ID: 1003121264

View in Genome Browser
Species Human (GRCh38)
Location 6:3320598-3320620
Sequence GAAGTGGCCCGCTGTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003121264_1003121270 16 Left 1003121264 6:3320598-3320620 CCCTCTCCACAGCGGGCCACTTC 0: 1
1: 0
2: 2
3: 9
4: 137
Right 1003121270 6:3320637-3320659 CAGAGCCCACTGCAGCAGATGGG 0: 1
1: 0
2: 1
3: 27
4: 246
1003121264_1003121271 19 Left 1003121264 6:3320598-3320620 CCCTCTCCACAGCGGGCCACTTC 0: 1
1: 0
2: 2
3: 9
4: 137
Right 1003121271 6:3320640-3320662 AGCCCACTGCAGCAGATGGGAGG 0: 1
1: 0
2: 3
3: 17
4: 252
1003121264_1003121269 15 Left 1003121264 6:3320598-3320620 CCCTCTCCACAGCGGGCCACTTC 0: 1
1: 0
2: 2
3: 9
4: 137
Right 1003121269 6:3320636-3320658 ACAGAGCCCACTGCAGCAGATGG 0: 1
1: 0
2: 1
3: 31
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003121264 Original CRISPR GAAGTGGCCCGCTGTGGAGA GGG (reversed) Intronic
900227044 1:1537838-1537860 GACGTGGCGCCCCGTGGAGAGGG - Intronic
900368546 1:2321356-2321378 GAGGTGGCCTCCTGTGGACACGG + Exonic
900432469 1:2609372-2609394 GGACCGGCCGGCTGTGGAGAAGG - Exonic
905793247 1:40801380-40801402 GAAGTGGCCTGCTTTGGAGAGGG - Intronic
906291047 1:44619352-44619374 GAAGAGGCGGGGTGTGGAGATGG + Intronic
908229209 1:62087176-62087198 GAAGTGGCTGTCAGTGGAGAGGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910897097 1:92080569-92080591 GACATGGCTCGCTGTGGGGAAGG + Exonic
916807050 1:168269383-168269405 GAGGTGGCCCCCTGTGGAACAGG + Intergenic
922065636 1:222137020-222137042 GGAGTGGCCTGCTTTGGAGAAGG - Intergenic
922756822 1:228101671-228101693 GCAGGGGCGTGCTGTGGAGATGG - Intronic
923443111 1:234040105-234040127 GAAGTGGCTCTCAGTGGAGAAGG + Intronic
1063201725 10:3790786-3790808 GAAGTGTGCCGGTGAGGAGATGG + Intergenic
1069458530 10:68572993-68573015 GAAGGGACACGCTGTGGTGAAGG + Exonic
1069900726 10:71705304-71705326 GCAGTGGTCAGGTGTGGAGAAGG - Intronic
1070204475 10:74242910-74242932 GAAATGGCTCTCAGTGGAGAGGG - Intronic
1073098099 10:100992621-100992643 GGGGTGGCCCGCTGTGGAGAAGG + Intronic
1074193373 10:111157333-111157355 CAAGGGGACTGCTGTGGAGAGGG + Intergenic
1076228257 10:128798747-128798769 GCAGTGAGCCTCTGTGGAGAAGG + Intergenic
1076246447 10:128950800-128950822 GAATTGCCACGTTGTGGAGAAGG + Intergenic
1076792570 10:132785116-132785138 CAAGCGGCACGCGGTGGAGATGG - Exonic
1078598136 11:12706843-12706865 GAAGAGGCCCATTATGGAGATGG - Intronic
1079023134 11:16925120-16925142 CAACTGGCCAGCAGTGGAGAGGG - Intronic
1079444299 11:20545674-20545696 GGCCTGGCCCTCTGTGGAGAAGG - Intergenic
1082819188 11:57532489-57532511 AAAGTAGCCCGGTGTGGTGACGG + Intergenic
1084473127 11:69374759-69374781 GCAGTGGACGGCAGTGGAGAGGG - Intergenic
1085452324 11:76642084-76642106 GAAGGGGCAGGCTGGGGAGATGG + Intergenic
1086002114 11:81996438-81996460 AAAGTGGCTCTCAGTGGAGAAGG + Intergenic
