ID: 1003117781

View in Genome Browser
Species Human (GRCh38)
Location 6:3294894-3294916
Sequence CCATCAGTACATCCTAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003117781_1003117785 -2 Left 1003117781 6:3294894-3294916 CCAAGGTTAGGATGTACTGATGG 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1003117785 6:3294915-3294937 GGGGCAGTGAGCAGCCCCACTGG 0: 2
1: 1
2: 1
3: 25
4: 344
1003117781_1003117791 23 Left 1003117781 6:3294894-3294916 CCAAGGTTAGGATGTACTGATGG 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1003117791 6:3294940-3294962 CCCTACACGTACCTCCAGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003117781 Original CRISPR CCATCAGTACATCCTAACCT TGG (reversed) Intronic
901895237 1:12306285-12306307 CCATTACTACCTCATAACCTTGG - Intronic
901926704 1:12570796-12570818 CCCTCAGTCCATCCTGACCTCGG - Intronic
905289180 1:36909946-36909968 CCATCATAGCATCCTCACCTGGG - Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
914690318 1:150020083-150020105 GCATCACTACATTCCAACCTGGG + Intergenic
914715497 1:150251172-150251194 ACACCACTACACCCTAACCTGGG - Intergenic
919718138 1:200801484-200801506 CCAGGAGAACTTCCTAACCTAGG - Intronic
920259332 1:204678333-204678355 CAATCAGTACATCCCCACCAAGG - Intronic
920354677 1:205362051-205362073 ACATCATTGCATTCTAACCTGGG + Intergenic
921387824 1:214588626-214588648 CCAGCAATATATTCTAACCTTGG + Intergenic
923348992 1:233085442-233085464 CCATCAGTAAATTCTACCCAAGG - Intronic
1067808336 10:49408379-49408401 CCCTCACTTCATCCTAATCTCGG + Intergenic
1067936185 10:50614174-50614196 CCATCATTACATCCCATCTTAGG - Intronic
1070994325 10:80762718-80762740 CCACCAGCACATGTTAACCTTGG - Intergenic
1071284696 10:84133772-84133794 CCAGCTGTACTTCCTACCCTTGG + Intergenic
1072137478 10:92560906-92560928 CCTTCACTCCATCCTCACCTGGG + Intronic
1073871026 10:107864382-107864404 CCATCACTTCATCCTCACCCAGG - Intergenic
1076302231 10:129437060-129437082 CCATCAGAGCATCCTAATCCTGG - Intergenic
1076808812 10:132876084-132876106 CCTTCAGTGCTTCCTATCCTTGG - Intronic
1084417348 11:69040636-69040658 CCATCCGTCCAACCTAATCTCGG - Intergenic
1087756288 11:102057827-102057849 CCATCACTCCCTTCTAACCTAGG - Intronic
1090939099 11:131372079-131372101 CAATCCCTAAATCCTAACCTCGG - Intronic
1091204577 11:133811067-133811089 CCGTCAGTACACGCTAACCCAGG + Intergenic
1096323837 12:50640436-50640458 CCATCAGTACTGCCTCTCCTTGG + Intronic
1102784862 12:115596129-115596151 CCATCTGTTCATTCTGACCTTGG + Intergenic
1104600097 12:130147471-130147493 ACATCACTGCATTCTAACCTGGG - Intergenic
1105010534 12:132753278-132753300 GCATCACTACACCCCAACCTGGG + Intronic
1106912219 13:34475182-34475204 CCATCAGAACCGCCTAATCTAGG + Intergenic
1111257209 13:85686333-85686355 CCACCATTGCATTCTAACCTGGG - Intergenic
1114822853 14:26042534-26042556 CCAATAGTAAAGCCTAACCTTGG - Intergenic
1114910694 14:27191934-27191956 CATTCAGTTCATCCAAACCTAGG - Intergenic
1117448529 14:55828207-55828229 ACATCAGTTCATTCTCACCTTGG - Intergenic
1126410840 15:48371536-48371558 CCAGGAGTAAAGCCTAACCTGGG + Intergenic
1128176476 15:65560758-65560780 CCACCACTGCATTCTAACCTGGG + Intronic
1132564474 16:615059-615081 CCATCCGTCCATCCTAAAATTGG + Intronic
1132787085 16:1663090-1663112 CCATAAATACATCCCAATCTGGG - Intronic
1137640675 16:50025697-50025719 CGAGCAGCACTTCCTAACCTTGG - Exonic
1140402034 16:74679417-74679439 CCATGAGTGCAACCCAACCTGGG - Intronic
1143216765 17:5230896-5230918 CCATCAGTGCACTCTAGCCTGGG + Intronic
1151590803 17:75043176-75043198 GCATCAGTGCACCCTAGCCTGGG + Intronic
1153730828 18:8010153-8010175 ACATGAGTACATCCTAGACTAGG + Intronic
1159633705 18:70779785-70779807 CCCTCATTACATCTTAACTTGGG + Intergenic
1160045705 18:75385481-75385503 GCATCATTACATCCTTACCCAGG - Intergenic
1162742105 19:12779188-12779210 CCAGCAGTACAACCTAGGCTGGG - Intronic
1165376452 19:35446173-35446195 CCCTCAGTCCACCCTAATCTGGG - Intronic
1165376559 19:35447074-35447096 CCTTCAGGAGCTCCTAACCTGGG + Intronic
1165604151 19:37085641-37085663 CCAAGAGGACATCCTAATCTAGG + Intronic
1166575642 19:43835044-43835066 CAATGAGTACATGCTAACTTAGG - Intronic
1167502157 19:49854437-49854459 CCATCGGTCCCTCCTCACCTGGG + Exonic
926156070 2:10454638-10454660 CCATCAGTCCATCCAAATCCTGG + Intergenic
941999035 2:171627842-171627864 ACATCATTACACTCTAACCTGGG - Intergenic
946096368 2:217277825-217277847 CCATCACACCATCATAACCTCGG + Intergenic
946360067 2:219213996-219214018 CCATCAGTGAGTCCAAACCTGGG + Intronic
948376603 2:237525068-237525090 CCCTCAGTACCTCCTTTCCTTGG + Intronic
1171469124 20:25355971-25355993 CCATCAGTACCTCCTATTATTGG - Intronic
1177888393 21:26774572-26774594 ACATAAGTACATCATAAGCTGGG + Intergenic
1181966909 22:26663118-26663140 CAACCAATACATCCTAACATGGG - Intergenic
1181976233 22:26732312-26732334 GCCTCTGTGCATCCTAACCTGGG + Intergenic
955376234 3:58399674-58399696 CCTTCAGTATTTCCTAAGCTGGG - Intronic
960056075 3:113277421-113277443 CCATCATTGCACCCTATCCTGGG - Intronic
960687250 3:120306908-120306930 CCATCGGTCCCTCCTCACCTGGG + Intergenic
962650844 3:137489000-137489022 GCATCAGTTAATCCTCACCTTGG - Intergenic
973755326 4:54068195-54068217 CATTCAGTACATCGTAGCCTGGG - Intronic
974065922 4:57077318-57077340 ACATCACTACATCCCAGCCTGGG - Intronic
980315162 4:131189795-131189817 GCATCACTACATTCTAGCCTGGG + Intergenic
980418175 4:132520699-132520721 CCATCAAAACATCATAAACTGGG - Intergenic
983914482 4:173277263-173277285 CCATGTGTACTTCCTGACCTTGG - Intronic
989426283 5:41299773-41299795 CCATCATTACATCATCCCCTTGG - Intergenic
990563528 5:57006571-57006593 CCATCACTGCACCCTAGCCTGGG + Intergenic
993139191 5:84008853-84008875 CCATCACTGCATTCTAGCCTGGG - Intronic
994801763 5:104386473-104386495 CCATCCATACATCCTAACCAGGG + Intergenic
1003117781 6:3294894-3294916 CCATCAGTACATCCTAACCTTGG - Intronic
1004172647 6:13308910-13308932 CCAGGAGAAAATCCTAACCTGGG + Intronic
1006717209 6:36128177-36128199 CCCTCAGTCCATCCTGCCCTGGG - Intronic
1010741917 6:79517093-79517115 CAATCAGTATAGACTAACCTAGG - Intronic
1014118529 6:117695149-117695171 GCATCAGTACACTCTAGCCTGGG + Intronic
1014901704 6:126973575-126973597 CCATCAGTATATCCTGAGCACGG - Intergenic
1015575140 6:134663496-134663518 CCAGCAGTAAATCCTCACCACGG + Intergenic
1017996195 6:159533667-159533689 CCATGAGCAATTCCTAACCTAGG - Intergenic
1018508775 6:164501909-164501931 ACACCAGTACACCCTAGCCTGGG + Intergenic
1021599386 7:22349379-22349401 CCACCAATACATTCCAACCTGGG + Intronic
1021942141 7:25688389-25688411 CCCTCAGCACAACCTAACCATGG + Intergenic
1026054638 7:66973768-66973790 CCATCACTACATTCCAGCCTGGG + Intergenic
1026394608 7:69938638-69938660 TAAGCAGTACACCCTAACCTAGG + Intronic
1027592361 7:80133660-80133682 TCATCAGTTCAGCCTCACCTTGG + Intergenic
1028057904 7:86271219-86271241 CCATTAGCACTTCCTAAACTGGG + Intergenic
1032755121 7:134882818-134882840 CCATCATTACATCCCAATATTGG - Intronic
1033283226 7:140020444-140020466 CCATCAGGACAGGCTTACCTGGG - Intergenic
1033476244 7:141696103-141696125 CCATCTGTACATCCTCAGCCAGG - Intronic
1037628048 8:20625198-20625220 CCATCAGTAAAGCCTTGCCTGGG - Intergenic
1047186983 8:122642527-122642549 CCATCAGAAAAACCTCACCTTGG - Intergenic
1050595389 9:7199655-7199677 CCAGGAGAACATCCTTACCTTGG + Intergenic
1051982003 9:23031624-23031646 ACATGAGTACATCATAGCCTGGG + Intergenic
1055635287 9:78271741-78271763 CCATCACTACACCCCAGCCTGGG - Intronic
1193952333 X:87815250-87815272 CCATTACTACATTCTAGCCTGGG - Intergenic
1195638267 X:107143265-107143287 GCATCACTACACCCTAGCCTTGG - Intronic
1196056570 X:111362625-111362647 CCAACAGTGCCTTCTAACCTAGG - Intronic