ID: 1003120757

View in Genome Browser
Species Human (GRCh38)
Location 6:3317455-3317477
Sequence AGTATCTAGGAGCATCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003120757_1003120760 -8 Left 1003120757 6:3317455-3317477 CCTCCTAGATGCTCCTAGATACT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1003120760 6:3317470-3317492 TAGATACTCCCTTCTTCTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 212
1003120757_1003120761 -3 Left 1003120757 6:3317455-3317477 CCTCCTAGATGCTCCTAGATACT 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1003120761 6:3317475-3317497 ACTCCCTTCTTCTTGTGGTTTGG 0: 1
1: 0
2: 2
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003120757 Original CRISPR AGTATCTAGGAGCATCTAGG AGG (reversed) Intronic
902755039 1:18543412-18543434 ATTATCCTGGAGCATCTGGGAGG + Intergenic
908132733 1:61091195-61091217 AATTTCTATGACCATCTAGGGGG - Intronic
912778874 1:112525502-112525524 ATTATCTCTGAGCATCTCGGTGG + Exonic
914923733 1:151865402-151865424 CGTGTCTAGAAGCACCTAGGTGG - Intergenic
916632895 1:166636046-166636068 ACTATCTTGGATTATCTAGGTGG - Intergenic
917191501 1:172423367-172423389 ATTATCTAGGACCACCAAGGTGG + Intronic
920503115 1:206497814-206497836 AGTACCCAGGAACATCAAGGCGG - Intergenic
921354973 1:214277293-214277315 AGTATCCTGGAACATCCAGGTGG - Intergenic
921905443 1:220490857-220490879 AGTCTCTAGGATTTTCTAGGAGG - Intergenic
924423169 1:243928267-243928289 TGTTTCTAGGACCATCTAAGTGG - Intergenic
1065625781 10:27627029-27627051 AGAATTTAGCACCATCTAGGGGG + Intergenic
1069667632 10:70174114-70174136 AGTTTCCAGGAACATCTGGGAGG + Intergenic
1070512844 10:77176900-77176922 AGTATCCTGGAGTATCCAGGTGG + Intronic
1075272491 10:121064494-121064516 ATTATCTTGGATTATCTAGGTGG + Intergenic
1077759047 11:5070610-5070632 AGTATTTAGGACCATCTTAGGGG + Intergenic
1078862582 11:15264066-15264088 AGTACCTTGGAGTATCCAGGTGG - Intergenic
1078862620 11:15264390-15264412 AGTACCTTGGAGTATCCAGGTGG - Intergenic
1078862657 11:15264716-15264738 AGTACCTTGGAGTATCCAGGTGG - Intergenic
1081352253 11:42068356-42068378 TGTATCTAGGAGCATATGGCTGG + Intergenic
1091659361 12:2371925-2371947 ACCATCTAGGAACATCTAAGAGG - Intronic
1092712275 12:11351712-11351734 AGTTTCCTGGAGCATCAAGGAGG + Intergenic
1092863948 12:12743723-12743745 AGTATCTTGGATTATCCAGGTGG + Intronic
1096531407 12:52244834-52244856 GGCATCTGGGGGCATCTAGGAGG + Intronic
1097881813 12:64693349-64693371 GGTATCTAGCATCATCTACGAGG - Intronic
1097908330 12:64943634-64943656 AGTATCCTGGATCATCTAGGTGG - Intergenic
1098508231 12:71280520-71280542 AGAATCAAGGAGACTCTAGGAGG - Intronic
1098873878 12:75846642-75846664 ATTATCCTGGATCATCTAGGTGG - Intergenic
