ID: 1003123928

View in Genome Browser
Species Human (GRCh38)
Location 6:3340127-3340149
Sequence AGGAGGGATGGCCTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 631}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123920_1003123928 -3 Left 1003123920 6:3340107-3340129 CCACAAAAGCGGTATTATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG 0: 1
1: 1
2: 3
3: 50
4: 631
1003123915_1003123928 16 Left 1003123915 6:3340088-3340110 CCTAGCCCAGAGAGCGCTCCCAC 0: 1
1: 1
2: 1
3: 19
4: 190
Right 1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG 0: 1
1: 1
2: 3
3: 50
4: 631
1003123919_1003123928 -2 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG 0: 1
1: 1
2: 3
3: 50
4: 631
1003123916_1003123928 11 Left 1003123916 6:3340093-3340115 CCCAGAGAGCGCTCCCACAAAAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG 0: 1
1: 1
2: 3
3: 50
4: 631
1003123917_1003123928 10 Left 1003123917 6:3340094-3340116 CCAGAGAGCGCTCCCACAAAAGC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG 0: 1
1: 1
2: 3
3: 50
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003123928 Original CRISPR AGGAGGGATGGCCTGGAGAA GGG Intronic
900155895 1:1203160-1203182 GAGAGGGCTGGCCTGGAGACGGG + Intergenic
900626158 1:3609612-3609634 AGGAGGGGAGGCTTGGAGAAAGG + Intronic
900702611 1:4057709-4057731 GGGAGGTAGGGCCTGGAGATGGG + Intergenic
901146089 1:7065527-7065549 AGGAGTGAGGTCCTGGAGGAGGG + Intronic
901272094 1:7960392-7960414 AGGAAGGGTAGCCAGGAGAAGGG + Intronic
901654108 1:10759572-10759594 AGGAGGCATGGCCTGGATTCAGG + Intronic
902764856 1:18607275-18607297 GGGAGGGAAAGGCTGGAGAAGGG + Intergenic
902973264 1:20070519-20070541 GGGAGGGAGAGACTGGAGAAGGG + Intronic
903172456 1:21562754-21562776 AGCAGGGGAGTCCTGGAGAAGGG - Intronic
903620632 1:24695650-24695672 AGGAGGGTGGGCCGGAAGAAAGG + Intergenic
903964810 1:27080775-27080797 AGGAGGGATGTGATTGAGAAGGG - Intergenic
903999853 1:27332737-27332759 AGCTGAGATGGCCTGGAGCAGGG + Intronic
904379449 1:30101240-30101262 AGGAGGAAGGGCCTGGGGAGGGG + Intergenic
904644305 1:31954614-31954636 AGGTGGGGTGGCCTGAGGAAAGG - Intergenic
904806550 1:33136202-33136224 AGGAGGGAAGGAAGGGAGAAAGG - Intergenic
904977925 1:34472715-34472737 AGGGAGGATGGCCTGGGAAAAGG + Intergenic
905941386 1:41866236-41866258 AGGAGTGGTGGCCTGGGGAAAGG - Intronic
906509964 1:46405344-46405366 AGGAGGGATGGGCACCAGAAGGG - Intronic
906951749 1:50340696-50340718 AAGAGGGATGGCCTGGGATAGGG - Intergenic
907117355 1:51980448-51980470 TGGAGGCATGGACTGGAGAGAGG - Intronic
907428973 1:54399885-54399907 AGGAGGGATGGAGTGATGAATGG - Intronic
907642357 1:56203781-56203803 AGGGTGGGGGGCCTGGAGAATGG + Intergenic
907939838 1:59076996-59077018 AGGAGAGATGGGCTGGGCAAGGG + Intergenic
908117847 1:60957864-60957886 AGGTGGGATGGACTGTTGAATGG - Intronic
909054517 1:70806217-70806239 AGGAGCCATGGGCTGGAGAGGGG - Intergenic
909433592 1:75616222-75616244 GGGAGGGAGGGTGTGGAGAAGGG - Intergenic
909599627 1:77448188-77448210 ACCAGGGATGGCCTGAAGCATGG + Intronic
909853323 1:80497084-80497106 ATGTGTGATGGCCTGGAAAATGG + Intergenic
909934951 1:81540623-81540645 AAGAGGGATTGCCTGTATAAAGG + Intronic
910820031 1:91336300-91336322 AGGAAGGATGGGATGGAGGAAGG - Intronic
