ID: 1003119011

View in Genome Browser
Species Human (GRCh38)
Location 6:3304883-3304905
Sequence CAGGGAGAGGAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003119005_1003119011 6 Left 1003119005 6:3304854-3304876 CCGAATGCTGGGAATGAGGTGAG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG No data
1003119004_1003119011 7 Left 1003119004 6:3304853-3304875 CCCGAATGCTGGGAATGAGGTGA 0: 1
1: 0
2: 1
3: 24
4: 209
Right 1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003119011 Original CRISPR CAGGGAGAGGAGAGGGATGC AGG Intronic
No off target data available for this crispr