1106942542 13:34794031-34794053 AGATTCAAGGAGCATTTAGGAGG + Intergenic
1107036642 13:35909215-35909237 AGTATCCAGGAGCCCCCAGGAGG - Intronic
1108036602 13:46296703-46296725 ACTATCTGGGATCATCTGGGTGG - Intergenic
1109349871 13:61165541-61165563 AGCATCTAGCAGCATCTTGTTGG + Intergenic
1110052036 13:70914710-70914732 AGTATATAGGAAAACCTAGGAGG - Intergenic
1112305466 13:98269427-98269449 AGTAACTAGAATCATCTTGGCGG - Intronic
1116888158 14:50240762-50240784 AGTATTTAGAAGGATCCAGGAGG + Intronic
1116888256 14:50241497-50241519 AGTATTTAGAAGGATCCAGGAGG + Intronic
1121308518 14:92922691-92922713 AATATCTAGGAGGCTCTAGAGGG - Intergenic
1126241939 15:46455020-46455042 AATATCTAGAAGCACCAAGGTGG - Intergenic
1127697484 15:61465176-61465198 AGACTTTAGCAGCATCTAGGGGG + Intergenic
1128414334 15:67430282-67430304 AGTATCTAGTAGGTTCTAGGAGG + Intronic
1130426967 15:83811093-83811115 ATTATCTAGGATTATCCAGGTGG - Intronic
1131036955 15:89229030-89229052 AGAATCTAGGAGAAGCTTGGAGG + Intergenic
1134175779 16:12004963-12004985 AGTGCCTAGAAGCATCTAGAAGG + Intronic
1134636592 16:15796679-15796701 ACTGTCTTGGATCATCTAGGTGG + Intronic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1140119386 16:72070456-72070478 AGTATTTAGGAGCACCAAGTAGG - Intronic
1140414895 16:74767502-74767524 ATTATCCTGGATCATCTAGGTGG + Intronic
1142620665 17:1163725-1163747 TGGATGTCGGAGCATCTAGGTGG + Intronic
1142620682 17:1163826-1163848 TGGATGTCGGAGCATCTAGGTGG + Intronic
1142620698 17:1163927-1163949 TGGATGTCGGAGCATCTAGGTGG + Intronic
1142620715 17:1164028-1164050 TGGATGTCGGAGCATCTAGGTGG + Intronic
1142620766 17:1164335-1164357 TGGATGTCGGAGCATCTAGGTGG + Intronic
1142620782 17:1164436-1164458 TGGATGTCGGAGCATCTAGGTGG + Intronic
1149018210 17:51933261-51933283 ATTATCTAGGATTATCTGGGTGG + Intronic
1149833029 17:59888387-59888409 AGTTTCAAGGAGTATATAGGAGG + Intronic
1150636405 17:66916272-66916294 ACTCTCCAGGAGCAGCTAGGAGG + Intergenic
1152021950 17:77784427-77784449 AGGAGCTAGGAACAGCTAGGAGG + Intergenic
1152223685 17:79082869-79082891 AGCCTCCAGGTGCATCTAGGAGG + Intronic
1152960701 18:78922-78944 AGTTTCTAGGAGCAAGTGGGAGG + Intergenic
1153531196 18:6048161-6048183 AATAGCTAGGAGTACCTAGGAGG + Intronic
1164874446 19:31673660-31673682 ATGACCTAGGAGTATCTAGGTGG + Intergenic
1165645553 19:37432394-37432416 CTTATCTAGGACCATCAAGGTGG + Intronic
1165872446 19:38982515-38982537 ATTATCCTGGAGTATCTAGGTGG - Intergenic
1168551850 19:57302713-57302735 AGGATGTAGCAGCATCTGGGAGG + Intergenic
928118675 2:28566209-28566231 GGTGTCTAGGAGCATCTAAAAGG - Intronic
932012246 2:67990037-67990059 AGTATCTATGAGCTTCTAAAGGG + Intergenic
933660772 2:84925688-84925710 AGTATTCAGGAGCAGCTATGGGG + Intergenic