914356471 1:146889129-146889151 AGGAGGGATGGACTTTATAATGG + Intergenic
914766388 1:150641228-150641250 AGGAGGGGAAGGCTGGAGAAGGG - Intergenic
915163041 1:153933093-153933115 AGGTGGGAGGGGCTGGGGAAGGG - Intronic
915215646 1:154338985-154339007 AGGAGGAATGGCCAGGGGAAAGG + Intronic
915475375 1:156149979-156150001 AGGCGGGATGGGGTTGAGAATGG + Intronic
915646455 1:157276221-157276243 AGGTGGGAGGGACTGGAGGAGGG + Intergenic
915835678 1:159173028-159173050 AGGAGGGCTGGGATGGAGGAAGG + Intronic
915912606 1:159924133-159924155 AGAAGGGATGGAATGAAGAAAGG + Intronic
916577700 1:166081990-166082012 AGGAGAAATGGCTTGGAGAAGGG - Intronic
916759514 1:167803837-167803859 AGGAGGGAGGGGGAGGAGAAAGG - Intergenic
917610845 1:176687534-176687556 AGGAGGGATGACCAGGAGTGTGG - Intronic
918108829 1:181437997-181438019 AGGAGGAATAGACTGGAGGATGG - Intronic
918332133 1:183471477-183471499 AGGATGCATGGCCTGGAGGCTGG - Intergenic
918355693 1:183705235-183705257 AGGTGGGAGGGACTGGAGGAGGG + Intronic
918387093 1:184020501-184020523 AGGAGGGGAGGAATGGAGAAAGG - Intronic
918820621 1:189250000-189250022 AAGAGGGATGGCCTGAAGCTTGG + Intergenic
918923191 1:190743210-190743232 AGGAAGGATGGAATGGAGGAAGG - Intergenic
919747278 1:201016780-201016802 AGGAGGGCTGGCCTGGGGAAGGG - Intronic
919853785 1:201692016-201692038 AAGAGATATGGCCTGGAAAATGG - Intronic
920004920 1:202826075-202826097 GGGAGGTACGCCCTGGAGAAGGG + Exonic
920255495 1:204651653-204651675 AGAAGGAATGGCCTGGGCAATGG + Intronic
920379039 1:205525230-205525252 AGGCAGGATGGCTTGGAGGAGGG + Intronic
920747923 1:208646465-208646487 GGGAGGGAGGGACTGGAGAGAGG - Intergenic
920840685 1:209551402-209551424 AGATGGGATGGCCTGGGGAGTGG - Intergenic
920851762 1:209632796-209632818 AGGAGGGAAGAGTTGGAGAATGG + Intronic
920926214 1:210344053-210344075 AGGAGGGGTGGGCTGGTGCAGGG - Intronic
921088200 1:211816164-211816186 GGGAGGGATGCCCTTGAGAAAGG - Intronic
921607725 1:217175128-217175150 ATGAGGGATCACATGGAGAAGGG - Intergenic
922169310 1:223141997-223142019 AGAAGGGAAGCCCTGGAGCAGGG - Intronic
922273875 1:224058597-224058619 AAGAGCCATGGCCTGGAGATTGG - Intergenic
922516782 1:226213952-226213974 AGGAAGGATGGCCTAAAGCAGGG + Intergenic
922777845 1:228225056-228225078 ATGGGGGATGGCCAGGACAATGG + Intronic
923514286 1:234681526-234681548 AAGAGGTAGTGCCTGGAGAACGG + Intergenic
1062834796 10:628625-628647 CGGACGGAGGGCCAGGAGAAGGG + Intronic
1062925396 10:1312492-1312514 AGGAGAGACGTCCTGGAGACAGG - Intronic
1062969418 10:1634491-1634513 AGGAAGGAGTGCCTGGAGGAAGG - Intronic
1063338751 10:5243296-5243318 AGGAGAGATTGCCTGCAGATGGG + Intergenic
1064637998 10:17388223-17388245 AGGCAGGACTGCCTGGAGAATGG - Intronic
1064753545 10:18555492-18555514 ATGAAGGATGGTATGGAGAATGG + Intronic
1065141319 10:22720938-22720960 AGGTGGGGTGGTCTGGGGAATGG - Intergenic
1065247445 10:23773103-23773125 AACAGGGATGGGCTGGAGAGAGG + Intronic
1065790897 10:29259683-29259705 AGGAGGTAAAGCCTGGAGCAGGG + Intergenic
1066048108 10:31611936-31611958 GGGAGGGAGGGCCTTAAGAAAGG + Intergenic
1066228560 10:33409125-33409147 AGGAGGAATGGGCAGGAAAAAGG + Intergenic
1066693730 10:38059711-38059733 AGGAGGGATGGCAGGTAGAGAGG + Exonic
1067017725 10:42770402-42770424 AGGAAGGAAGGCCAGGAGAGGGG - Intergenic
1067142085 10:43666601-43666623 AGGAGGGATGGGATGGGGGATGG - Intergenic
1067192671 10:44084127-44084149 AGGCAGGGTGGCCTGGAGACTGG + Intergenic
1067534163 10:47095724-47095746 AGGAGAGAGGGCCAGGACAAGGG - Intergenic
1067729361 10:48798916-48798938 AGCCAGCATGGCCTGGAGAATGG + Intronic
1069083556 10:64114177-64114199 AGCAGAGTTGGCCTAGAGAAAGG + Intergenic
1069405151 10:68091152-68091174 GGTAGGCATGGACTGGAGAAAGG + Intergenic
1069994406 10:72333688-72333710 AGAAGGGAAGGCCTGCAGAGGGG - Exonic
1070070110 10:73079926-73079948 TTGAGGGATGGCCTTGTGAATGG + Intronic
1070402721 10:76067653-76067675 GGGAGGGGTGGGCTGGAGGATGG - Intronic
1070523149 10:77271943-77271965 AGGAGAAATAACCTGGAGAAGGG - Intronic
1070610177 10:77927121-77927143 CGGAGGGACGGCCTGGGGAGGGG - Intergenic
1070703861 10:78623013-78623035 AGGAAGGAAGGGATGGAGAAAGG + Intergenic
1071214109 10:83378771-83378793 AGGAGGGTGGACATGGAGAAGGG - Intergenic
1071293268 10:84202166-84202188 AGGTGGGATGGCCAAGAGAATGG + Intronic
1071385429 10:85114847-85114869 AGGAGGGACTGCCTGGGAAAAGG - Intergenic
1071715789 10:88093950-88093972 AGAATGGCTGGCATGGAGAAAGG - Intergenic
1071922377 10:90365954-90365976 AGGAGGTACGGCCTGGGGGAGGG - Intergenic
1072083563 10:92056925-92056947 GGGAGGTAGGGCCTGGAAAAGGG - Intronic
1072253488 10:93600281-93600303 AGGAAGAATGGCCTGCGGAAAGG - Intronic
1072525244 10:96265595-96265617 ATGAGGGATTGCCTAGAGGAGGG - Intronic
1072563580 10:96599039-96599061 AGGAGGGAGTGACTGGAGGAAGG + Intronic
1073352794 10:102831777-102831799 AGGAGGGAAGGGATGGAGAAGGG - Intronic
1073591334 10:104760134-104760156 AGGATGGAGTGCTTGGAGAATGG + Intronic
1074525724 10:114261445-114261467 AGGAGGGGCAGCCTTGAGAATGG - Intronic
1074774034 10:116753281-116753303 AAGAGGGATGTCCTGGAAAGAGG - Intergenic
1074879689 10:117645981-117646003 AGGAAGGAAGGCCTGAAGTAAGG + Intergenic
1075070944 10:119319488-119319510 AGGAGAGGTTGCATGGAGAAGGG - Intronic
1075148041 10:119899985-119900007 AGGAGGAAGGGGCAGGAGAAAGG - Intronic
1075334142 10:121597083-121597105 AGGAAGGAGGGTCTGGAGAACGG + Intronic
1075550125 10:123386435-123386457 AGTAGGAATGGCATGGAGAGAGG - Intergenic
1075633205 10:124013760-124013782 AGGGGAGAAGCCCTGGAGAAGGG - Intronic
1076052286 10:127345504-127345526 AGGAAAGATGGCCAGGTGAAAGG - Intronic
1076180933 10:128406764-128406786 AGAAGAGATGGTCTGGAGTATGG - Intergenic
1076739686 10:132477156-132477178 AGGAGGGACGAGCTGGAGAAAGG - Intergenic
1077038073 11:504702-504724 TGGAGGGATGGTCTGGGGGAAGG - Intronic
1077368770 11:2171947-2171969 AGGAGGGAGGCGCAGGAGAAAGG + Intergenic
1077372074 11:2187049-2187071 AGGAGGCACGGCCGGGCGAAGGG + Intergenic
1077507827 11:2940329-2940351 AAGAGGGAACGCCTGGAGATGGG - Intergenic
1077902228 11:6498601-6498623 TGGAGGAAAGGCCTGGACAATGG - Exonic
1078567355 11:12427988-12428010 AGGAGGGGAGGCCTGGAGATGGG - Intronic
1079246733 11:18757709-18757731 AGCAGGGGTGGACTGGAGACTGG + Intronic
1081668302 11:44929290-44929312 ATCAGAGATGGCCAGGAGAAGGG + Exonic
1081693641 11:45094738-45094760 AGGAGGGAAGGAATGAAGAAAGG + Intergenic
1082274747 11:50209181-50209203 AAAAGGAATGGCCTGGACAAAGG - Intergenic
1082991493 11:59211061-59211083 ATGAGGGGTGGCCGGGTGAAAGG + Exonic
1083298568 11:61728303-61728325 TGGAGAGGTGACCTGGAGAAGGG - Intronic
1083580060 11:63818992-63819014 AGGAGGGCTCACCTGGAGAGGGG - Exonic
