ID: 1003123927

View in Genome Browser
Species Human (GRCh38)
Location 6:3340126-3340148
Sequence CAGGAGGGATGGCCTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 9, 3: 75, 4: 601}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123915_1003123927 15 Left 1003123915 6:3340088-3340110 CCTAGCCCAGAGAGCGCTCCCAC 0: 1
1: 1
2: 1
3: 19
4: 190
Right 1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG 0: 1
1: 0
2: 9
3: 75
4: 601
1003123917_1003123927 9 Left 1003123917 6:3340094-3340116 CCAGAGAGCGCTCCCACAAAAGC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG 0: 1
1: 0
2: 9
3: 75
4: 601
1003123916_1003123927 10 Left 1003123916 6:3340093-3340115 CCCAGAGAGCGCTCCCACAAAAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG 0: 1
1: 0
2: 9
3: 75
4: 601
1003123920_1003123927 -4 Left 1003123920 6:3340107-3340129 CCACAAAAGCGGTATTATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG 0: 1
1: 0
2: 9
3: 75
4: 601
1003123919_1003123927 -3 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG 0: 1
1: 0
2: 9
3: 75
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003123927 Original CRISPR CAGGAGGGATGGCCTGGAGA AGG Intronic
900155894 1:1203159-1203181 AGAGAGGGCTGGCCTGGAGACGG + Intergenic
900226865 1:1537056-1537078 GCACAGGGATGGCCTGGAGAGGG - Intronic
900482125 1:2904463-2904485 CGGAAGGGATGCCCTGGGGAGGG + Intergenic
900649494 1:3723955-3723977 CAGGAGAGGTGGCCTGCAGGAGG + Intronic
900702610 1:4057708-4057730 TGGGAGGTAGGGCCTGGAGATGG + Intergenic
901272093 1:7960391-7960413 CAGGAAGGGTAGCCAGGAGAAGG + Intronic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902334950 1:15749347-15749369 GAGGAGGGGAGGCCTGGAGAGGG + Intergenic
902705268 1:18199952-18199974 CAGGAGGGATGGGTAGGAGCGGG + Intronic
903656590 1:24952662-24952684 CAGGAGGAATGGCCTAGCGATGG - Intronic
903999852 1:27332736-27332758 CAGCTGAGATGGCCTGGAGCAGG + Intronic
904277561 1:29394401-29394423 CAGGAGGGATGTGCTGCACAGGG - Intergenic
904379448 1:30101239-30101261 AAGGAGGAAGGGCCTGGGGAGGG + Intergenic
904634837 1:31871897-31871919 CAGGAGGAAAGGCCCTGAGATGG + Intergenic
905069168 1:35210373-35210395 CAGGAGGGAGGGCCCAGGGAGGG + Intergenic
905224772 1:36472037-36472059 GTGGAGGGATGGCCTTCAGAGGG + Intronic
905304071 1:37005534-37005556 CAGGAGGGATCGCCAGGGGCTGG + Intronic
905732545 1:40306550-40306572 CAGGAGGTATGGAATGGAGATGG + Intronic
906021371 1:42632256-42632278 CAGGAGCTAGGGCCTGGAAAGGG + Intronic
906120562 1:43387635-43387657 CAGGACAGATGGCCTGGTGGTGG + Exonic
906229972 1:44153692-44153714 CAGGAGGGGTGGCCTTGGGCGGG - Intergenic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
907441935 1:54484272-54484294 CAGCGGGGAATGCCTGGAGAGGG + Intergenic
907608840 1:55847326-55847348 CAGGAGAGATGGCCTCCAGGAGG + Intergenic
907869690 1:58432078-58432100 GAGTAGGGACAGCCTGGAGACGG - Intronic
909054518 1:70806218-70806240 TAGGAGCCATGGGCTGGAGAGGG - Intergenic
909323723 1:74322788-74322810 TAGTAGTGTTGGCCTGGAGATGG - Intronic
910523930 1:88155872-88155894 GAGGATGGAGGGCCTGGAGGTGG - Intergenic
910724926 1:90328300-90328322 CAGGAGCCAAGGCCTGGAAATGG - Intergenic
911214738 1:95179826-95179848 CAGGAGGCATTGCCAGTAGATGG - Intronic
911540064 1:99146953-99146975 CAGTAGAGAAGCCCTGGAGACGG - Intergenic
912242606 1:107927144-107927166 CAGGAGCTAGGGCCTGGAAAGGG - Intronic
912280569 1:108308573-108308595 CAGGAGGTAGGGCCTGGAACAGG + Intergenic
912287657 1:108385784-108385806 CAGGAGGTAGGGCCTGGAACAGG - Intronic
915581686 1:156816605-156816627 CAGGAGGGAGGGCAGGGGGATGG + Intronic
916068327 1:161154271-161154293 AAGGAGGGATGGTGGGGAGAGGG + Intronic
916577701 1:166081991-166082013 GAGGAGAAATGGCTTGGAGAAGG - Intronic
919074255 1:192794755-192794777 CAGGAAGCATGGCATGTAGAAGG + Intergenic
919498522 1:198308444-198308466 AAGGAGGTGTGGCCTGGAGAGGG - Intronic
919747279 1:201016781-201016803 CAGGAGGGCTGGCCTGGGGAAGG - Intronic
919799501 1:201344918-201344940 CAGGAGGGGTGGGCTGGGGCTGG - Intergenic
920054248 1:203181127-203181149 AAGGAGGGAGGGCCAGGAGGGGG - Intronic
920379038 1:205525229-205525251 CAGGCAGGATGGCTTGGAGGAGG + Intronic
922025210 1:221742980-221743002 CGGGAGGGTTAGCCTGGGGACGG - Intergenic
922169311 1:223141998-223142020 CAGAAGGGAAGCCCTGGAGCAGG - Intronic
923093534 1:230757267-230757289 CAGGGAGGATCTCCTGGAGAAGG - Intronic
923663371 1:235977976-235977998 CAGTAGTTATGGCCTGGAAAAGG + Exonic
923671970 1:236048857-236048879 CACGACCGATGGCCTGGGGAAGG - Exonic
924269509 1:242318260-242318282 GAGGTGGGATGGCCTGCAGAGGG + Intronic
1063338750 10:5243295-5243317 GAGGAGAGATTGCCTGCAGATGG + Intergenic
1064436600 10:15316355-15316377 CAGCAGGAATGGCCTGGTGAGGG - Intronic
1065665901 10:28060427-28060449 CAGGAAGGATGGCCTGTAGTGGG - Intronic
1066715393 10:38280511-38280533 GAGGTGGGATGGCCTGCAGAGGG - Intergenic
1066725000 10:38382405-38382427 CAGGAAGGATGGTCTGTAGGTGG + Intergenic
1066782702 10:38970201-38970223 GAGGTGGGATGGCCTGCAGAGGG + Intergenic
1067017726 10:42770403-42770425 CAGGAAGGAAGGCCAGGAGAGGG - Intergenic
1068610912 10:59058971-59058993 AAGGAGAAATTGCCTGGAGAAGG - Intergenic
1069597505 10:69681914-69681936 CAGGTGAAAAGGCCTGGAGATGG + Intergenic
1069865025 10:71496927-71496949 CGGAAGGGATGCCCCGGAGATGG + Intronic
1069994407 10:72333689-72333711 CAGAAGGGAAGGCCTGCAGAGGG - Exonic
1070610178 10:77927122-77927144 CCGGAGGGACGGCCTGGGGAGGG - Intergenic
1071922378 10:90365955-90365977 CAGGAGGTACGGCCTGGGGGAGG - Intergenic
1073352795 10:102831778-102831800 TAGGAGGGAAGGGATGGAGAAGG - Intronic
1074670126 10:115780658-115780680 CAGGAGCTAGGGCCTGGAAAGGG - Intronic
1075399451 10:122150556-122150578 AAAGAGGGGTGGCCAGGAGACGG + Intronic
1076082843 10:127599137-127599159 TGGGAAGGATGGGCTGGAGAAGG - Intergenic
1076704649 10:132294417-132294439 CTGGAGGGGAGGCCTGCAGACGG + Intronic
1076902420 10:133346535-133346557 CAGGAGGGAGCGCCTGGAAGGGG + Intronic
1076984151 11:223434-223456 CAGGAGGCTGGTCCTGGAGAAGG - Intronic
1077024125 11:431821-431843 GGGGTGGGCTGGCCTGGAGAGGG - Intronic
1077097173 11:803981-804003 CGGGAGGGGCGGCCTGGAGCTGG + Intronic
1077295109 11:1822902-1822924 GAGGAGGGTTGGCCTGGGGGTGG - Intergenic
1077328934 11:1975595-1975617 CAGGAGGTTGGCCCTGGAGATGG - Intronic
1077372073 11:2187048-2187070 CAGGAGGCACGGCCGGGCGAAGG + Intergenic
1077507828 11:2940330-2940352 CAAGAGGGAACGCCTGGAGATGG - Intergenic
1078042725 11:7883687-7883709 CAGAGAGGAGGGCCTGGAGAAGG + Intergenic
1078042735 11:7883758-7883780 CAGAGAGGAGGGCCTGGAGAAGG + Intergenic
1078359996 11:10660751-10660773 CAGGAGGAGTGGGCTGGGGAGGG - Intronic
1078567356 11:12427989-12428011 GAGGAGGGGAGGCCTGGAGATGG - Intronic
1079660965 11:23035896-23035918 CAGGAGGGGTAGCATGCAGATGG - Intergenic
1079701730 11:23556475-23556497 CAGGAGCTAGGGCCTGGAAATGG + Intergenic
1080230863 11:30016862-30016884 CAGGAGGGATTGCCTGGGAAAGG + Exonic
1080600246 11:33815753-33815775 CAGGAGGGATGTCCTTGAATAGG + Intergenic
1081668301 11:44929289-44929311 CATCAGAGATGGCCAGGAGAAGG + Exonic
1081751171 11:45512178-45512200 CAGGAGGGATAGACTGCAGTGGG + Intergenic
1082807148 11:57458619-57458641 CTGGGGGGAGGGCCTGGAGGCGG - Intergenic
1083454272 11:62768030-62768052 AAGTGGGGATGCCCTGGAGATGG + Intergenic
1083580061 11:63818993-63819015 CAGGAGGGCTCACCTGGAGAGGG - Exonic
1083665311 11:64270845-64270867 CAGGAGCTTTGGCCTGGAGTGGG + Intronic
1083728658 11:64641768-64641790 CAGGAGGGGAAGCCTGGAAACGG + Intronic
1084308216 11:68300284-68300306 CAGGGGTGAGGGCCTGGAGGAGG + Intergenic
1084693168 11:70738708-70738730 CAGGGGACATAGCCTGGAGACGG - Intronic
1085267335 11:75244689-75244711 CATGAGGAATGACTTGGAGAAGG - Intergenic
1085531387 11:77194252-77194274 CAGGAGGCAGGGCCAGGAGAGGG + Intronic
1085551705 11:77379589-77379611 CTGGAGGTATAGCCTGGTGAAGG - Intronic
1086866326 11:91984240-91984262 CAGGAGGGAGGGCAGGGGGAAGG + Intergenic
1088231333 11:107676505-107676527 CAGGAGGGTTGAGCTGCAGAAGG - Intergenic
1088729458 11:112668075-112668097 CAGGCAGGATGCCTTGGAGATGG + Intergenic
1089138871 11:116270762-116270784 CAGGAGGGAGGGGCAGGAGCTGG - Intergenic
1089209237 11:116789424-116789446 CCAGAGGGAGGGGCTGGAGATGG + Exonic
1089385184 11:118062637-118062659 GTGGAGGGAGGGCCAGGAGAGGG - Intergenic
1089854603 11:121532072-121532094 CAGGAAGGATGGGCTATAGAGGG + Intronic
1090221556 11:125031179-125031201 CATCAGGGATGTCCTGGAAAGGG + Intronic
1090619403 11:128548283-128548305 CACCAGGCATGGCGTGGAGAAGG - Intronic
1090657867 11:128859702-128859724 CGGGAGGGCTAGCCAGGAGAGGG - Intronic
1090669714 11:128937740-128937762 CAGGAGGCAGGGCCTGGGCAGGG - Exonic
1090972760 11:131657045-131657067 GAGGAAGGCGGGCCTGGAGAAGG + Intronic
1091058998 11:132444351-132444373 CAGGAGGTATGTGATGGAGAAGG - Intronic
1202811913 11_KI270721v1_random:30774-30796 CAGGAGGTTGGCCCTGGAGATGG - Intergenic
1091551622 12:1539390-1539412 CGGGAGAGATGGCCTTGTGAGGG - Intronic
1091752805 12:3033166-3033188 CAGGGAGGCTGGACTGGAGACGG - Intronic
1091986633 12:4915029-4915051 CAGGAGGGAAGGCCTAGGAAAGG - Exonic
1092242468 12:6843622-6843644 CAGGAGAGATAACCTGGAGGCGG - Exonic
1093249675 12:16786712-16786734 CAGCAGGGATCATCTGGAGATGG - Intergenic
1093491556 12:19710730-19710752 CAGCAGGGTTGGCATGGAGAGGG + Intronic
1094244167 12:28268716-28268738 CAGTAGGGATGGCATGGGGAAGG + Intronic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1096452507 12:51756171-51756193 GACGAGGGGTGGCCTGGTGAGGG - Intronic
1096454073 12:51770705-51770727 GAGGAGGGATTGGCTGGGGAAGG + Intronic
1096579684 12:52576647-52576669 CAGAAGTGATGGGCTGGGGAGGG + Intergenic
1096628011 12:52907093-52907115 CAGGAGGCAGGGCCTGGGGAGGG - Intronic
1096867950 12:54576370-54576392 CAGGAGGGAAGATGTGGAGAGGG + Intronic
1097319250 12:58207241-58207263 CAGGAGGAATTGCCCAGAGAAGG - Intergenic
1097425983 12:59445540-59445562 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1098333908 12:69382326-69382348 CAGGAGCCAGGGCCTGGAGTTGG + Intronic
1098339466 12:69436891-69436913 CTGGAGTGATGGCCTAGAGCAGG + Intergenic
1099590015 12:84575231-84575253 GAGGAAGGATGGTCTGGATATGG - Intergenic
1100789628 12:98116234-98116256 CAAGAGGGAAAGGCTGGAGAGGG + Intergenic
1101056885 12:100926819-100926841 CAAGAGAGATGCCCTGTAGAGGG + Intronic
1101086293 12:101239715-101239737 CAGAAAGGAGGCCCTGGAGAGGG - Intergenic
1101580384 12:106037364-106037386 CAGGAGGGGTGGGGAGGAGAGGG - Intergenic
1101883606 12:108642485-108642507 CAGGAGGGCTGGGTGGGAGATGG - Intergenic
1102544157 12:113642646-113642668 AAGGAGGGATGGAGGGGAGAAGG - Intergenic
1102663214 12:114547582-114547604 CAGCAGGGGTGACCTGCAGAAGG + Intergenic
1102664833 12:114563023-114563045 CAGCAGGGGTGACCTGCAGAAGG - Intergenic
1103282940 12:119775403-119775425 CAGGAGGCCTGCCCTGCAGAAGG - Intronic
1103317883 12:120071725-120071747 CAGGAGGGATGTGCTGGTGGCGG - Exonic
1104964142 12:132501443-132501465 CAGGGGTGATGGCCGGGGGAGGG + Intronic
1105021024 12:132816982-132817004 CAGGCGGGGTGGCCAGGATAAGG + Intronic
1105774925 13:23649969-23649991 CAGGTGGTCTGTCCTGGAGAAGG + Intronic
1106237908 13:27880721-27880743 CAGGAGGTATGCCCAGGAAAAGG - Intergenic
1106819728 13:33451357-33451379 CATGAGGGATGGACTGGGGGTGG + Intergenic
1106855699 13:33849504-33849526 TATCAGTGATGGCCTGGAGAAGG - Intronic
1108255997 13:48611661-48611683 CAGGAGCTAGGGCCTGGAAAGGG + Intergenic
1108584894 13:51862660-51862682 TAGGAGAGATGGCCTGGAGGAGG + Intronic
1108950247 13:56083649-56083671 CAGGAGAGAAGGGCAGGAGAAGG - Intergenic
1110737798 13:78958336-78958358 CAGGAGGGAGGGGCATGAGAGGG + Intergenic
1112077238 13:95928316-95928338 CGGGACGGCTGGCCTGGCGAGGG + Intronic
1112496596 13:99910526-99910548 CAGGAGCCATGGCCAAGAGAGGG + Intergenic
1113889566 13:113728802-113728824 AAGGAGGGATGCCCTGGAGAGGG + Intronic
1114417314 14:22553524-22553546 CAGTAGGGCTGACCAGGAGAAGG - Intergenic
1114658693 14:24331329-24331351 CAGGAAGGATGGACAAGAGAAGG + Exonic
1115745295 14:36430340-36430362 CAGGAAGAATAGCATGGAGATGG + Intergenic
1116220924 14:42085939-42085961 CAGGAGCTAGGGCCTGGAAAGGG + Intergenic
1116413270 14:44650136-44650158 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1116430003 14:44835795-44835817 CAGGAGTGAGGGGCTGGGGAGGG + Intergenic
1117406810 14:55411884-55411906 CAGGAGGAGGGGCCTGGGGAAGG + Intergenic
1118065415 14:62185341-62185363 CTGGAGGGATGGCATGAGGAGGG + Intergenic
1118251988 14:64170696-64170718 GAGGAGGCATGGAGTGGAGATGG + Intronic
1118800278 14:69183472-69183494 CAGGATTGATTCCCTGGAGAGGG - Intergenic
1119138040 14:72238635-72238657 CAGCAGGGAGGGCCTGTAGAGGG + Intronic
1119519066 14:75272187-75272209 CAGGAGGGGCTTCCTGGAGAAGG + Intergenic
1119749446 14:77067072-77067094 GAAGAGGGCTGGCATGGAGAAGG - Intergenic
1119948316 14:78717925-78717947 AAGGAGTGATGGCCCAGAGAAGG + Intronic
1120045365 14:79799673-79799695 GAGGACGGGTGGGCTGGAGAAGG - Intronic
1120134357 14:80848328-80848350 CAGGATGGTTGGCCTAGAGTTGG + Intronic
1120901912 14:89582766-89582788 CAGGGGAGATGGCTGGGAGAAGG - Intronic
1121024282 14:90603087-90603109 CAGGAGGGATGGGCTCCAGGTGG + Intronic
1122060150 14:99131839-99131861 CAGCAGGAATGGGCTGGGGAGGG + Intergenic
1122202400 14:100130537-100130559 CAGCTGGGAGGGCCAGGAGAAGG - Intronic
1122413470 14:101537683-101537705 CAGGATGGAAGGCCTCTAGAAGG + Intergenic
1122425307 14:101602170-101602192 CTGGAAGCAGGGCCTGGAGAAGG + Intergenic
1122459766 14:101885155-101885177 CACGGGCCATGGCCTGGAGAAGG + Intronic
1122507326 14:102239936-102239958 CAGTAAGGATGACCTGGAAAGGG - Intronic
1122985241 14:105208840-105208862 CAGGATGGGGGGCTTGGAGAAGG - Intergenic
1123149535 14:106167526-106167548 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1123173042 14:106391873-106391895 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1124110310 15:26779400-26779422 AAGTAGGGAAGGCCTGGAGAGGG + Intronic
1124341734 15:28894340-28894362 CAGGAGGGAGGGCATGGAGGGGG + Intronic
1124625842 15:31307033-31307055 CTGGGGGGATGGCCTGGGGCTGG + Intergenic
1124811531 15:32944093-32944115 CAGAAGGGAGTGCCTGGGGAAGG + Intronic
1124982062 15:34575829-34575851 CAGGAGGGAGGGCATGGAAGGGG - Intronic
1125204075 15:37131349-37131371 GAAGAGGGATGGACTGAAGAGGG + Intergenic
1125567145 15:40685391-40685413 CAGGAGGCAAGGCCTGGAAATGG + Intergenic
1125741192 15:41966067-41966089 CAGAAGGGAAGCCATGGAGAGGG - Intronic
1125767468 15:42145161-42145183 CTGGAGGGATGGAGTGGAAAAGG + Intronic
1125896504 15:43307274-43307296 CAGAAGGAATGGCCAGGAAAGGG - Intergenic
1126250829 15:46565950-46565972 CAGGAGCTAGGGCCTGGAAAGGG + Intergenic
1127806516 15:62526004-62526026 CAGGAAGGGTGGCTTGGAGTAGG + Intronic
1127961852 15:63896013-63896035 CAGGGAGGCTGGCCTGGAGCAGG - Intergenic
1129327219 15:74807130-74807152 CAGGAGGGGTGGTATGTAGATGG + Intergenic
1129642465 15:77394142-77394164 CAGGAGCCAGGGCCTGGAGTTGG - Intronic
1129652232 15:77499230-77499252 CAGGAGGGAAGGCCTGGCACTGG - Intergenic
1129709475 15:77813211-77813233 CAGGAGGGGTGGCCAATAGAAGG + Intronic
1129975071 15:79815213-79815235 CAGGAGTGATGCTCTAGAGAGGG - Intergenic
1130048898 15:80467258-80467280 CAGTCGGCATGGACTGGAGAAGG + Intronic
1130145742 15:81272559-81272581 TTGGAGGGATGTCCTTGAGAAGG + Intronic
1131034760 15:89214949-89214971 CAGGAGGCAAGGTCTGTAGAGGG - Intronic
1131539296 15:93262610-93262632 CAGGAGAGATGGGCTGGGGTTGG - Intergenic
1132085654 15:98906482-98906504 AAGGAGGGATGGAGTGGAAATGG - Intronic
1132215456 15:100058554-100058576 CAGGAGGGCACACCTGGAGACGG + Intronic
1132393984 15:101459072-101459094 GAGGAGAGGTGGCCTGGAGAGGG - Intronic
1132399731 15:101497912-101497934 CAGGAGGCATGGCCAGAACAGGG - Intronic
1132698794 16:1213515-1213537 CAGGAGGCCTGGGCTGGAGCAGG - Intronic
1134109511 16:11506528-11506550 CAGGAAGGATGCCTGGGAGAGGG - Intronic
1134191735 16:12126667-12126689 CAGGAAGGATGAGCTGGAGGAGG + Exonic
1134594887 16:15488349-15488371 AAGAAGTGATGGGCTGGAGATGG + Intronic
1135733814 16:24915307-24915329 AAGGAGGGGTTGGCTGGAGAGGG + Intergenic
1136541161 16:30928244-30928266 GAGGAGGGAGGGGCTGGAGAGGG + Intronic
1136632440 16:31496813-31496835 CTGGAGGGAGGGCGTGGAGTGGG - Intronic
1136680522 16:31959259-31959281 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136713455 16:32258675-32258697 CAGGAGGGCAGGGCTGGAGGAGG + Intergenic
1136754456 16:32670756-32670778 CAGGAGGGCAGGGCTGGAGGAGG - Intergenic
1136780863 16:32900805-32900827 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136813657 16:33199609-33199631 CAGGAGGGCAGGGCTGGAGGAGG + Intronic
1136820133 16:33309689-33309711 CAGGAGGGCAGGGCTGGAGGAGG + Intergenic
1136826696 16:33366228-33366250 CAGGAGGGCAGGGCTGGAGGAGG + Intergenic
1136831762 16:33464999-33465021 CAGGAGGGCAGGGCTGGAGGAGG + Intergenic
1137282658 16:46991877-46991899 CAGGGAGGAGGCCCTGGAGAGGG + Intergenic
1137522269 16:49204458-49204480 CAGGAGAGATGGTGTGAAGAGGG + Intergenic
1137773830 16:51039811-51039833 CAGGAGAAGTGGCCTGGAAAAGG - Intergenic
1138588360 16:57985805-57985827 CAGGAGGGATGGCGGGGAGAGGG + Intronic
1139013149 16:62658108-62658130 CATGAGGGATGGTTTGGAGGAGG + Intergenic
1139068596 16:63351249-63351271 CTAGAGGGATAGCCTGGAGTGGG + Intergenic
1139292436 16:65870813-65870835 GAGGAGGGAGGGACAGGAGAGGG + Intergenic
1140803000 16:78506092-78506114 CAGCAGGGGCTGCCTGGAGAAGG + Intronic
1141502225 16:84452057-84452079 AACGGGGGATGCCCTGGAGACGG + Exonic
1141603015 16:85137582-85137604 CAGGAGGGGTGGCCTGGGTCTGG + Intergenic
1141676885 16:85522385-85522407 GGGGAGGGATGGGCTGGGGAGGG - Intergenic
1141817803 16:86424949-86424971 CAGGAATGTGGGCCTGGAGAGGG - Intergenic
1142222254 16:88861322-88861344 CAGGTGGGCTGGTCTGGAGGGGG + Exonic
1202992233 16_KI270728v1_random:22583-22605 CAGGAGGGCAGGGCTGGAGGAGG + Intergenic
1203056603 16_KI270728v1_random:931087-931109 CAGGAGGGCAGGGCTGGAGGAGG - Intergenic
1203083515 16_KI270728v1_random:1164834-1164856 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1142631946 17:1230829-1230851 CTGGAGAGGGGGCCTGGAGACGG + Intergenic
1143259241 17:5585796-5585818 CGGGAGGAATGGCCTGGAGGAGG + Intronic
1143366626 17:6412915-6412937 GAGGAGGGATGGCCAGGACTGGG - Intronic
1143458033 17:7080325-7080347 AAGTAGGCATGGCCTGGAGGAGG - Intergenic
1143731805 17:8885963-8885985 CAGGAGGCAGGGCCATGAGAGGG - Intronic
1144684438 17:17216600-17216622 CAGGAGGGAGGGCTTGGACCGGG - Intronic
1144948790 17:18983066-18983088 CAGGAGGGATGGACTGCCCAGGG + Intronic
1145711300 17:26981768-26981790 CAGCAGGCAGGACCTGGAGACGG + Intergenic
1145775297 17:27523802-27523824 CAGGATGAATGAACTGGAGAAGG + Intronic
1146001657 17:29133958-29133980 AAGGAGGGATGGAGTGGAGGAGG + Intronic
1146064814 17:29625892-29625914 AAGGAGGGAGGTGCTGGAGAAGG - Intergenic
1146474077 17:33148003-33148025 CAGGAAGTGAGGCCTGGAGAGGG + Intronic
1146907984 17:36630145-36630167 CAGGAGGGATGCCCTGCATTTGG - Intergenic
1147212111 17:38877755-38877777 CAGGAGGGGTTCCCTGGGGAGGG + Intronic
1147718221 17:42522080-42522102 CAGGAGGGGTGTCCTGGGCAGGG + Exonic
1148143053 17:45341957-45341979 GAGGAAGGGAGGCCTGGAGAAGG - Intergenic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1149639559 17:58193914-58193936 CAGGGGGCAGGGCCTGGAGATGG - Intronic
1149686598 17:58539092-58539114 GAGGTAGGATGGCATGGAGATGG - Exonic
1149774730 17:59348389-59348411 CAGGATGGAGGGGCGGGAGATGG - Intronic
1149855320 17:60077987-60078009 AAGGTGGGATGGACTGGGGACGG + Intronic
1150644936 17:66972040-66972062 GTGGAGGGATGGCCCGGAGAAGG + Intronic
1150930680 17:69581481-69581503 CTGGAGGGAAGGCGTGGGGAGGG - Intergenic
1151150011 17:72076904-72076926 CAGGAGGGATGTTCAGTAGATGG - Intergenic
1151339453 17:73461043-73461065 AGGGAGGGATGGCATGGGGAGGG - Intronic
1151457446 17:74234374-74234396 CAGGTGGGATGACCCAGAGATGG - Intronic
1151540528 17:74762472-74762494 CAGCAGGGAAGCTCTGGAGATGG - Intronic
1151547271 17:74800814-74800836 CAGGAAAGGTGGCCTGGGGAGGG + Intronic
1151872318 17:76844690-76844712 GAGCAGGGATGGCCTGGAGTGGG + Intergenic
1152119825 17:78411614-78411636 CAGGAACGATAGCCTGGGGAGGG - Intronic
1152217896 17:79045092-79045114 CTGGAGGCAGGGCCAGGAGAGGG + Intronic
1152232504 17:79121148-79121170 CAGAAGGGAGGGCCTGGTGTAGG - Intronic
1152345291 17:79747542-79747564 CAGGAGGGATGTCAAGGCGAGGG + Intergenic
1152390573 17:80001630-80001652 GAGGTGGGATGGCCAGGAGCTGG - Intronic
1152637126 17:81434792-81434814 GCGCAGGGCTGGCCTGGAGAGGG + Intronic
1152667226 17:81578116-81578138 CAGGAGGGGTGGTCTGGAGGCGG - Intronic
1152763612 17:82122769-82122791 CAGGAGAGAAGTCCTGGAGGAGG - Intronic
1152933482 17:83122492-83122514 CAGGTGGGAACTCCTGGAGACGG + Intergenic
1153387287 18:4511561-4511583 CATGATGGATGTGCTGGAGAAGG - Intergenic
1153991321 18:10403322-10403344 CAGGAAGGATGCCCTGCAGAGGG - Intergenic
1154350607 18:13580239-13580261 CAGCAGGGAAGGCCAGGAGCTGG - Intronic
1154358420 18:13640426-13640448 CAGACGGGATGGCCTGGAGATGG - Intronic
1154491194 18:14923519-14923541 CAGGAGACAGGGCCTGGAGTCGG - Intergenic
1155025232 18:21934926-21934948 CAGGAGGCAGAGCCAGGAGAAGG - Intergenic
1155185429 18:23383169-23383191 CAGGAGGTATGGGCTGGAGATGG + Intronic
1155443481 18:25885556-25885578 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1156524326 18:37752308-37752330 AAAGAGGGATGGGCTAGAGAGGG - Intergenic
1157160942 18:45313875-45313897 CAGGAGGGATGGCATAGTGAAGG - Intronic
1158481208 18:57823514-57823536 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1158773889 18:60553570-60553592 CAGGGAGGAGGCCCTGGAGAGGG - Intergenic
1159447565 18:68559264-68559286 GAGAAGGGCTGACCTGGAGATGG - Intergenic
1160128219 18:76199126-76199148 CAGGAGGCATCGCGTGGCGAGGG - Intergenic
1160180873 18:76635176-76635198 CAGGGGGTAAGGCCTGGAGTAGG - Intergenic
1160288024 18:77564684-77564706 ACAGAGGGCTGGCCTGGAGAGGG - Intergenic
1160676145 19:392426-392448 CAGGAGGAAAAGCCTGGAGGTGG + Intergenic
1160848973 19:1180623-1180645 CAGGAGGGCTGGCAGGGAGGAGG - Intronic
1160871230 19:1278810-1278832 CATGAGGGAAGGACAGGAGATGG + Exonic
1161214738 19:3088569-3088591 CAGGAGGGAGGGCTTGGAGTGGG + Intergenic
1161226388 19:3148489-3148511 CAGGAGGCCTGGCGTGGAGTTGG + Intronic
1162398680 19:10432108-10432130 CAGGAGGGCGGGCCCGGAGCCGG + Intronic
1162526406 19:11209254-11209276 GATGAGGGATGGCCAGGTGAGGG - Intronic
1162792401 19:13069877-13069899 CACGAGGCAGGGCCTGGGGAGGG + Intronic
1163551374 19:17967792-17967814 CTGGAGGGCTGGCCAGCAGATGG + Intronic
1163758116 19:19118998-19119020 CATGAGGGAGTGCCAGGAGAAGG - Intergenic
1163758427 19:19120409-19120431 CAGGAGGCGGGGCCTGGGGAGGG - Intronic
1165066768 19:33234232-33234254 CAGGAGGGATGGGTTGGGGCTGG - Intergenic
1165127899 19:33613707-33613729 CAGATGGCATGGCCTGCAGAAGG - Intergenic
1165245796 19:34497788-34497810 GAGCAGGGATGGTCTGCAGAGGG + Intronic
1165397155 19:35570722-35570744 CAGGAAGGGTGGGATGGAGAAGG + Intergenic
1165419850 19:35717487-35717509 CAGGAGGCGTGGGCTGGAGAAGG - Intergenic
1166301197 19:41913051-41913073 CAGGAGGGATTGCGGGGAGAGGG - Intronic
1166318503 19:42002412-42002434 CCGGAGGGATGTCCTTGAGAAGG + Intronic
1166750081 19:45160373-45160395 AAGGAGGGATGGCCAGAGGAGGG + Intronic
1167074432 19:47240051-47240073 CAGTTGGGATGGGCTGGAAACGG + Intergenic
1167602929 19:50465056-50465078 CAGGAGGGAGAGACTGGAGACGG - Intronic
1167671693 19:50857267-50857289 GTGGAGGGATGTCCTGGAGAAGG - Intronic
1167723080 19:51192270-51192292 AAGGAGGGAGGGGCTGGAGATGG + Intergenic
1168280984 19:55305189-55305211 CAGGAGGGATGGCTTGGCCGAGG + Intronic
1168350147 19:55670931-55670953 CAGGAGGGCTTGCCGGGAGCTGG + Intronic
924975961 2:175566-175588 CTGGAGGGTTAGCCTGGACAGGG + Intergenic
925096062 2:1204127-1204149 CTGGAGGGATTGCCTGCAAACGG + Intronic
925644283 2:6020344-6020366 AGGGAGGGATGGCTTGGAGATGG + Intergenic
925922698 2:8647842-8647864 CAGAAAGGAGGCCCTGGAGAGGG - Intergenic
927472302 2:23385532-23385554 CAGGGAGGATGCCCGGGAGAGGG - Exonic
927886282 2:26720825-26720847 CAGGAGCTCTGGCCTGAAGAGGG + Intronic
929119696 2:38474291-38474313 CAGGAGGGATGGAATACAGAAGG + Intergenic
929548636 2:42875029-42875051 CAGGAGGGGAGGCGTGGAGTGGG + Intergenic
929574531 2:43043482-43043504 CAGGAAGGATGGCTGGGTGATGG + Intergenic
929601253 2:43206169-43206191 CAGGAGGGCTGGGCTGGAGGAGG + Intergenic
929780441 2:44953742-44953764 CAGGTGGGAAGGCATGGAGGAGG + Intergenic
930975847 2:57459953-57459975 CAGGAGGAATGAGCTGGAAAGGG - Intergenic
931804455 2:65790486-65790508 CTGGAGGGCTGGGCTGGGGACGG + Intergenic
932471709 2:71963413-71963435 CAAGAGGGATGTCCCTGAGAAGG - Intergenic
932570790 2:72937369-72937391 CTGCAGGGATGCCCTGGAGCAGG - Intergenic
932793998 2:74679723-74679745 CCGGCGGGATGGACTGGAGGTGG + Exonic
933991695 2:87638686-87638708 CATGAGGGATGGAGTTGAGAAGG - Intergenic
934502797 2:94872807-94872829 CAGGGGGAAGGGCCTGCAGAAGG - Intronic
934663315 2:96154470-96154492 CAGCAGGGAAGGCCTGCAGCTGG + Intergenic
934913660 2:98280626-98280648 CAGGAAGCAGCGCCTGGAGAGGG + Intronic
935065158 2:99641068-99641090 CAGAAGGAATGGCCTGGGCAGGG - Intronic
935105901 2:100043314-100043336 CAGGTGGGATGGCATGGTGCAGG + Intronic
935190430 2:100773711-100773733 CAGGAGGGATGGGGTGGATGTGG - Intergenic
936302148 2:111312132-111312154 CATGAGGGATGGAGTTGAGAAGG + Intergenic
937193543 2:120129031-120129053 AAGGAGGGATGGACTGGGAAAGG + Intronic
937209754 2:120260681-120260703 CAGGAGGGATGGCCTCAGGAGGG + Intronic
937259887 2:120578508-120578530 CAGGAGGGATGGGATACAGATGG + Intergenic
937643157 2:124236317-124236339 CAGGAGGCGTGGCCTGGACCAGG + Intronic
938152887 2:128902017-128902039 CAGGAGGGAGGGCCTGGCTGGGG - Intergenic
938911266 2:135887824-135887846 CACGATGAATGGCGTGGAGAGGG + Intergenic
940503842 2:154527716-154527738 CAGGAGGTAGGGCCTGGAAAGGG + Intergenic
940861315 2:158773286-158773308 CAGGGGGCATGGCTTGGAGAGGG + Intergenic
941594336 2:167456789-167456811 GAGGATGGTGGGCCTGGAGAGGG - Intergenic
941746007 2:169087785-169087807 CAGGAGGTAGGGCCTGGAATAGG + Intronic
941875127 2:170424225-170424247 CTGGAAGGATGTCCTGGAAAAGG - Intronic
942734763 2:179097092-179097114 CAGGAGGTAGGGCCTGGAATAGG + Intergenic
944221795 2:197310676-197310698 CGGAAGGGATTGCCAGGAGAAGG + Exonic
946197409 2:218043363-218043385 CAGAAAGGAGGCCCTGGAGAAGG + Intronic
946402022 2:219473169-219473191 CTCAAGGGATGGCCTGGACATGG + Intronic
946441984 2:219704400-219704422 CAGGATGGATTGCCTGGGGGAGG - Intergenic
947505284 2:230703865-230703887 CGGGAGGCAAGGCCTGGAGTAGG + Intergenic
947793472 2:232880456-232880478 CAAGAGGGACTCCCTGGAGAAGG + Intronic
947793517 2:232880680-232880702 CAGCAGGGGTGGCCAGGAGCTGG + Intronic
948096040 2:235334604-235334626 CAGGAGGAATTGCCTTGAGGAGG - Intergenic
948293562 2:236845073-236845095 CAGGGAGGAGGCCCTGGAGAGGG + Intergenic
948558390 2:238834058-238834080 CTGGAGGGAAAGCCTGGAGCAGG + Intergenic
948761710 2:240196469-240196491 CAGGAGGAATGGCCTGGCTAGGG - Intergenic
948850836 2:240704540-240704562 CAGGGGGGCTGGGCTGGGGAGGG - Intergenic
1168774966 20:439783-439805 CTTGAGGGATGGGGTGGAGATGG - Intronic
1168799593 20:635587-635609 CAGGAGGGCAGGCCTGGGGAAGG - Intergenic
1169112779 20:3044419-3044441 CAGGAGGCCTCGCCTGGAGCTGG - Exonic
1169215908 20:3794807-3794829 CAAAAGGGAGGGCCTGGTGATGG - Intronic
1169788112 20:9382285-9382307 GAGAAGGCATTGCCTGGAGAGGG - Intronic
1170206893 20:13808136-13808158 CAAAAGAGATGGCCTGGAAAAGG + Intronic
1170254359 20:14323396-14323418 CAGGATGGCATGCCTGGAGAGGG - Exonic
1170393025 20:15895625-15895647 CAGGAGAGAGGGCCTGGTGGCGG + Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171035930 20:21713028-21713050 GAGGAAGGATGGCTTGGACAGGG + Intronic
1171981459 20:31632114-31632136 CAGGACAGGTGGCCTAGAGATGG - Intergenic
1171986012 20:31661791-31661813 CTGGAGGGCAGGCCTGGAGGTGG - Intergenic
1172470891 20:35194461-35194483 CTGGAGTGATGTCCTGGAGCAGG + Intergenic
1172518441 20:35552053-35552075 CCGGAGTGAAGTCCTGGAGAAGG + Intronic
1172603985 20:36202373-36202395 CCGAAGGGCTGGCCTGGAGGAGG - Intronic
1172623055 20:36332133-36332155 GAGAAGGGATGCCCAGGAGAAGG + Intronic
1172701503 20:36856145-36856167 CAGTAGGCAGGGCCTGGAGGTGG - Intronic
1172768346 20:37362984-37363006 CAGGTGGGATGGCTTTGACAGGG - Intronic
1172834828 20:37866437-37866459 CAGGAGCTATGGCTTGGAGAGGG - Intronic
1173196073 20:40913706-40913728 CATGATGGATTGCCTGGTGAGGG + Intergenic
1173250590 20:41362368-41362390 CCGTATGGATGGCCTTGAGAGGG - Exonic
1173681476 20:44885524-44885546 CAGGGCGGATGGCCGGGGGAGGG - Intergenic
1173784067 20:45779851-45779873 CAGGAAGCCTGGCCTGGAAAAGG - Intronic
1173893020 20:46528024-46528046 CAGGGAGGATGTCCTGGAGGAGG + Intergenic
1175238080 20:57526589-57526611 GAGGGAGGAGGGCCTGGAGAGGG + Intergenic
1175870876 20:62208874-62208896 CGGGAGGGGTTGCCGGGAGACGG + Intergenic
1175982412 20:62745761-62745783 CAGCAGGGAAGCCCTGGGGACGG - Intronic
1176092852 20:63326600-63326622 CCGGAGGAATGGCCTGAAGGAGG + Intronic
1176277206 20:64279180-64279202 CAGGAGGGATGGGGTGGAGGTGG - Intronic
1176515906 21:7783259-7783281 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1178395171 21:32236584-32236606 CAAGAGTGATGCTCTGGAGATGG - Intergenic
1178649934 21:34413271-34413293 CTGGAGGGAGGGAATGGAGAGGG - Intergenic
1179355040 21:40651176-40651198 CAGGAGACAGGGCCTGGAGTTGG - Intronic
1179546976 21:42119034-42119056 CAGGAGGAACCGCCTTGAGACGG + Intronic
1179799075 21:43802537-43802559 CAGGAGGGATGCCGAGGACAGGG - Intronic
1179878763 21:44284883-44284905 CCGCAGGCATGGCCTGGAGGGGG - Intergenic
1179995373 21:44971613-44971635 CAGGAAGGATGTCCTGGACCCGG + Intronic
1180042428 21:45287409-45287431 CAGGAGGGATGGGATGGGGGCGG - Intronic
1180063854 21:45403266-45403288 CAGGAGGGAGGGGCTGGGGCAGG - Intergenic
1180589459 22:16923985-16924007 CAGGAAGGATGGCTGGGAGATGG - Intergenic
1180756494 22:18165571-18165593 CAGCAGGGAATGTCTGGAGAGGG - Intronic
1180834978 22:18925350-18925372 CAGGAGGGTGGGCTTGGGGATGG - Intronic
1181075275 22:20371863-20371885 CAGCAGGGAATGTCTGGAGAGGG + Intronic
1181257862 22:21575734-21575756 CAGGAGGAATGGCTTGAACATGG - Intronic
1181319163 22:21991436-21991458 CAGGAGGCAGGCACTGGAGATGG + Intergenic
1181351327 22:22260513-22260535 CAGGAGGGGGGGACTGGAGGAGG + Intergenic
1181518498 22:23432040-23432062 CAGGGCGGGGGGCCTGGAGATGG + Intergenic
1181758574 22:25042062-25042084 CAGGAATGCTGGCCTTGAGATGG + Intronic
1182974490 22:34610350-34610372 CAGGGGGGATGGGGTGGGGATGG - Intergenic
1183231817 22:36587191-36587213 CAGGAAGGACTTCCTGGAGAAGG + Intronic
1183293508 22:37017157-37017179 CAGGAGTGATGGCAGCGAGACGG + Intronic
1183386797 22:37519530-37519552 CGGGAGGGAGGGCGTGCAGACGG - Exonic
1183587544 22:38761466-38761488 CAGGAGCTGTGGGCTGGAGAGGG + Intronic
1183639805 22:39085981-39086003 CAGGAGGGACAGCCTGGATCAGG - Intronic
1183663698 22:39235504-39235526 GAGGAGGGAGGGCGGGGAGAAGG - Intronic
1184302852 22:43572692-43572714 CAGAAGGGAGGGCCTGTCGAGGG - Intronic
1184336767 22:43858422-43858444 CAGGAGGCTTGACCTGGGGAAGG - Intronic
1184381012 22:44144995-44145017 CTTGGGGGAGGGCCTGGAGAGGG - Intronic
1184499127 22:44861403-44861425 GAGGAGGGGTGGCCTGCAGTGGG + Intronic
1184530324 22:45051454-45051476 CAGGAGGGATGGGTTGGAGTGGG - Intergenic
1184602788 22:45553333-45553355 CAGGATGGGTGGCCTGCTGAGGG + Intronic
1184770624 22:46594694-46594716 TAGGAGGGCCGGACTGGAGATGG + Intronic
1185234362 22:49703559-49703581 GAGGAGGCATGGGCTGGGGAGGG - Intergenic
1185332846 22:50259373-50259395 TATGGGGGCTGGCCTGGAGAGGG + Intronic
1185346614 22:50313364-50313386 GAGGAGGGAAGGTCTGGAGCAGG - Intronic
1203285067 22_KI270734v1_random:150649-150671 CAGGAGGGTGGGCTTGGGGATGG - Intergenic
949823328 3:8138693-8138715 CAGGAGGGAAGGGCAGGGGAGGG + Intergenic
949899221 3:8795910-8795932 CAGGAGAGAAGGCCTTGAGGAGG + Intronic
951874572 3:27407748-27407770 AAGGAGGGATGGGATGGAGGAGG - Intronic
952534593 3:34296279-34296301 CAGGAGCAATTGTCTGGAGAAGG + Intergenic
952878117 3:37965241-37965263 CAGGAGGGAAGTCCTGAAGGTGG - Intronic
952956655 3:38561984-38562006 CAGGAGGCAGGGCATGCAGAGGG + Intronic
953932139 3:47010721-47010743 AAGGAGAGCTTGCCTGGAGAAGG - Intergenic
954293083 3:49660036-49660058 CAGGAGGCATGGAGTGGAGAGGG - Intronic
954579346 3:51694812-51694834 CAGCAGGGAGAGCCTGCAGAAGG - Intronic
954693773 3:52409904-52409926 GGGGAGGGAGGGCCTGGACATGG - Exonic
955067077 3:55543067-55543089 CAGGAAGGCAGGCCAGGAGAAGG - Intronic
955396815 3:58563473-58563495 CAGGTGGAAAGGCATGGAGATGG + Intergenic
955441055 3:58955892-58955914 CAGGAGCCAGGGCCTGGAAAGGG - Intronic
955473024 3:59306392-59306414 CAGAAAGGCTGGCCTGGACAGGG + Intergenic
956535072 3:70266902-70266924 CAGAAGGCATGGCCTGGCAATGG + Intergenic
957810443 3:85214895-85214917 CAGGAGTCATGGCCTGGAATTGG + Intronic
957977146 3:87461060-87461082 CAGGAGTTAGGGCCTGGAAACGG - Intergenic
958993150 3:100871012-100871034 TATGAGGGATGGGATGGAGAGGG + Intronic
960128931 3:114032394-114032416 AAAGAGGGATGGCCTGGATGAGG - Intronic
960682771 3:120266296-120266318 CAGTAGGTATGGCCTGGGGCCGG + Intronic
961376481 3:126469526-126469548 GAGGTGGGATGGCCTGGACGGGG - Intronic
961412971 3:126736328-126736350 CAGGAGGGTTGGTCCTGAGATGG + Intronic
962894894 3:139705266-139705288 AAGGAGGGATTGTGTGGAGAGGG - Intergenic
965844583 3:172946706-172946728 CATGAGCCAGGGCCTGGAGAGGG - Intronic
966060069 3:175743326-175743348 CAGGGGAGAGGGCCAGGAGAAGG + Intronic
966400433 3:179542040-179542062 CAGCAGGCATTGCCTGGAAATGG - Intergenic
966676913 3:182599572-182599594 GAGGAGAGAAGGCCTGGAGAAGG - Intergenic
966914223 3:184576011-184576033 CCAGAGGGAAGGCCTGCAGAGGG - Intronic
967117443 3:186354792-186354814 GAGGAGTTATGCCCTGGAGAAGG + Intronic
967677498 3:192317287-192317309 CAGGAGCCAAGGCCTGGAGCTGG - Intronic
967806609 3:193719710-193719732 CAGGAAGGATGCCCTGGAGGTGG + Intergenic
967893820 3:194381981-194382003 CAGGGGTGAGGGGCTGGAGAGGG + Intergenic
967893841 3:194382032-194382054 CAGGGGTGAGGGGCTGGAGAAGG + Intergenic
967893863 3:194382083-194382105 CAGGGGTGAGGGGCTGGAGAGGG + Intergenic
967893884 3:194382134-194382156 CAGGGGTGAGGGGCTGGAGAGGG + Intergenic
967893906 3:194382185-194382207 CAGGGGTGAGGGGCTGGAGAGGG + Intergenic
967893928 3:194382236-194382258 CAGGGGTGAGGGGCTGGAGAGGG + Intergenic
967994657 3:195157557-195157579 CAGGAGGGAGGCACTGGCGAAGG + Intronic
968083639 3:195864003-195864025 CAGGAGGGATGGGCAGGGCAGGG + Exonic
968233337 3:197016912-197016934 AAGGAGGGCTGGCCAGGAGAGGG - Intronic
968334373 3:197900791-197900813 CAGGAGCTAAGGCCTGGAGTGGG - Intronic
968574775 4:1360500-1360522 CAGGAGGCCAGGCCTGGACAAGG - Intronic
969226264 4:5800520-5800542 AAGGATGGAGGGCCTGGTGAAGG + Intronic
969343470 4:6556919-6556941 CAGGAGGCATTGCCAGGAGCTGG - Intronic
969525349 4:7701425-7701447 CAGGAGGAAACGCCTGGGGAAGG + Intronic
969531735 4:7734196-7734218 CAGACGGGATGGGCTGGGGATGG + Intronic
970579149 4:17458333-17458355 CAGAAGGGAGGGCATGCAGATGG + Intergenic
974589090 4:63920030-63920052 CAGGAGCTATGGCCTGGAATGGG + Intergenic
974972213 4:68844470-68844492 CAGAGGGGAGGCCCTGGAGAGGG + Intergenic
975240277 4:72049755-72049777 CAGGAGGTCTGGCCAGGAGCTGG - Intronic
975747815 4:77492076-77492098 CAGGAGAGAGGACCTGGAAATGG + Intergenic
976675444 4:87697609-87697631 CAGGGAGGAGGCCCTGGAGAGGG + Intergenic
977351796 4:95897825-95897847 CTGTAGGGATTGCCTGGTGAAGG + Intergenic
977716004 4:100184741-100184763 GAGGATGGTGGGCCTGGAGAGGG - Intergenic
978258310 4:106719018-106719040 CAGGAGCCAAGGCCTGGACAAGG - Intergenic
978528657 4:109692606-109692628 CATGAGGAATGGGCTGAAGAGGG - Intronic
978837887 4:113175481-113175503 GAGGAGTGCTGGGCTGGAGAGGG - Intronic
979136672 4:117118772-117118794 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
979145422 4:117240311-117240333 CAGAAAGGAGGCCCTGGAGAGGG - Intergenic
982932649 4:161428572-161428594 CAGGAGCGAGGGCCTGGAATGGG - Intronic
983550278 4:169010369-169010391 GCGGAAGAATGGCCTGGAGAGGG + Intergenic
983622136 4:169772976-169772998 GAGGAGGGATGCCCTGGATTTGG + Intergenic
984176831 4:176429368-176429390 AAGGAGGAAAGGCATGGAGAAGG + Intergenic
985714849 5:1449998-1450020 AAGGAGGGATGGCCAGAGGATGG + Intergenic
985860775 5:2469032-2469054 AAGGAAGGAGAGCCTGGAGATGG + Intergenic
986018540 5:3779539-3779561 GAGGAGGGCTGGCCCGGAGTGGG + Intergenic
986370498 5:7075460-7075482 CAGGAGTGAGGGCCTGGGGCAGG - Intergenic
986807134 5:11318444-11318466 GAGGGGGCATGGACTGGAGAGGG - Intronic
986885172 5:12225682-12225704 CAGGAGTCAGGGCCTGGAGTTGG + Intergenic
987051084 5:14146681-14146703 CAGGACTGCTGCCCTGGAGAGGG + Intronic
987789090 5:22540995-22541017 TAGGAGGGTTGACTTGGAGAGGG + Intronic
988599655 5:32627780-32627802 CAGATGGGATTGCCTGGAAAGGG + Intergenic
991725294 5:69529829-69529851 CAGGAGGGATCACCTGAAGTCGG - Intronic
992435377 5:76750996-76751018 GAGGAGGGATGGGCTGGAGAGGG + Intergenic
992657198 5:78922398-78922420 CAGGAGGTAGGGCCTGGAATGGG - Intronic
993110143 5:83646704-83646726 GGTGAGGGAAGGCCTGGAGATGG + Intronic
994217904 5:97159425-97159447 CAGGAGGTAGGGCCTGAAGTGGG + Intronic
998038871 5:138938181-138938203 CAGGAGGGATGGCCCAAAGCTGG - Intergenic
998634657 5:143940167-143940189 CAGGAGTGGTGACCTTGAGAGGG + Intergenic
999434921 5:151556037-151556059 CAGGAGGGATGGACTGGACTCGG + Intronic
999977035 5:156922074-156922096 AAGGAGGGAGGGCCAGGTGATGG - Intronic