937882262 2:126877281-126877303 ACTGTGTAGGAGCATTTAGGAGG + Intergenic
945569082 2:211441518-211441540 ATTATCCATGAGCATCTATGAGG - Intronic
947292289 2:228589554-228589576 AGTATCTAATATCATCTAGAGGG - Intergenic
948193915 2:236080899-236080921 AGTATCTTGGATTATCCAGGTGG - Intronic
948522582 2:238549752-238549774 AGTATCTTGGATCATCTCAGAGG - Intergenic
948989411 2:241545080-241545102 ATTATCTCGGATTATCTAGGTGG - Intergenic
1178678049 21:34647537-34647559 CATATCTAGGAGTATTTAGGAGG - Intergenic
1178712837 21:34934666-34934688 AGAATATAGGAGCATCTTTGTGG + Intronic
1178751423 21:35307567-35307589 AATATCTTCCAGCATCTAGGAGG - Intronic
1181538038 22:23556869-23556891 CCTCTCTAGGAGCATCTAGAAGG + Intergenic
1182293689 22:29300787-29300809 AGGCACTAGGAGCATCTAAGGGG + Intergenic
1184750315 22:46482234-46482256 AGTATCCTGGAGGATCTGGGTGG + Intronic
951428853 3:22582980-22583002 AGAATCCAAGAGCATCTAAGTGG + Intergenic
954365661 3:50144810-50144832 AAACTCTAGGAGCAGCTAGGGGG + Intergenic
958041086 3:88227526-88227548 AGTCTTTAGGGGCTTCTAGGTGG - Intergenic
962982490 3:140503163-140503185 AGTATCCTGGACCATTTAGGTGG - Intronic
964891672 3:161543908-161543930 GGTATTTAGGGGCATCCAGGAGG + Intergenic
969902198 4:10360365-10360387 AGTATGTAGCAGCCTCCAGGGGG - Intergenic
970418488 4:15882583-15882605 AGTATCCTGGATCATCCAGGTGG + Intergenic
972761040 4:42104680-42104702 ATTATCTTGGATCATCTGGGAGG - Intergenic
973764704 4:54152472-54152494 AGTGTTTGGGAGCATCAAGGAGG + Intronic
974167766 4:58225690-58225712 AGCATCTAGGAGAAACAAGGAGG + Intergenic
975845450 4:78520178-78520200 AGTTTTAAGGAGCATCTATGTGG - Intronic
975960651 4:79900049-79900071 ATTATCTAGGATAATCTAAGTGG + Intergenic
977929031 4:102731804-102731826 AACATCTATGAACATCTAGGAGG - Intronic
979134029 4:117085701-117085723 AGAATTCAGGAGCATCTTGGCGG - Intergenic
981363020 4:143869512-143869534 AGTTTCTATGAGTATCTTGGAGG + Intergenic
981373746 4:143990307-143990329 AGTTTCTATGAGTATCTTGGAGG + Intergenic
981382849 4:144093572-144093594 AGTTTCTATGAGTATCTTGGAGG + Intergenic
982887026 4:160794536-160794558 AGGATCTAGGAGCATGTACATGG + Intergenic
983142102 4:164163153-164163175 TGTATTTAGGATCTTCTAGGTGG - Intronic
985411479 4:189690096-189690118 ATTTTCGAGGAGCATCAAGGAGG + Intergenic
986279836 5:6314069-6314091 AGGATATGGGAGCACCTAGGAGG - Intergenic
991020405 5:61974069-61974091 TGTAACCAGGAGCCTCTAGGAGG + Intergenic
992269062 5:75047413-75047435 AGCATTTTGGAGCATCTTGGAGG + Intergenic
993588770 5:89767248-89767270 ATTATATTGGAGGATCTAGGCGG - Intergenic
995531057 5:113092200-113092222 AGTATCATGGATCATCTAGGTGG + Intronic
997381837 5:133443984-133444006 GGTGTGTAGGAGCATATAGGAGG - Intronic
