ID: 1003123919

View in Genome Browser
Species Human (GRCh38)
Location 6:3340106-3340128
Sequence CTGGATAATACCGCTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123919_1003123930 8 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123930 6:3340137-3340159 GCCTGGAGAAGGGAATGGTAAGG No data
1003123919_1003123928 -2 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG 0: 1
1: 1
2: 3
3: 50
4: 631
1003123919_1003123933 13 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123933 6:3340142-3340164 GAGAAGGGAATGGTAAGGGCAGG No data
1003123919_1003123935 15 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123935 6:3340144-3340166 GAAGGGAATGGTAAGGGCAGGGG No data
1003123919_1003123927 -3 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG 0: 1
1: 0
2: 9
3: 75
4: 601
1003123919_1003123929 3 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG 0: 1
1: 1
2: 3
3: 79
4: 817
1003123919_1003123934 14 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG 0: 1
1: 0
2: 6
3: 75
4: 944
1003123919_1003123925 -9 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123925 6:3340120-3340142 ATTATCCAGGAGGGATGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 234
1003123919_1003123936 27 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123936 6:3340156-3340178 AAGGGCAGGGGCTTTGAAATTGG 0: 1
1: 0
2: 2
3: 43
4: 365
1003123919_1003123932 9 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123932 6:3340138-3340160 CCTGGAGAAGGGAATGGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003123919 Original CRISPR CTGGATAATACCGCTTTTGT GGG (reversed) Intronic
901079868 1:6577914-6577936 CAGGATACGACTGCTTTTGTAGG - Intronic
910066974 1:83165607-83165629 CTTGATAATACCTGTCTTGTAGG - Intergenic
912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG + Intergenic
919413387 1:197275349-197275371 TTGGTTAATACCACTTTTATTGG + Intronic
923084302 1:230690796-230690818 ATGTATAATACAGTTTTTGTGGG + Intronic
1062888855 10:1040383-1040405 CTGGATAAAACCCCTGTGGTGGG - Exonic
1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG + Intronic
1068330142 10:55554574-55554596 ATCGAAAATACAGCTTTTGTGGG + Intronic
1074797886 10:116967309-116967331 TTGGAAAGTACAGCTTTTGTGGG + Intronic
1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG + Intergenic
1076037672 10:127214535-127214557 CTGAATAATACTCCTGTTGTAGG + Intronic
1081250757 11:40830349-40830371 GTTGATAATACTGCTTTGGTTGG - Intronic
1082039752 11:47675115-47675137 CTGGATAATACAACTTTAATAGG - Intronic
1087543849 11:99558585-99558607 CTGTATAATAGCTCTTTTGCAGG - Intronic
1089924686 11:122245269-122245291 ATGGATAATACAGCTTATGGGGG - Intergenic
1100351351 12:93786378-93786400 AATGATAATACCTCTTTTGTAGG + Intronic
1105845299 13:24288926-24288948 TTGAATAGTACAGCTTTTGTAGG - Intronic
1107587571 13:41868227-41868249 CTTGATAGTACTGCTTCTGTCGG - Intronic
1107842711 13:44475916-44475938 CTGGAGACTGCCACTTTTGTTGG - Intronic
1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG + Intergenic
1126425808 15:48525910-48525932 CTGGATCATCCCTCTTTTATGGG + Intronic
1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG + Intergenic
1129983366 15:79895075-79895097 ATGGATAATATCACTCTTGTAGG - Intronic
1130732675 15:86515183-86515205 CTGAATAATACCTCTTGTCTAGG + Intronic
1136564201 16:31060491-31060513 ATGAACAATACCCCTTTTGTGGG + Intergenic
1137321105 16:47383527-47383549 TTGGATAGTAGCGCTTGTGTAGG - Intronic
1149572778 17:57685435-57685457 CTGGAGAATACAGCTTTCCTGGG - Intergenic
1155610040 18:27656453-27656475 CTGAACAATAACACTTTTGTAGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
932441686 2:71741308-71741330 CTTGATAATACTCCTTTTATCGG - Intergenic
939979808 2:148766578-148766600 CTGGAAAATTACTCTTTTGTAGG - Intronic
942316280 2:174699363-174699385 CTGGATAATAACTCCTTTGAGGG - Intergenic
943483077 2:188446302-188446324 CTGGATAATAGCTATTTTCTGGG + Intronic
945465019 2:210159131-210159153 CCTGATAATACCAATTTTGTAGG - Intronic
1175757332 20:61538128-61538150 CTGGAAAATACAGCTTTGGGTGG - Intronic
1203293066 22_KI270736v1_random:14038-14060 CTGGATAAGACAGCATTTGGAGG - Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
956582180 3:70826267-70826289 CTGGATGATACCCTTTATGTAGG - Intergenic
956793688 3:72699895-72699917 CTGGATAACGCAGCCTTTGTTGG - Intergenic
957543349 3:81604745-81604767 CATGAAAATACCACTTTTGTAGG - Intronic
974376880 4:61089508-61089530 CTAGATTATACCACATTTGTAGG + Intergenic
976959788 4:90956230-90956252 CTGTATAATAATGCTTCTGTAGG - Intronic
978788204 4:112633747-112633769 TTGGATAAAACTGTTTTTGTGGG + Intronic
979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG + Intronic
979662696 4:123276371-123276393 CTGGATATTATATCTTTTGTGGG + Intronic
986370996 5:7079870-7079892 CTGGAGAATACACCTTCTGTAGG + Intergenic
987879832 5:23729248-23729270 CTGGACAATACCTTGTTTGTAGG - Intergenic
990080324 5:51904571-51904593 ATGGATAATACCACATATGTAGG - Intergenic
990088020 5:52003075-52003097 CTTGATACTACCTCTTCTGTAGG + Intergenic
991675825 5:69089121-69089143 CTGGATTATACTGGTTATGTAGG - Intergenic
999807799 5:155100001-155100023 CTGCATAATATTTCTTTTGTGGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1007188009 6:39988926-39988948 TTGGATGATACTGATTTTGTTGG + Intergenic
1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG + Intergenic
1010140578 6:72610103-72610125 CAGGATAATTCCTTTTTTGTGGG + Intergenic
1012970947 6:105729982-105730004 CTGGAAAATATCCCTTTTCTGGG - Intergenic
1021402725 7:20228133-20228155 TTAGATAATACCTGTTTTGTAGG - Intergenic
1024261137 7:47574650-47574672 CTGAATAATACCGTGTGTGTGGG - Intronic
1027277135 7:76569151-76569173 CTTGATAATACCTGTCTTGTAGG + Intergenic
1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG + Intergenic
1030553916 7:110999348-110999370 CTGGATTGTACCTCTTTTATTGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1043578383 8:81683830-81683852 TTGGATCATACTGATTTTGTGGG - Intronic
1055584917 9:77748823-77748845 CTGGATCATACCTCACTTGTGGG - Intronic
1059140707 9:111850557-111850579 CTGCATCATACAGCATTTGTAGG - Intergenic
1187489014 X:19732463-19732485 ATAGATAATACAGCATTTGTGGG - Intronic
1191917613 X:66219831-66219853 CTGGATTATACTGGATTTGTGGG - Intronic
1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG + Exonic
1194491390 X:94554348-94554370 CTGAATAATACAGATTTTGGTGG + Intergenic
1194589163 X:95775512-95775534 GTGGATAATGCCTCCTTTGTGGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic