 14:70096239-70096261 CTCTTTTGGTTATAAGAAGCAGG - Intronic
1119594152 14:75918221-75918243 CTCTGTTGCTAAGGAGAAGTAGG - Intronic
1125795467 15:42401336-42401358 CGCTGTTGGTGACTAGAATCTGG - Intronic
1128178567 15:65579841-65579863 CTCTGCAGGTGACCAGAAGCAGG + Intronic
1129780938 15:78270603-78270625 GTCCATGGGTGAAGAGAAGCTGG - Exonic
1130165349 15:81451247-81451269 CTCTGTGGAAGGAGAGAAGCAGG + Intergenic
1132375550 15:101326099-101326121 CTGTGTTGTTAAAGAGAAGTGGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1134629810 16:15748508-15748530 CAATGGTGGTGAAGAGAAGTGGG - Intronic
1139408375 16:66738045-66738067 TTCTGTGGGTGAAGAGGAGCAGG - Intronic
1139957710 16:70700991-70701013 GGCTGGTGGTGAGGAGAAGCGGG + Intronic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1141140128 16:81492018-81492040 CTCTATTGAGGAAGAAAAGCAGG - Intronic
1141542023 16:84731887-84731909 CAGTGTTGGTGATGAGAAGAAGG + Intronic
1143171975 17:4935628-4935650 TTCTTTTGGTGAAGAGTGGCTGG + Intergenic
1144421295 17:15101494-15101516 CTGTGTGGGTGAGGAGAACCAGG - Intergenic
1146261380 17:31424046-31424068 CTCTCTTTCTGATGAGAAGCCGG - Intronic
1147181883 17:38691578-38691600 CTCTGTTTTTGCTGAGAAGCTGG - Intergenic
1148645632 17:49218319-49218341 TGCTGTTGGTGAGAAGAAGCGGG + Intronic
1150953802 17:69832571-69832593 ATCTTTTGGAGAAGAGGAGCAGG + Intergenic
1152290421 17:79437057-79437079 CCCTGTTGGAGAAGGGAATCGGG - Intronic
1154445312 18:14431131-14431153 CTCTGGGGGTGAGGAGGAGCTGG - Intergenic
1155222921 18:23701709-23701731 CGCTGAGGATGAAGAGAAGCGGG + Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1158745222 18:60192021-60192043 TACTGATTGTGAAGAGAAGCTGG + Intergenic
1160095263 18:75865999-75866021 CACTGTGGGTGAAGAGAAGGTGG + Intergenic
1168085807 19:54045094-54045116 CTCTGTTGGTGCAGAGGACCAGG - Intronic
925760672 2:7181407-7181429 CTGTGCTGGGGAAGAGAAGCAGG - Intergenic
926057174 2:9780889-9780911 CTCTGTCGGTGATTAGATGCAGG + Intergenic
926061847 2:9809384-9809406 ATCTGTGGGTGAAAACAAGCGGG + Intergenic
927044715 2:19265264-19265286 CTCTGTTGGTCAATGGAATCTGG + Intergenic
928192003 2:29179432-29179454 TTCTGTTTGTGAAGAGAGCCTGG + Intronic
928434586 2:31246301-31246323 CGCTGGAGCTGAAGAGAAGCAGG + Intronic
928712927 2:34027998-34028020 CTCTGTTGCTGAATTGAAGATGG + Intergenic
929293415 2:40219069-40219091 CTTTGTTGGAGAAGTTAAGCAGG + Intronic
929784664 2:44980591-44980613 ATCTCTTGGTGAAGGGAAGGGGG + Intergenic
929784899 2:44982428-44982450 ATCTCTTGGTGAAGGGAAGGGGG - Intergenic
931833102 2:66072680-66072702 CCCTGTTGCTACAGAGAAGCAGG - Intergenic
935891904 2:107688103-107688125 CACGGTTGGTTAAGAGGAGCAGG + Intergenic
937872258 2:126794315-126794337 CTCTCTCAGGGAAGAGAAGCTGG + Intergenic
940838143 2:158548469-158548491 CCCTGTTGTTGCAGAGAAGCAGG + Intronic