1088693399 11:112346411-112346433 GAAGCGGCCCAGTGAGGAGATGG - Intergenic
1089190624 11:116650790-116650812 GGAGTGGCCTGCTTGGGAGAGGG - Intergenic
1090548491 11:127792308-127792330 GAAGTATCCCGCTGAGCAGAGGG - Intergenic
1091875355 12:3929120-3929142 GAAGTGGCCCCAGGTGGAGGGGG + Intergenic
1094814079 12:34166746-34166768 GAACTGGCCGGCTGGCGAGACGG - Intergenic
1096771120 12:53936689-53936711 GTAGTGGGGCGCTGTGGACAGGG - Intergenic
1100281238 12:93120227-93120249 GCAGGGGCCCACTGTGGACAAGG + Intergenic
1101617401 12:106351586-106351608 GAAGGGACCCGAAGTGGAGACGG - Intergenic
1102554719 12:113719344-113719366 GCAGTGGGCCACTGTGGGGATGG - Intergenic
1105623240 13:22089065-22089087 TTAGTGGCCCCCTGTGGGGAAGG - Intergenic
1106108993 13:26760652-26760674 GCAGTTGCCCGCTGTGGCAAGGG + Exonic
1113015439 13:105823431-105823453 GGAGTAGGCAGCTGTGGAGAAGG - Intergenic
1113344015 13:109455997-109456019 GATGTGGACCTCTTTGGAGAGGG + Intergenic
1113662143 13:112114915-112114937 GAGGAGGCCAGCTTTGGAGACGG + Intergenic
1117333380 14:54736237-54736259 GATGTTGCCCACTGTGTAGAAGG + Intronic
1129151437 15:73690809-73690831 GAAGCAGCCCACTGTGGTGAGGG + Intronic
1129886771 15:79043680-79043702 GAAGTGGCTACCTGGGGAGATGG + Intronic
1131367764 15:91854102-91854124 GAAGGGGCCCGCGGCGGAGTTGG - Intronic
1131400225 15:92119504-92119526 GAAGAGACCCGCTAAGGAGAAGG + Intronic
1137690954 16:50427185-50427207 AAACTGGCATGCTGTGGAGAAGG - Intergenic
1139208185 16:65049835-65049857 GATGTAGGCCACTGTGGAGAAGG - Intronic
1139281107 16:65771282-65771304 AAAGTTCTCCGCTGTGGAGAGGG - Intergenic
1141080159 16:81043774-81043796 GCAGTGGCCCACTGTGCAGAAGG - Exonic
1141196328 16:81864307-81864329 GAAATGGCCACCTGTGGTGAGGG - Intronic
1141689468 16:85588143-85588165 CAAGAGGCCAGCTGGGGAGAGGG - Intergenic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1151018490 17:70584789-70584811 AAAATGGCCCTCAGTGGAGAGGG + Intergenic
1155169918 18:23259824-23259846 GAAGCTGCCCTCTGTGGAGGAGG - Exonic
1155243760 18:23887727-23887749 AGAGTGGCCAGCTGTGGGGAGGG + Intronic
1155681484 18:28492108-28492130 GAAGTGGCAGGGTGGGGAGAAGG - Intergenic
1157564231 18:48668813-48668835 CAAGTGCCCCGCTGGGGACAAGG - Intronic
1157833570 18:50879054-50879076 GGCGTGGCCCACGGTGGAGACGG - Exonic
1160703841 19:519950-519972 GAAGAGGCCAGCTGGGCAGATGG + Intergenic
1163783237 19:19261381-19261403 GAAGTGGCCAAGTGCGGAGAGGG - Intronic
1165084293 19:33332551-33332573 GAAGAGGCCCTCTCAGGAGAAGG - Intergenic
1166395072 19:42433643-42433665 CATGTGGCAGGCTGTGGAGAGGG + Intronic
1167502635 19:49856376-49856398 GGGGTGGCCCGGTGTGGGGAGGG + Intronic
1167687738 19:50967231-50967253 CAAGTGGCCCGAGGTGTAGAGGG + Exonic
1168346185 19:55651271-55651293 GCAGTGGTCCTCTGGGGAGATGG - Exonic
928374155 2:30761476-30761498 GCAGAGGCTGGCTGTGGAGATGG - Intronic
929957227 2:46467304-46467326 GAGGTGCCCCTCTTTGGAGATGG - Intronic
931244077 2:60478297-60478319 GAAGTGTCCTGCTGTGGACAGGG + Intronic
931676874 2:64705987-64706009 GAGCTGGCTCCCTGTGGAGATGG + Intronic
931717057 2:65037598-65037620 GAGGGTGCCAGCTGTGGAGATGG - Intergenic
932442787 2:71748402-71748424 GAAATGGCCTGCTGTGGCCAGGG + Intergenic
933674681 2:85044282-85044304 GAAATGGCTCTCTCTGGAGAAGG - Intronic
933950510 2:87325463-87325485 GAGGTGCCGCCCTGTGGAGAGGG - Intergenic
936329268 2:111533116-111533138 GAGGTGCCGCCCTGTGGAGAGGG + Intergenic
936858410 2:116987446-116987468 GAAATGGCTCTCAGTGGAGACGG - Intergenic
938143146 2:128812663-128812685 GAAGTGGCCTGGTCAGGAGACGG + Intergenic
938237941 2:129721954-129721976 GACAGGCCCCGCTGTGGAGACGG - Intergenic
942444897 2:176071378-176071400 GAGGTGGCCCACTCCGGAGAGGG + Intergenic
946458266 2:219847286-219847308 GAAGAGGCAAGCTATGGAGATGG - Intergenic
947640800 2:231706883-231706905 GCAAAGCCCCGCTGTGGAGACGG + Intronic
948514445 2:238495002-238495024 GGAGTGGCCCAGTGTGGGGAAGG - Intergenic
948989347 2:241544607-241544629 GAATTTGTCCGCTGTGGATAAGG + Intergenic
1169119089 20:3084609-3084631 GAAGTAGCACGCGGAGGAGAAGG + Exonic
1170072207 20:12381264-12381286 GAAGTAGCAAGCTGGGGAGATGG - Intergenic
1176034086 20:63028033-63028055 GGAGTGGACCGGTGGGGAGAGGG + Intergenic
1176990492 21:15490713-15490735 CAAGTGGCACACTGTGGAAAAGG - Intergenic
1179080955 21:38170283-38170305 AAAGTGGCCCAGTTTGGAGAAGG - Intronic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180784599 22:18539743-18539765 GGTGTGGCCAGCTGTGGAGAGGG - Intergenic
1180790563 22:18573455-18573477 GAGTTGGCCTGCTGTGGAAATGG - Intergenic
1181128177 22:20713796-20713818 GGTGTGGCCAGCTGTGGAGAGGG - Intronic
1181179493 22:21056838-21056860 GAACTTGCCTGCTGGGGAGAGGG - Intronic
1181231175 22:21421860-21421882 GAGTTGGCCTGCTGTGGAAATGG + Intronic
1181241502 22:21479100-21479122 GGTGTGGCCAGCTGTGGAGAGGG - Intergenic
1181247476 22:21513008-21513030 GAGTTGGCCTGCTGTGGAAATGG - Intergenic
951069659 3:18312323-18312345 AAAGTGGCCCGCCTAGGAGAAGG - Intronic
954837765 3:53484912-53484934 GAAGTGGCCTGCTGAAGGGAAGG + Intergenic
955612066 3:60768367-60768389 GAAGGTCCCCACTGTGGAGAAGG + Intronic
958582363 3:96043898-96043920 GAAGTGGACCTCTGTCAAGAAGG - Intergenic
959157476 3:102684546-102684568 GATGTAGGCCGCTTTGGAGAGGG - Intergenic
962243878 3:133775369-133775391 AAGGTGCCCCGCTGGGGAGATGG - Intronic
966277692 3:178195285-178195307 GAGGTGGTCAGCTGTGAAGAGGG - Intergenic
967784058 3:193470828-193470850 GAGGTTGTCAGCTGTGGAGATGG + Intronic
969201433 4:5609465-5609487 GAAATGGCCGACTGTGAAGATGG + Intronic
971749740 4:30631923-30631945 GAAATGGTTCTCTGTGGAGAGGG - Intergenic
977257837 4:94759073-94759095 GAAGTTGTCCGCTGTGGTGCGGG + Intronic
980627487 4:135391915-135391937 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