1083621028 11:64049501-64049523 TGGAGGTGTGGCCTGGGGAAGGG - Intronic
1083699796 11:64468552-64468574 AGGAGAGATGGCCAGAAGTATGG - Intergenic
1083780416 11:64914655-64914677 AGGGGGGCTGGCCTGTAGTAGGG - Intronic
1083936866 11:65873761-65873783 AGCAGGGATGGCAAGGGGAAAGG - Intergenic
1084116185 11:67044422-67044444 GGCAGGGACAGCCTGGAGAAAGG - Intronic
1084272958 11:68038849-68038871 CGGAGAGGAGGCCTGGAGAAAGG - Intergenic
1084364896 11:68691558-68691580 AGGTGGGAGGGCCAGGAGCAAGG + Intergenic
1084717297 11:70882175-70882197 AGGAGGGAGGGAGTGGGGAAAGG + Intronic
1085246661 11:75107465-75107487 AGGAGGAATGGGGAGGAGAAAGG - Intronic
1085267334 11:75244688-75244710 ATGAGGAATGACTTGGAGAAGGG - Intergenic
1085435176 11:76493427-76493449 ACCAGGGATGGCCTGAAGCATGG + Intronic
1085531388 11:77194253-77194275 AGGAGGCAGGGCCAGGAGAGGGG + Intronic
1086630071 11:89006900-89006922 AGGAGGCTTGGGCAGGAGAACGG - Intronic
1086866327 11:91984241-91984263 AGGAGGGAGGGCAGGGGGAAGGG + Intergenic
1087048786 11:93866358-93866380 AGGTGGGAGGGACTGGAGGAGGG + Intergenic
1088249855 11:107853056-107853078 AGGGGGCATGGGCTGGAGGAGGG - Intronic
1088361211 11:108992014-108992036 AGGAGGGAAGTCCTGAAGAGAGG + Intergenic
1088458029 11:110053065-110053087 AGGAGGAATTGACTGGAAAAGGG + Intergenic
1088472000 11:110196682-110196704 AGGAGGGAGGACCTGCAGATTGG + Intronic
1089589806 11:119533090-119533112 AGGAGGAAGGGACCGGAGAAGGG - Intergenic
1089695631 11:120214650-120214672 AGGTGGGAAGGGCTGGAGAGAGG - Intronic
1089793054 11:120958230-120958252 AGGAGGGATTTCCTGGGGTAAGG - Intronic
1090424020 11:126594693-126594715 AGGAGAGTTGGCCAGGAGCATGG - Intronic
1091819978 12:3468925-3468947 TGGAGGCATGGACTGGAGAGAGG - Intronic
1091976155 12:4827255-4827277 AGGAGGGAAGGGCGAGAGAAAGG - Intronic
1092237984 12:6821755-6821777 AGGAGGGAGGCCCGGGGGAAGGG + Exonic
1093376589 12:18435378-18435400 AGGATGGATGGACTGGGGATAGG - Intronic
1093491557 12:19710731-19710753 AGCAGGGTTGGCATGGAGAGGGG + Intronic
1094244168 12:28268717-28268739 AGTAGGGATGGCATGGGGAAGGG + Intronic
1096452506 12:51756170-51756192 ACGAGGGGTGGCCTGGTGAGGGG - Intronic
1096454074 12:51770706-51770728 AGGAGGGATTGGCTGGGGAAGGG + Intronic
1096628010 12:52907092-52907114 AGGAGGCAGGGCCTGGGGAGGGG - Intronic
1098209801 12:68151710-68151732 TGGAAGAATGGCCTGGAGTAGGG - Intergenic
1098268783 12:68750275-68750297 AGTAGAGATGGCCAGGAGACTGG + Intronic
1099316308 12:81086518-81086540 AGGATGGATTGCCTGGCAAATGG + Intronic
1099433734 12:82619418-82619440 AGGAGGCAGGGCCTGGAACAGGG - Intergenic
1099703368 12:86118224-86118246 AGGAGAAATAGCCTGAAGAATGG + Intronic
1099861731 12:88231130-88231152 AGGTGGGAGGGACTGGAGGAGGG - Intergenic
1099931653 12:89082331-89082353 GGCAGGGATGGCATTGAGAATGG + Intergenic
1100290875 12:93214187-93214209 ATCAGGGAAGGACTGGAGAAAGG - Intergenic
1101353047 12:103950499-103950521 AGGAGGCATGGCTTTGAGCAAGG + Exonic
1101763314 12:107676947-107676969 AGGAAGGATGGGCTGGGCAAAGG - Intergenic
1102039622 12:109792518-109792540 AGGAGGCATGGTCTGGACACTGG - Intronic
1102457543 12:113080045-113080067 AGGAGGGTTGGCATGGAGGGCGG + Intronic
1103518611 12:121523346-121523368 AGGAGGGTTGGCTGGGGGAATGG + Intronic
1103733361 12:123043147-123043169 GGGAGGGTTGGCCTGCAGCAGGG - Intronic