1001308787 5:170595537-170595559 CTGGAGGGTGGTCCTGGAGATGG - Intronic
1001881792 5:175251025-175251047 CAGGTGGGGTGGCATGGAGGAGG - Intergenic
1001944694 5:175769270-175769292 CAGGAGGGATCGCCTGGTGATGG + Intergenic
1002042035 5:176521518-176521540 CAGGAGGGATAGGCTGAAGAGGG + Intergenic
1002553125 5:180012445-180012467 CCGGTGTGAGGGCCTGGAGATGG - Intronic
1002685343 5:181005176-181005198 CACGGGGGCTGCCCTGGAGAAGG + Intronic
1002925108 6:1601510-1601532 CGGCAGGAACGGCCTGGAGAAGG + Intergenic
1002938955 6:1699322-1699344 GAGGAGGGATGTACAGGAGATGG + Intronic
1003016531 6:2472503-2472525 ATGGCAGGATGGCCTGGAGATGG - Intergenic
1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG + Intronic
1003874820 6:10426108-10426130 CAGGTGTCATGGCCTGGAAATGG + Intergenic
1004135025 6:12957792-12957814 CACGTGGGATGGAATGGAGAAGG - Intronic
1006286007 6:33094872-33094894 TAGGAAGGATGGGCTGGAGGAGG + Intergenic
1006441717 6:34057448-34057470 CAGGAGGTTTGGCCTGCAGTAGG + Intronic
1006527145 6:34616209-34616231 CAGGAGGCAAAGCCTGGTGAAGG + Intronic
1006554167 6:34851750-34851772 CAGGAGCCATGGCCCGGAGTCGG + Intronic
1006626881 6:35403916-35403938 CAGGAGGATAGGCCTGGAGAGGG + Intronic
1006669162 6:35718956-35718978 CAGTGGGGAGGGCCTGGAGGAGG + Intronic
1006909467 6:37554821-37554843 CAGGTGGGGTGGCGGGGAGATGG + Intergenic
1006939361 6:37741900-37741922 CAGGAGGCTTGTCCTGGAGCAGG - Intergenic
1007288986 6:40770028-40770050 CAGGAGCAAAGGCCTAGAGATGG - Intergenic
1007449916 6:41935075-41935097 CAGCAGGGATGCCCTGGAGGTGG - Exonic
1007725606 6:43913945-43913967 CAGGAGGGAGTCCCTGGAGCAGG + Intergenic
1007932093 6:45700612-45700634 CAGGAGGGAGAGCATGCAGACGG - Intergenic
1008940470 6:57040677-57040699 CAGGAGCTAGGGCCTGGAAAGGG - Intergenic
1010486596 6:76421779-76421801 GAGGAGGGATGCCCTGGTGCAGG + Intergenic
1012316840 6:97791390-97791412 CAGGAGCCATGGGCTGGAGTGGG - Intergenic
1013086336 6:106861120-106861142 CAGAAAGGAGGCCCTGGAGAGGG + Intergenic
1013232387 6:108169731-108169753 TGGGAGGGAGGGGCTGGAGAGGG - Intronic
1013296500 6:108762378-108762400 CTGGAGGGATGTCCTTGAGTAGG - Intergenic
1013865595 6:114692477-114692499 TAGGAGGTAAGGCCTGTAGAAGG + Intergenic
1016271379 6:142294013-142294035 CAGGAGTGATGTTCTAGAGAAGG - Intergenic
1016479481 6:144466881-144466903 CAGAAGGAAGGGCCTGGAGGAGG - Intronic
1017442273 6:154475291-154475313 CAGGAGGGACGAGGTGGAGAAGG - Intronic
1018486833 6:164249189-164249211 AGGGAAGGATGGCCTGGGGAAGG - Intergenic
1018721096 6:166573094-166573116 CAGGAGGGATGGCCCGGTGCAGG + Intronic
1018844706 6:167547502-167547524 GAGGAGGGATGGGGTGAAGAGGG - Intergenic
1018844719 6:167547546-167547568 GAGGAGGGATGGGGTGAAGAAGG - Intergenic
1018864518 6:167736428-167736450 CAGGAGGAATATCCTGGTGAAGG - Intergenic
1019307475 7:342761-342783 CAGGAAGGAGGCCCTGGAGCAGG + Intergenic
1019499039 7:1355300-1355322 CGGGAGGGAAGGCCTGCGGATGG + Intergenic
1019600065 7:1876904-1876926 CAGGGCGGGGGGCCTGGAGATGG - Intronic
1019967695 7:4513538-4513560 GGGGAGGAATGGCCTGGAAATGG - Intergenic
1019978899 7:4606520-4606542 CATGAGGGATGGCCTGGAGTGGG - Intergenic
1020224137 7:6266621-6266643 CAGAAGGGAAGGCATGGAGCTGG - Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020567982 7:9822184-9822206 CAGAAAGGAGGCCCTGGAGAGGG + Intergenic
1021540498 7:21752040-21752062 CAGGAGGTCTGGCTTGGAGTTGG - Intronic
1021877093 7:25059406-25059428 CAGAAGTGGTGGCCTGGAGAGGG - Intergenic
1022586409 7:31617165-31617187 CAGGAAGAAAAGCCTGGAGAAGG + Intronic
1023632823 7:42180553-42180575 GTGGAGTGATGGCCTGGAAAAGG + Intronic
1023866222 7:44239540-44239562 CAGGAGGGACGGGCGGGAGCGGG + Intronic
1024787320 7:52923087-52923109 CAGGTGAGATGGCCTAAAGAAGG + Intergenic
1025142590 7:56478511-56478533 CAGGCGGGATGAGCTGCAGAAGG + Intergenic
1026295590 7:69049193-69049215 CAGGTGACGTGGCCTGGAGACGG - Intergenic
1029216195 7:98951914-98951936 CAGGAGACACAGCCTGGAGAAGG - Intronic
1029300387 7:99578376-99578398 CAGGAGGGATGCCCTGGATTTGG + Intronic
1029417686 7:100453587-100453609 CAGGAGGATTGACCAGGAGATGG + Intergenic
1029662016 7:101968745-101968767 CAGCAGGGATATCCTGGAGAAGG - Intronic
1029667964 7:102008080-102008102 CAGAGGGGAAAGCCTGGAGATGG - Intronic
1030079850 7:105767861-105767883 CCAGAGGGGTGGACTGGAGAAGG - Intronic
1031599786 7:123692636-123692658 GAGGAGGGAAGGGCTGGAGGTGG + Exonic
1031978086 7:128106473-128106495 CAGGATGGATGGTGTGAAGATGG - Intergenic
1032315055 7:130829638-130829660 CACGAGGGTAGGCCTGGAGCTGG + Intergenic
1033461453 7:141550893-141550915 CAGGGGAGAGAGCCTGGAGAGGG - Intergenic
1033473286 7:141667807-141667829 CAGGAGTGATGCCTTGGAAAGGG - Intronic
1034293200 7:149948528-149948550 CTGGAGGGCTGGGATGGAGAGGG - Intergenic
1034345405 7:150382485-150382507 CAGGAAGGGTGGCCTTGAGAAGG + Intronic
1034406375 7:150905528-150905550 CAGCAGAGGAGGCCTGGAGAGGG + Intergenic
1034416205 7:150965547-150965569 CAGGAGGGAAGGGCTGAAGCTGG - Intronic
1034812874 7:154148351-154148373 CTGGAGGGCTGGGATGGAGAGGG + Intronic
1034940829 7:155229090-155229112 CAGCAGGGCTGGCGTGGTGAGGG + Intergenic
1034951304 7:155298407-155298429 CAGCAGGGAGGGCCCGGACACGG - Exonic
1035987407 8:4449987-4450009 CAGGAGAGATGGCTAGGACAGGG - Intronic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1036563033 8:9913667-9913689 GAGGAGGTAGGGCCTGGAGCTGG - Intergenic
1037339803 8:17832242-17832264 CAGGAGGGATGGCGGGAGGAAGG + Intergenic
1037696542 8:21228769-21228791 CAGGAGGGCTGGGGTGGAGTGGG + Intergenic
1037787252 8:21910410-21910432 GAGCAGGAAGGGCCTGGAGAGGG - Intronic
1038529864 8:28309786-28309808 CAGGTGAGCTGGCCTGGAGGAGG - Intergenic
1039185520 8:34911353-34911375 CATGAGGGATGGCCTGGTGGTGG - Intergenic
1039424838 8:37477326-37477348 CAGGAAGCAGGGGCTGGAGAGGG - Intergenic
1039465722 8:37783908-37783930 CAGGAGTGAGGGGCTGGAGGAGG + Intergenic
1039475342 8:37836653-37836675 CATGAGGGATGGACTGAAGGTGG - Intronic
1039607194 8:38891144-38891166 TAGGAGGGGTGGCCTGGTGGGGG - Intergenic
1039647496 8:39303662-39303684 CAGGAGCCATGACCTGGAAAGGG + Intergenic
1039888235 8:41667647-41667669 AAGGAGGGAGGGCCAGGAGAGGG + Intronic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041151930 8:54944172-54944194 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1042631306 8:70820091-70820113 CAGGAGTGAAGGACAGGAGAAGG - Intergenic
1044089336 8:87979625-87979647 CAGGATGAAGGGCCAGGAGAAGG + Intergenic
1044193107 8:89342828-89342850 CAGGAGCTAGGGCCTGGAAAAGG + Intergenic
1044288690 8:90441490-90441512 CAGGAGGCATTTCCAGGAGATGG - Intergenic
1044351190 8:91168363-91168385 CAGGAGAGGAGGGCTGGAGATGG - Intronic
1045357091 8:101398890-101398912 CAGGAGTCATGTCCTTGAGAAGG - Intergenic
1047609252 8:126504936-126504958 TAGCAGGGTTGGCCTGGAGAGGG - Intergenic
1047988864 8:130264856-130264878 CAGGGAGAATGTCCTGGAGAAGG + Intronic
1048569567 8:135640366-135640388 GAGGTGGGATGACCTGGGGAAGG + Intronic
1049034200 8:140061852-140061874 TGGGAGGACTGGCCTGGAGAAGG - Intronic
1049180433 8:141219413-141219435 CAGGAGGCCAGGCCTGCAGAGGG - Intronic
1049211618 8:141389212-141389234 CTGGAGGCATGGCCAGGAGGAGG - Intergenic
1049311473 8:141936039-141936061 CAGGTGGGAGGGCCTAGGGAGGG - Intergenic
1049360988 8:142212571-142212593 CAGGAAGGATGGACTGGGCAGGG - Intronic
1049755294 8:144308821-144308843 CAGAAGGGGCGGCCTGGGGAAGG + Intronic
1050184828 9:2962172-2962194 CAAGTGGGGTGGCGTGGAGAAGG - Intergenic
1050315915 9:4400766-4400788 CAGGAGCTAGGGCCTGGAGCAGG - Intergenic
1050906949 9:11016410-11016432 CAGGAGCTAGGGCCTGGAAAGGG + Intergenic
1051234078 9:14980164-14980186 GAGGAGGGATGCCCTGGATATGG - Intergenic
1051812828 9:21069617-21069639 CAGTTGGGATGGGCAGGAGAGGG - Intergenic
1052094031 9:24362765-24362787 CAGGAGGCAGGGCCTGGAGTTGG - Intergenic
1052750471 9:32484622-32484644 CAGTAGAGATGGATTGGAGAAGG - Intronic
1052882483 9:33612054-33612076 AAGCAGGGATGTTCTGGAGATGG + Intergenic
1053152344 9:35751004-35751026 CTGGAGGGAAGGGCTGGGGAAGG + Intronic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1053576577 9:39360933-39360955 CAGCAGGCATGCTCTGGAGATGG - Exonic
1053841087 9:42188858-42188880 CAGTAGGCATGCTCTGGAGATGG - Exonic
1054098144 9:60919624-60919646 CAGTAGGCATGCTCTGGAGATGG - Intergenic
1054119545 9:61195254-61195276 CAGTAGGCATGCTCTGGAGATGG - Exonic
1054588208 9:66987308-66987330 CAGTAGGCATGCTCTGGAGATGG + Intergenic
1055986233 9:82058502-82058524 CAGTAGGCATGCTCTGGAGATGG + Intergenic
1056291868 9:85151608-85151630 CAGGAGTGATGGCCAGGCCAGGG + Intergenic
1056611771 9:88130309-88130331 CAGTAGGCATGCTCTGGAGATGG + Intergenic
1056776758 9:89518648-89518670 CATGAGGGTGGGCCTGGAGCTGG + Intergenic
1057130573 9:92651562-92651584 CAGGAGGGAGGGCCTGGCCCAGG - Intronic
1057186714 9:93061192-93061214 TTGGAGGAAGGGCCTGGAGAGGG + Intronic
1057299580 9:93870096-93870118 CAGGTGGCATGGCCTGGGCAGGG + Intergenic
1057745653 9:97748827-97748849 CTGGAGAGATGGCCTTGGGAAGG - Intergenic
1057788690 9:98108264-98108286 CCTGAGGGATGGCCTGGGGTAGG - Intronic
1058016468 9:100037693-100037715 CAGGAGCTAGGGCCTGGAAAGGG - Intronic
1058820958 9:108728860-108728882 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059757451 9:117306914-117306936 CAGGAGGAATGTCCTTGTGATGG + Intronic
1060758253 9:126227990-126228012 CAAGAGGCAGGGCCTGGAGAAGG + Intergenic
1060800829 9:126545074-126545096 CAGTAGGGAAGGACTCGAGAAGG - Intergenic
1061025553 9:128046739-128046761 GAGGCGGGAGGGCGTGGAGAGGG + Intergenic
1061136203 9:128735385-128735407 CAGGAGAGATTCCCTGGGGAAGG + Exonic
1061498958 9:130991402-130991424 CAGGAGGCACGGCCTGGTGGAGG - Intergenic
1061532508 9:131225914-131225936 AAGGTGGGATGGACTGAAGATGG + Intronic
1061614244 9:131769029-131769051 CAGGAGGGAAGGCCTCAAGGTGG + Intergenic
1061899487 9:133665774-133665796 GAGGAGGGGTAGGCTGGAGACGG - Intronic
1062088569 9:134661857-134661879 CTGGAGGGAAGGGCTGGAAAGGG - Intronic
1062424714 9:136500794-136500816 CAGCGGGGGCGGCCTGGAGACGG - Exonic
1062503689 9:136862145-136862167 CAGCAGGAATGGGCTGGGGAGGG + Exonic
1186447797 X:9646641-9646663 TTGGAGGGATGGCCTGGACAAGG - Intronic
1187482387 X:19669501-19669523 CAGCAGCTAGGGCCTGGAGATGG - Intronic
1187572471 X:20518959-20518981 AAGAGGGGATGGACTGGAGAGGG + Intergenic
1187655170 X:21463745-21463767 CAGGAGCTAGGGCCTGGAAAGGG + Intronic
1187844879 X:23524897-23524919 CAGGAGCTAGGGCCTGGAGAGGG - Intergenic
1189770106 X:44416974-44416996 CAGGAGCTAGGGCCTGGAAAGGG + Intergenic
1190945504 X:55089311-55089333 GGGGAGGGATTGCCTGAAGATGG + Intronic
1192737517 X:73863352-73863374 CACAGGGGCTGGCCTGGAGATGG - Intergenic
1193169018 X:78315118-78315140 CAGGAGCTAGGGCCTGGAAAGGG - Intronic
1193463430 X:81817746-81817768 CAGGAGCCAGGGCCTGGAGTTGG + Intergenic
1193830984 X:86289179-86289201 CAGGAGGAAGGTCCTGGAAAGGG + Intronic
1194072065 X:89338195-89338217 CAAAAGGGATGGTCTGGTGATGG - Intergenic
1195502047 X:105613176-105613198 CAGGAGAGATGGCCTGGAAATGG - Intronic
1196217526 X:113071490-113071512 CGGGAGCCAGGGCCTGGAGATGG + Intergenic
1196508451 X:116476885-116476907 CAGGAGCTAGGGCCTGGAAAAGG + Intergenic
1196588703 X:117460516-117460538 CAGGAGCTAGGGCCTGGAAAGGG - Intergenic
1196683623 X:118493372-118493394 CAGGAACGAAGGCCTAGAGATGG - Intergenic
1196728302 X:118917031-118917053 CAGGAGAGGCTGCCTGGAGAAGG + Intergenic
1197514600 X:127410700-127410722 CAGGATCCATGGCCTGGAAATGG + Intergenic
1197873909 X:131084453-131084475 AAGGAGGGATGTTCTGGAAATGG + Intronic
1198292974 X:135256883-135256905 CAGGAGCTAGGGCCTGGAAAAGG - Intronic
1198544941 X:137681521-137681543 CAGGAGGGATGTTCTGGACTAGG - Intergenic
1198854979 X:141005956-141005978 CAGGAGCGAGTGCCTGGAGCAGG - Intergenic
1198877033 X:141239184-141239206 CAGGAGCGAGTGCCTGGAGCAGG + Intergenic
1198907713 X:141581413-141581435 CAGGAGCGAGTGCCTGGAGCAGG + Intergenic
1198909078 X:141593011-141593033 CAGGAGCGAGTGCCTGGAGCAGG - Intronic
1200076425 X:153553557-153553579 CAGGACCGATGGACTGGAGGTGG + Intronic
1200726308 Y:6673946-6673968 CAAAAGGGATGGTCTGGTGATGG - Intergenic
1200878983 Y:8191996-8192018 CAGAGGGGAAGCCCTGGAGAGGG - Intergenic
1201176697 Y:11314268-11314290 CTGGCGTGATGGCCTGAAGATGG - Intergenic
1201177822 Y:11320915-11320937 CCGGAGTGATGGCCTGACGATGG - Intergenic
1201372204 Y:13278087-13278109 CAGGAAGTATGGCCTGGAAAGGG - Intronic
1201719257 Y:17078893-17078915 CAGGAAGTGTGTCCTGGAGAGGG + Intergenic