940972759 2:159911583-159911605 CTCTCTTTAAGAAGAGAAGCAGG - Intergenic
940979972 2:159990615-159990637 CTCTGTTAGAGGAGAGAAGAAGG - Intronic
941352450 2:164453436-164453458 CTATGTTGGTCAAGAGCATCAGG - Intergenic
941387928 2:164875997-164876019 CCCTGTTGGTGAGGACAAGTTGG - Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
943772517 2:191733654-191733676 GTTTGTTGGTGAAGAGGAGGAGG + Intergenic
945053273 2:205846176-205846198 CTCTCTTGTTGAAGGGAATCTGG - Intergenic
945563233 2:211364253-211364275 CTCTCCTGGTGAAGAGATTCAGG + Intergenic
946301814 2:218828504-218828526 CTTTGTGGGTGAGGAGAGGCTGG - Exonic
948223198 2:236289647-236289669 CTCTGTTGGTGGTGAGAAGGAGG + Intergenic
948356745 2:237384374-237384396 CCATGTTGGTGAGGAGTAGCAGG - Intronic
1168806473 20:675087-675109 CCCCGTTGAGGAAGAGAAGCTGG - Intronic
1170771320 20:19335324-19335346 ATCTGTGGGCTAAGAGAAGCTGG - Intronic
1170776609 20:19380247-19380269 GCCTGTTGGTGCAAAGAAGCAGG + Intronic
1170969651 20:21105108-21105130 CTCTCTGGGTGAAGGAAAGCGGG + Intergenic
1176017869 20:62945938-62945960 TTCTGTGAGTGAACAGAAGCAGG - Exonic
1178188905 21:30257735-30257757 GTTTGCTGGTGAAGAGAAGTTGG - Intergenic
1178347015 21:31838376-31838398 CTCTGTAGGTGAAAAGGAACTGG + Intergenic
1181552681 22:23649705-23649727 CCCTGTGGGAGAAGAGGAGCAGG + Intergenic
1184148044 22:42622938-42622960 CTCTGCTTTTCAAGAGAAGCTGG - Intronic
1184426154 22:44410411-44410433 CTCTCTTGGAGAAGGGATGCGGG - Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951971193 3:28445449-28445471 GTATGTTGGGGAAGATAAGCTGG + Intronic
953225684 3:41017389-41017411 GTTTGTTGGGGAAGAGTAGCAGG + Intergenic
955417793 3:58708870-58708892 CTCTTTTTGAGAAGTGAAGCTGG + Intergenic
956501343 3:69888853-69888875 CTGTCTTGGTGAAGAGAAAAGGG + Intronic
956641901 3:71423520-71423542 CTCTTTGTGTGAGGAGAAGCTGG - Intronic
961455970 3:127024190-127024212 CTCTGTGGGTGTGGAGAATCGGG - Intronic
961500507 3:127329731-127329753 CTCTGGTGGTACAGACAAGCAGG - Intergenic
963269783 3:143274478-143274500 CTCTGTTGGGGAAGAAAGGCTGG + Intronic
963351614 3:144158883-144158905 CTCTGTTGGGTAAGAGAAGCAGG - Intergenic
963784382 3:149518752-149518774 CTCTGTTGTAGAAGAAAAGAAGG - Exonic
963828819 3:149985238-149985260 TTCTGTTAGTGAACAGAAGTAGG - Intronic
964080039 3:152743395-152743417 CTATGATGTAGAAGAGAAGCAGG - Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
964501860 3:157356646-157356668 CTCTGTTGGTGATGAAGAGTTGG - Intronic
964785717 3:160394019-160394041 CTCTATTGGAGAAGAGACACAGG - Intronic
965982348 3:174708659-174708681 CTATGTTGGTCAAGAGAAATAGG + Intronic
966892813 3:184419377-184419399 CTCTGCTTGTGAAAAGAATCGGG + Intronic
967710912 3:192707141-192707163 CTTTGTTGTTGAAGATAACCTGG - Intronic
968383289 4:112867-112889 GTCTGTTGGGGAAGACAAGCAGG - Intergenic
969223198 4:5774755-5774777 CTCTGGTGGGGAATAGAAGCTGG - Intronic
971967891 4:33585741-33585763 ACCTGTTGGGGAAGAGAAGGAGG + Intergenic
977424952 4:96856588-96856610 CTATGTTGCAGAAGAGAAGCAGG - Intergenic
981849710 4:149215616-149215638 CTCTGTGGGTTGAGAGATGCAGG - Intergenic
989432605 5:41373220-41373242 CTCTGTTGAGGAAGAAATGCTGG - Intronic
990561720 5:56990293-56990315 CTCTTTAGGTGAGGAGATGCAGG - Intergenic
991502979 5:67295484-67295506 CTGCCTTGGGGAAGAGAAGCAGG + Intergenic
992504215 5:77369403-77369425 TTCTGCTGGACAAGAGAAGCAGG + Intronic
994118768 5:96090670-96090692 CTGTGTTGGTGAGAAGAAGAGGG + Intergenic
995730586 5:115236599-115236621 TTCTGTTAGTAAAGACAAGCAGG - Intronic
996058940 5:119011437-119011459 CTGAGTGGGTGAAGAGAACCTGG + Intergenic
999316965 5:150590446-150590468 CTCTGGTGGTGATCAGACGCTGG + Intergenic
1001685534 5:173592232-173592254 ACCTTGTGGTGAAGAGAAGCAGG - Intergenic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1005091663 6:22063150-22063172 CTCCGTGGGTGAAGGGAAGTGGG - Intergenic
1005628453 6:27685445-27685467 CTCTGTTAGTGTGGAGAAGCAGG + Intergenic
1009356087 6:62747361-62747383 CTATTTTGGTGAATGGAAGCTGG + Intergenic
1011542373 6:88445648-88445670 CTCAGCTGATGAAGGGAAGCAGG - Intergenic
1013011555 6:106125305-106125327 CTCTATTGCTCAAGAGAAGGTGG + Intergenic
1013145529 6:107387183-107387205 CACGGGTGGTGAGGAGAAGCTGG - Intronic
1013264778 6:108485147-108485169 CTCAGTTTGGGAACAGAAGCTGG - Intronic
1013542861 6:111128487-111128509 TTCTGTTGGAGAAGAAAGGCTGG + Intronic
1015052447 6:128858290-128858312 TTCAGTTAGTGAAGAGTAGCAGG - Intergenic
1017192679 6:151670401-151670423 ATACGTTGGTGAAGAGAGGCAGG - Intronic
1017740808 6:157405042-157405064 CTCAGTGGGTAAAGAGAAACAGG + Intronic
1019025469 6:168958922-168958944 CTCTGTTGGTGAGGAGTCACTGG + Intergenic
1019029775 6:169000261-169000283 CGCTGTGGGTGAAGAGAAGACGG - Intergenic
1019756413 7:2773785-2773807 GTCTTTTGGTGAAGAGATGTAGG - Intronic
1021991721 7:26147534-26147556 CTCTGATGCTGAGCAGAAGCTGG + Intergenic
1022687667 7:32611778-32611800 CTTTGTTACTGAAGAGAATCTGG + Intergenic
1023143535 7:37126732-37126754 CTGTGGTGGTGAAGAAAGGCAGG - Intronic
1024932033 7:54674123-54674145 CTTTTTTTGTAAAGAGAAGCTGG + Intergenic
1027727278 7:81823508-81823530 CTCACTTGGTGAAAAGTAGCAGG - Intergenic
1028155405 7:87423598-87423620 ATCTGTTTGTGTAGAAAAGCTGG - Intronic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1031117758 7:117686655-117686677 GTCTGTTGCAGAAGAGAAGAGGG - Intronic
1033521601 7:142166540-142166562 GTCTGTTGGAGAACACAAGCAGG + Intronic
1034745240 7:153518237-153518259 GGCTGTTGGTGTGGAGAAGCTGG - Intergenic
1035148486 7:156844578-156844600 CACTTTTAGTGATGAGAAGCTGG - Intronic
1036085589 8:5609708-5609730 CACTGTTGGTGATTAGTAGCTGG - Intergenic