1103949446 12:124543067-124543089 AGGAGGGATGGGAGGGAGAGAGG - Intronic
1104258904 12:127165100-127165122 CAGAGGGATGGCCTGTATAAAGG - Intergenic
1104517579 12:129442266-129442288 AGAAGGGAAGGTGTGGAGAAGGG + Intronic
1105566955 13:21558813-21558835 GTGAGGGATGGCAGGGAGAAGGG + Intronic
1105621792 13:22074770-22074792 AGGTGGGATGACCTGGGCAAAGG + Intergenic
1106013113 13:25843843-25843865 AGGAGGTAGGGGCTGGAAAAGGG + Intronic
1106237907 13:27880720-27880742 AGGAGGTATGCCCAGGAAAAGGG - Intergenic
1106855698 13:33849503-33849525 ATCAGTGATGGCCTGGAGAAGGG - Intronic
1106925072 13:34605369-34605391 AGGAGGGATGGAATGGTGAGTGG - Intergenic
1108180152 13:47832672-47832694 AGAACGGGTGGTCTGGAGAAAGG + Intergenic
1109075070 13:57823891-57823913 AGGAGCCATGGTCTGGAGCAGGG + Intergenic
1109388849 13:61667553-61667575 AGCAGGGAGGGCCTAGATAAAGG + Intergenic
1109476741 13:62888090-62888112 TGGAGGGAAGGCATTGAGAATGG - Intergenic
1112703213 13:102035925-102035947 AGAAAGGAAGGCCTGGGGAAAGG + Intronic
1113156412 13:107327832-107327854 AAGAGGGATGGCAAGGACAAAGG - Intronic
1113847262 13:113399470-113399492 AGGAGGGAGGGTCTGGGGCAAGG - Intergenic
1114318395 14:21526560-21526582 AGGAGGGTAGGCCTGGGCAAAGG - Intronic
1114417313 14:22553523-22553545 AGTAGGGCTGACCAGGAGAAGGG - Intergenic
1114671077 14:24411456-24411478 AGGAGGGCAGGCCTGGGGACCGG - Intronic
1116432856 14:44866740-44866762 ATGAGGGCAGGCCTGGAGACTGG + Intergenic
1116727800 14:48584215-48584237 AGGATGGATGCACTGGACAAAGG + Intergenic
1116816412 14:49587869-49587891 AGAAGGGAATGCCTGGTGAAAGG + Intronic
1116945714 14:50833112-50833134 AGGAGGGAAAGCATGGAGCATGG + Intergenic
1117025021 14:51610229-51610251 AGGAATAATGGCTTGGAGAAAGG - Intronic
1117249534 14:53922684-53922706 AGGAAAGATGGTCTGGAAAAAGG + Intergenic
1117406811 14:55411885-55411907 AGGAGGAGGGGCCTGGGGAAGGG + Intergenic
1117480633 14:56140863-56140885 AGGAGGGAAGGCCAAGAGAATGG + Intronic
1118251989 14:64170697-64170719 AGGAGGCATGGAGTGGAGATGGG + Intronic
1119047896 14:71337014-71337036 AGACAAGATGGCCTGGAGAATGG - Intronic
1119074459 14:71621806-71621828 AGGAGGAAAGACATGGAGAAAGG - Intronic
1119158432 14:72432630-72432652 AGGTGGGATGGACAGGAGCAAGG - Intronic
1119214651 14:72859537-72859559 AAGAGGGATGGCCTGGGCACTGG - Intronic
1119218935 14:72891433-72891455 AGGAGGGGTAGCGGGGAGAATGG - Intronic
1119726159 14:76922923-76922945 AGGAGGGAGGAAATGGAGAAGGG - Intergenic
1119727236 14:76928879-76928901 AGGAGGGAAGGAAAGGAGAAAGG + Intergenic
1119749445 14:77067071-77067093 AAGAGGGCTGGCATGGAGAAGGG - Intergenic
1119852068 14:77873334-77873356 AGGAGGCCTGGCCTGGGAAATGG - Intronic
1119878004 14:78076808-78076830 AGAATGGAAGGCCTGGAGAGAGG - Intergenic
1119948317 14:78717926-78717948 AGGAGTGATGGCCCAGAGAAGGG + Intronic
1120289430 14:82548003-82548025 ATGAGGGATGGCAGGGAGATAGG + Intergenic
1121409232 14:93737817-93737839 AGGATGGATGGCCTGGGGCGTGG - Intronic
1121955881 14:98212466-98212488 AGGAGAGATGGCTTGAAAAAAGG - Intergenic
1122364972 14:101189594-101189616 AGGAGGGAGGGCCTGGGGGGAGG + Intergenic
1122459767 14:101885156-101885178 ACGGGCCATGGCCTGGAGAAGGG + Intronic
1122796240 14:104207581-104207603 AGGAGGCCTGGCCAGGTGAAGGG - Intergenic
1122995541 14:105261926-105261948 AGCAGGGGGGGCCTGCAGAAGGG - Intronic
1124346294 15:28923669-28923691 AGCAGGGATGCCCTGGCAAAAGG - Intronic
1124405742 15:29390011-29390033 ATGACGGAGGGCCTGCAGAATGG + Intronic
1124811532 15:32944094-32944116 AGAAGGGAGTGCCTGGGGAAGGG + Intronic
1125204076 15:37131350-37131372 AAGAGGGATGGACTGAAGAGGGG + Intergenic
1125214909 15:37260737-37260759 AGGAAGGATGGTCTTGACAATGG + Intergenic
1125423248 15:39525627-39525649 AGGAGACATGGCCAAGAGAATGG + Intergenic
1125567146 15:40685392-40685414 AGGAGGCAAGGCCTGGAAATGGG + Intergenic
1125686098 15:41564273-41564295 AGGAGGGCTGGCAGGGAGGAAGG + Intronic
1125767469 15:42145162-42145184 TGGAGGGATGGAGTGGAAAAGGG + Intronic
1126530926 15:49710646-49710668 ATGAGGGCTGGCCTGGAGCCTGG + Intergenic
1126755984 15:51925291-51925313 CAGAGGGAAGGCATGGAGAAGGG + Intronic
1126778887 15:52121182-52121204 AGAAGGGCTGGGCTGGAGCAGGG + Exonic
1127340365 15:58036883-58036905 AGGAAGTATGACCTGGAGTAGGG + Intronic
1128743841 15:70100289-70100311 AGGAGGGGTGGCCTGTGAAAGGG + Intergenic
1128774891 15:70312820-70312842 ATGAAGGGTGGTCTGGAGAAAGG + Intergenic
1128987977 15:72235137-72235159 AGGAGTGATGGTCCAGAGAAGGG - Intergenic
1129253865 15:74323018-74323040 GGGAGGTATGGGCTGGAGCAGGG - Intronic
1129602293 15:77007211-77007233 TGGAGGGAAGGCCTGGAGGCTGG + Intronic
1129616980 15:77106466-77106488 AGGAGGGTGGGGCAGGAGAATGG - Exonic
1129869919 15:78933565-78933587 GGGAGGGACGGCCTGGTGAGAGG + Intronic
1129977780 15:79836830-79836852 ATGGAGGATGGCCTGGAGGATGG + Intronic
1130145743 15:81272560-81272582 TGGAGGGATGTCCTTGAGAAGGG + Intronic
1130785250 15:87088477-87088499 AGCTGGGATGGCCTAAAGAAGGG - Intergenic
1131469654 15:92684936-92684958 CAGAGGGAGGGCTTGGAGAAGGG - Intronic
1132350509 15:101136946-101136968 CAGAGGTATGGCCAGGAGAAGGG + Intergenic
1132368340 15:101275000-101275022 AGGAGGGACAGGCTGGAGCAGGG - Intronic
1132533212 16:463961-463983 AGGAGGGGTGGAGGGGAGAAAGG + Intronic
1132654011 16:1034248-1034270 TGGAGGGATGGACTGGTGGATGG - Intergenic
1133116409 16:3580250-3580272 GGGAGGCATGGCCTGGGGACTGG - Intergenic
1133412225 16:5578374-5578396 AGGAAGGGTGGAGTGGAGAAAGG + Intergenic
1133517695 16:6525727-6525749 AGGAGGGAAGGGCTGAAAAATGG + Intronic
1134603387 16:15550941-15550963 AGGAGGGATGGACTTGGGAGTGG + Intronic
1135735843 16:24931228-24931250 CGGAGGGCTGGCCTGGAGGCTGG + Exonic
1137345700 16:47656845-47656867 AGGAGAGATGTCCTGGGTAATGG - Intronic
1138124648 16:54428802-54428824 AGGAGGAATGGCCAGGGCAAAGG - Intergenic
1138588361 16:57985806-57985828 AGGAGGGATGGCGGGGAGAGGGG + Intronic
1139092401 16:63664114-63664136 AGGATGAATGTCCTGGAAAAGGG + Intergenic
1139292437 16:65870814-65870836 AGGAGGGAGGGACAGGAGAGGGG + Intergenic
1139783333 16:69369794-69369816 AGAAGGCATGGTGTGGAGAAAGG - Intronic
1139977546 16:70826324-70826346 AGGAGGGATGGACTTTATAATGG - Intronic
1140158174 16:72455586-72455608 AGGAGCTAGGGCCTGGAAAAAGG + Intergenic
1140803001 16:78506093-78506115 AGCAGGGGCTGCCTGGAGAAGGG + Intronic
1141151996 16:81570638-81570660 ACCAGGGATGGCCTGAGGAAAGG + Intronic
1141260579 16:82449965-82449987 AGGAGGGATGCCCTTGCCAATGG - Intergenic
1141676884 16:85522384-85522406 GGGAGGGATGGGCTGGGGAGGGG - Intergenic
1141986184 16:87581936-87581958 AGGAGGGAGGGCCTGGAAGGAGG - Intergenic
1143009968 17:3860862-3860884 AGGAGGGCTTGTTTGGAGAAGGG - Intronic
1143259242 17:5585797-5585819 GGGAGGAATGGCCTGGAGGAGGG + Intronic
1143284410 17:5778530-5778552 AGGAGGGAGACCCTGGACAAAGG + Intronic
1143346606 17:6254083-6254105 AGGCGAGATGGCCCAGAGAAGGG - Intergenic
1143500681 17:7336851-7336873 AGGAGACCTGGCCTGGGGAAAGG - Intronic
1144014208 17:11178466-11178488 AAGAGGGATGGACAGGAGATTGG - Intergenic
1144948037 17:18979795-18979817 AGGCTGTAAGGCCTGGAGAAAGG + Intronic
1145201038 17:20944868-20944890 AGGAAGGAGGAACTGGAGAAAGG - Intergenic
1146566659 17:33919059-33919081 AGCAGGGCTGGGCTGGAGACTGG + Intronic
1146762616 17:35491578-35491600 CTGAGGGATGGGCTGCAGAATGG + Intronic
1147530192 17:41269063-41269085 AGGAGGGATGGAAGGAAGAAAGG + Intergenic
1147578924 17:41617792-41617814 AGCAGGGAGGGCCTGGGGGAAGG - Intergenic
1147654668 17:42082060-42082082 AGCAGGACTTGCCTGGAGAAAGG - Intergenic
1148229738 17:45924431-45924453 AGGAGTGGAGGCCGGGAGAATGG - Intronic
1148915060 17:50969593-50969615 GGGAGGGAGGGACTGGAGTATGG - Intronic
1149515192 17:57275749-57275771 AGAAGGGGTGGCCAGGAGGAGGG + Intronic
1149578030 17:57727688-57727710 AGGAGGGAAGGGCAGGAGGAGGG + Intergenic
1149686597 17:58539091-58539113 AGGTAGGATGGCATGGAGATGGG - Exonic
1149855321 17:60077988-60078010 AGGTGGGATGGACTGGGGACGGG + Intronic
1150429771 17:65105741-65105763 AGAAGGGGTAGCCTGGAGAAAGG + Intergenic
1150644937 17:66972041-66972063 TGGAGGGATGGCCCGGAGAAGGG + Intronic
1151872319 17:76844691-76844713 AGCAGGGATGGCCTGGAGTGGGG + Intergenic
1151974572 17:77477061-77477083 AGGAGGGAGGGACGGAAGAAGGG - Intronic
1152302970 17:79506232-79506254 AGGAGGGAGTGCCAGGAGGAGGG + Intronic
1152318271 17:79593508-79593530 GGGAGGGTGGGCGTGGAGAAAGG + Intergenic
1152333296 17:79685851-79685873 AGGAGGGATGGCCGGTAGAATGG - Intergenic
1152390572 17:80001629-80001651 AGGTGGGATGGCCAGGAGCTGGG - Intronic
1152476107 17:80519319-80519341 AGGAAGGATGTCATGAAGAATGG + Intergenic
1152667225 17:81578115-81578137 AGGAGGGGTGGTCTGGAGGCGGG - Intronic
1153016124 18:584070-584092 AGGGGGGATGACCTTGAGCAAGG + Intergenic
1153746216 18:8182353-8182375 AGGAGGGAGGGTGTGGAGCAAGG - Intronic
1154358419 18:13640425-13640447 AGACGGGATGGCCTGGAGATGGG - Intronic
1156460480 18:37318938-37318960 AGGGGGGATGGCATGAACAAGGG - Intronic
1156524325 18:37752307-37752329 AAGAGGGATGGGCTAGAGAGGGG - Intergenic
1156580602 18:38370469-38370491 AGGAGGCAGGACCTGGAGAGTGG + Intergenic
1156729428 18:40172963-40172985 AGTAGGGAAGGCCTGGACAAAGG + Intergenic
1157840618 18:50955019-50955041 GGGAGGGCTGGCATGGTGAAAGG + Intergenic
1157919479 18:51699837-51699859 AGGTGGGAGGGACTGGAGGAGGG - Intergenic
1158869363 18:61669763-61669785 AGGAGGGATGGACCACAGAAGGG - Intergenic
1159104818 18:63994045-63994067 AGGAGGGATGGGATGGGGGAAGG - Intronic
1159447564 18:68559263-68559285 AGAAGGGCTGACCTGGAGATGGG - Intergenic
1160777403 19:862408-862430 GGGAGGGTGGGGCTGGAGAAGGG + Intronic
1160937926 19:1606084-1606106 AGGAAGCAGGGACTGGAGAAAGG - Intergenic
1160960314 19:1718033-1718055 AGGATGGATGGATGGGAGAATGG + Intergenic
1161040692 19:2109463-2109485 AGGACGGATGTCCTGTAGGAAGG + Intronic
1161145142 19:2673150-2673172 AGGAGGGTGAGCCAGGAGAATGG + Intronic