998324383 5:141266500-141266522 TGTATCTAGGAGCAACTGTGTGG + Intergenic
998474814 5:142411762-142411784 AGTATACAGGAGCCTCTAAGTGG + Intergenic
1003120757 6:3317455-3317477 AGTATCTAGGAGCATCTAGGAGG - Intronic
1004861280 6:19806705-19806727 TGTATCTAGCATCATCTAGTGGG - Intergenic
1007268089 6:40612276-40612298 AGTATCTGGGACAGTCTAGGGGG + Intergenic
1007612150 6:43157026-43157048 ATTATCTAGGAACATGTAAGTGG + Intronic
1008700687 6:54095967-54095989 AGGCTCTAGCAGCATCTAGCAGG + Intronic
1009015872 6:57900649-57900671 AATATCTAGTAACATCTATGTGG - Intergenic
1012991185 6:105928308-105928330 ATTACCTAGAAGCATCAAGGAGG - Intergenic
1013636870 6:112037615-112037637 AGCATCTATGAGCATCTCTGTGG + Intergenic
1013691950 6:112655892-112655914 AGTTTCTTGGAGCAACTAGCAGG + Intergenic
1013811398 6:114048796-114048818 AGTATCAAGGATTATCTGGGTGG - Intergenic
1016520896 6:144945356-144945378 AGTCTGTAGGCTCATCTAGGAGG - Intergenic
1020900737 7:14000325-14000347 AGAATCTAGGAGCAATTAGCTGG + Intergenic
1021969813 7:25954442-25954464 ATTATCTTGGATTATCTAGGTGG - Intergenic
1022974308 7:35543750-35543772 AGGATCCAGGAGGATCCAGGAGG + Intergenic
1022974311 7:35543760-35543782 AGGATCCAGGAGGATCCAGGAGG + Intergenic
1025651019 7:63469159-63469181 TGTATCTAGGAGTATCTTTGTGG - Intergenic
1028871886 7:95779282-95779304 AACATCTAAGAGCATCTAGGAGG + Intronic
1029370817 7:100149334-100149356 AGTATTGAGGACCATGTAGGGGG + Intronic
1029470889 7:100753318-100753340 AGCATCTAGAAGCAACTAGAAGG - Intronic
1032439035 7:131927829-131927851 AGCATCTTGGAGCAGCTGGGGGG - Intergenic
1034173486 7:149081829-149081851 AGTCTCTAGGATTTTCTAGGTGG - Intronic
1042515234 8:69652202-69652224 AGTATCCTGGAGCATCCAGGTGG - Intronic
1043350735 8:79358002-79358024 AGTATCAAGGAGCTTCATGGGGG + Intergenic
1044380872 8:91531831-91531853 AGTATATACCAGCATCTAGAAGG + Intergenic
1047366536 8:124216647-124216669 ATTATCCAGGATTATCTAGGTGG - Intergenic
1048896532 8:138997411-138997433 AGTATCCCGGATCATCTGGGTGG - Intergenic
1050893340 9:10852756-10852778 AGTAGCTAGGAGCCTCTTGGAGG - Intergenic
1057351150 9:94299945-94299967 AGCATCTTGGAGCTTCTAGTTGG - Exonic
1059772975 9:117445068-117445090 AGTTTCTAACAGCATCTAGAGGG + Intergenic
1062737395 9:138144825-138144847 AGTTTCTAGGAGCAAGTGGGAGG - Intergenic
1203671116 Un_KI270755v1:12886-12908 ATTTTCGAGGAGCATCAAGGAGG - Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1189636042 X:43010388-43010410 AGTATCAAGAAGCAACTAGGTGG + Intergenic
1195609580 X:106850934-106850956 GGTATGTAGAAGCATATAGGGGG - Intronic
1196714990 X:118802166-118802188 AGTACCTAGGAGCACTGAGGAGG + Intergenic
1201617307 Y:15914962-15914984 ATTCTCTTGGAGGATCTAGGTGG + Intergenic