982036647 4:151352685-151352707 GAAGTTCCCAGTTGTGGAGACGG + Intergenic
986076190 5:4340421-4340443 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
992205930 5:74430272-74430294 GAAGTGGCTCTCAGTAGAGAGGG - Intergenic
995420630 5:111962884-111962906 GAAGTGGCTGTCAGTGGAGAGGG - Intronic
997366535 5:133328885-133328907 GAAAAGGCCGGCTGTGGAGCTGG + Intronic
999229285 5:150052277-150052299 GAAGTGGTCTCCTGTGGGGAGGG + Exonic
999861804 5:155655926-155655948 GAAATGGCTAGCTGTAGAGAAGG + Intergenic
1002043909 5:176531733-176531755 GAGGTAGGCCGCCGTGGAGAAGG - Intronic
1002653659 5:180724104-180724126 GAGGTGGCCAGGTGTGGAGAAGG + Intergenic
1003121264 6:3320598-3320620 GAAGTGGCCCGCTGTGGAGAGGG - Intronic
1004130519 6:12914961-12914983 GAACTGGCCCTCTGTGATGAAGG + Intronic
1006519846 6:34564885-34564907 GAAGTGGCCTGGAGGGGAGAAGG + Intergenic
1007448784 6:41927414-41927436 GGAGTGGCCCACCCTGGAGAAGG + Exonic
1009926773 6:70129873-70129895 GAAGTGGCCAGATGTGGATTTGG + Intronic
1010556154 6:77281940-77281962 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
1014627552 6:123747068-123747090 TCAGTGGCTAGCTGTGGAGAGGG - Intergenic
1015512495 6:134052414-134052436 GAAGGGGACAGCCGTGGAGACGG - Exonic
1017760226 6:157562783-157562805 GAAGTGTAGTGCTGTGGAGAGGG + Intronic
1019351287 7:555201-555223 GACGTGCCCCGCTCTGGGGAGGG + Intronic
1026674856 7:72419908-72419930 GAAGTGGCTCTTGGTGGAGAGGG - Intronic
1028951209 7:96637120-96637142 GAAGTGATCTGTTGTGGAGAGGG + Intronic
1030609693 7:111675911-111675933 GCATTGGCCAGCAGTGGAGAGGG - Intergenic
1034276241 7:149825048-149825070 GCAGAGGCCCTCTGTGGAGGAGG + Intergenic
1037865686 8:22440850-22440872 GAAGGGGCCGGCTGCGGGGAGGG + Intronic
1039630745 8:39108566-39108588 CAAATGGACCACTGTGGAGAGGG + Intronic
1043927443 8:86053269-86053291 CAAGTGGCAAGCTGGGGAGATGG - Intronic
1045118749 8:99013008-99013030 GAAGTGGCGCTCCGGGGAGAAGG - Intergenic
1045694082 8:104788231-104788253 GAAATGGCCCGATGTGCAGGCGG + Intronic
1049541565 8:143211396-143211418 GAGGTGGGACGCTGGGGAGAAGG + Intergenic
1052848008 9:33354466-33354488 GAGGTGGCCATCTCTGGAGAGGG + Intronic
1056758581 9:89398410-89398432 GAAGTGGCTCTCAGCGGAGATGG - Intronic
1057463929 9:95293616-95293638 GCGGTGGCCCACTGTGCAGAAGG - Intronic
1058455992 9:105138725-105138747 GAAGAAGCCAGCTGTGGGGAGGG - Intergenic
1060892837 9:127199385-127199407 GAAGTGGCCTGTTCTTGAGATGG + Intronic
1060927352 9:127464221-127464243 GAAAGGGCCGGCTGGGGAGATGG + Intronic
1062184099 9:135207439-135207461 GAACTTGCCCTCTGTGGACAGGG + Intergenic
1190152069 X:47957205-47957227 GAGGTGGCCCGCTTGGGAGGAGG - Intronic
1195854084 X:109311417-109311439 GAAATGGCTCTCAGTGGAGAGGG + Intergenic
1196976323 X:121161587-121161609 AAAGTGGCCTGCTGTGAAGGGGG - Intergenic
1199522434 X:148751277-148751299 GATGTGGACTGCTGTGGACAGGG + Intronic