1036959622 8:13229768-13229790 CTAGGCTGATGAAGAGAAGCTGG + Intronic
1038075862 8:24072799-24072821 CTCTGTTGATGATGAGCAGATGG + Intergenic
1039805334 8:40992731-40992753 CTCTGTTAGTGCAGAGTGGCTGG + Intergenic
1041930549 8:63281731-63281753 CTCTGATAGTGAAGAGCAGGTGG + Intergenic
1041959941 8:63601663-63601685 ATCTTTGGGAGAAGAGAAGCTGG + Intergenic
1044041045 8:87368693-87368715 CTCTTTTGGCTAATAGAAGCAGG - Intronic
1045132314 8:99166961-99166983 CTTTTTAGGTGAAGAGAAGGAGG + Intronic
1045696204 8:104811264-104811286 CTCTTTTGGGCAAGAGAAGAGGG + Intronic
1046010688 8:108543125-108543147 CTCTTTTGGTGAAGTGATGAAGG + Intergenic
1046505299 8:115129380-115129402 CTCTGTTGGTGAGAACATGCTGG + Intergenic
1048000345 8:130374802-130374824 CTCTTTGTGTGAAAAGAAGCTGG - Intronic
1048581298 8:135731684-135731706 CTCTGCTGGTGAAGACATCCAGG - Intergenic
1048856665 8:138692618-138692640 CTCTATAGGTGCAGAGAAGCAGG + Intronic
1049299635 8:141862740-141862762 CTGTGTGGGTGCAGCGAAGCAGG + Intergenic
1050282013 9:4060343-4060365 CACTGAAGGTGACGAGAAGCAGG - Intronic
1051794786 9:20854126-20854148 CTCTGTTGGAGTAAAGAATCAGG + Intronic
1057933662 9:99218485-99218507 ATCTGTTGATGGAGAGCAGCAGG + Exonic
1059180724 9:112209998-112210020 CTCTGTCAGTGCAGAGCAGCTGG + Intergenic
1060255092 9:122020347-122020369 CTTTGTTGGTGATGGGGAGCAGG - Intronic
1060654376 9:125358978-125359000 CTTTGTAGATGAAGAGAAGTAGG - Intronic
1061303241 9:129718332-129718354 CTCTGGTGGGGATGAGGAGCTGG - Intronic
1061373236 9:130209623-130209645 CCGTGTTGGGGAAGAGAAGGTGG + Intronic
1185668362 X:1786521-1786543 CTTTGTGGGTGAAGTGAAGGGGG - Intergenic
1186684808 X:11914667-11914689 CTCTGGAGGAGAAGAGAGGCTGG - Intergenic
1186866236 X:13723505-13723527 TTTTGTTGGTGAAGGGAAGGTGG - Intronic
1187013697 X:15305498-15305520 GTCTCTGGGTGAAGAGAAGCAGG + Intronic
1187847598 X:23556842-23556864 CTCTGATGGGGATGAGAATCAGG + Intergenic
1188702871 X:33286946-33286968 CTCTGAGGTTGAAGAGATGCGGG + Intronic
1189595731 X:42563618-42563640 TTCTTGTGGTGAAGAGAAGGAGG + Intergenic
1190357186 X:49616899-49616921 CTCTGTTGTTGAAGGTCAGCAGG + Intergenic
1191117123 X:56864099-56864121 CTCAGTTGGTGAACAGAAGATGG + Intergenic
1195913828 X:109916087-109916109 TTCTGTTTGGGAAGAGGAGCTGG + Intergenic
1196150490 X:112368238-112368260 GTGTGTTAGTGAAGAGAAGGTGG + Intergenic
1196679292 X:118454541-118454563 GTCTGTTGGAGAAGGGATGCAGG + Intergenic
1198333219 X:135641592-135641614 CAATGTTGGTGAAGAGAGGATGG - Intergenic
1198362445 X:135908880-135908902 CAGTGTTCGTGAAGAGAAGATGG + Exonic
1201787673 Y:17803550-17803572 TTTTGTTGGTGAAGGGAAGGTGG - Intergenic
1201813880 Y:18102438-18102460 TTTTGTTGGTGAAGGGAAGGTGG + Intergenic
1201866463 Y:18660960-18660982 CTTTGTGGGTGAAAAGAAGGTGG - Intergenic