1161214739 19:3088570-3088592 AGGAGGGAGGGCTTGGAGTGGGG + Intergenic
1161443426 19:4305025-4305047 AGGAGGGAGGGCGTGGGGGATGG - Intronic
1163939133 19:20476862-20476884 AGGCGGGAGGGACTGGAGGAGGG + Intergenic
1164473307 19:28553906-28553928 AGGAGGGCTGTCCAGGAGAGTGG - Intergenic
1164714997 19:30384691-30384713 AGGAGGAATGGCTTGGAATAGGG + Intronic
1164800684 19:31073694-31073716 AGGAAGGACGGAGTGGAGAAAGG - Intergenic
1164932607 19:32186966-32186988 AGAAGGGATTGTCAGGAGAAGGG - Intergenic
1165245797 19:34497789-34497811 AGCAGGGATGGTCTGCAGAGGGG + Intronic
1165397156 19:35570723-35570745 AGGAAGGGTGGGATGGAGAAGGG + Intergenic
1166068669 19:40375254-40375276 AGGAGGCATGGGCTGGAAACAGG + Intronic
1167195192 19:48023453-48023475 AGGAGGGAAGGAATGGAGGAAGG + Intronic
1167203099 19:48081058-48081080 AGGAGGCTGGGCCAGGAGAATGG + Intronic
1167498205 19:49831298-49831320 AGGAAGGAGGGCCATGAGAATGG - Intronic
1167695962 19:51015791-51015813 AGGAAGGATGGGCTGGGGACTGG - Intronic
1168114093 19:54211348-54211370 GAGAGGGATGGACTGGAGTAGGG + Intronic
1168140057 19:54379992-54380014 GGGGGTGATGTCCTGGAGAAAGG + Intergenic
925633126 2:5915543-5915565 GAGAGGGATGGCTTGGAGACAGG + Intergenic
925831905 2:7904079-7904101 AGGATTGAGGGCATGGAGAATGG - Intergenic
925843102 2:8010655-8010677 AGAAAGGATGGCTTGGTGAATGG + Intergenic
926458951 2:13103694-13103716 GGGAGGGATGGGGTGGGGAAGGG - Intergenic
927011241 2:18906734-18906756 AGGAGGGATGGCAATGTGAATGG - Intergenic
927898444 2:26801302-26801324 CGGAGGGATGTCCTGCAGGATGG - Intergenic
928660552 2:33497974-33497996 AGGAAAGAAGGGCTGGAGAAAGG - Intronic
928660556 2:33497994-33498016 AGGAAAGAAGGGCTGGAGAAAGG - Intronic
929119697 2:38474292-38474314 AGGAGGGATGGAATACAGAAGGG + Intergenic
930056590 2:47257045-47257067 AGGAGGGACGGCCTCCAGAATGG + Intergenic
930277127 2:49324721-49324743 AGGAGGGAGGGAGGGGAGAAGGG + Intergenic
931060258 2:58520837-58520859 AGGAGGGGTGGGTTGGGGAAGGG + Intergenic
931525098 2:63144696-63144718 AAGAGGGATGGACTAGAGAAAGG - Intronic
931986962 2:67751449-67751471 AGGAGGGGTGAGCAGGAGAAAGG + Intergenic
932570789 2:72937368-72937390 TGCAGGGATGCCCTGGAGCAGGG - Intergenic
932763559 2:74456186-74456208 TGGCTGGATGCCCTGGAGAAGGG + Exonic
933214322 2:79610700-79610722 AGAAGGGATGGGATGGAGAGAGG + Intronic
934502796 2:94872806-94872828 AGGGGGAAGGGCCTGCAGAAGGG - Intronic
934574772 2:95392932-95392954 AGGAGGAAGGGGCTGGGGAAAGG + Intergenic
934584957 2:95483721-95483743 TGGAGGCGGGGCCTGGAGAATGG + Intergenic
935333372 2:101993926-101993948 AGGTGGGATGGAGTGCAGAAAGG - Intronic
935533166 2:104260808-104260830 AGCAGTGCTGGCCTGGAAAATGG - Intergenic
936091445 2:109504147-109504169 AGGCAAGATGGCCTGAAGAAAGG - Intronic
936523050 2:113224075-113224097 AGGAGGGATGGGTGGAAGAATGG + Intronic
937056393 2:118940873-118940895 AGGTGGGACAGCCTGGAGCAGGG - Intergenic
937193544 2:120129032-120129054 AGGAGGGATGGACTGGGAAAGGG + Intronic
937209755 2:120260682-120260704 AGGAGGGATGGCCTCAGGAGGGG + Intronic
937498775 2:122454485-122454507 GGGAGGGATGGAGTGGGGAATGG + Intergenic
937868113 2:126768991-126769013 AAGAGGTAGGGCCAGGAGAAGGG + Intergenic
939629051 2:144513100-144513122 AGGAGGCACCTCCTGGAGAAGGG + Intronic
940503843 2:154527717-154527739 AGGAGGTAGGGCCTGGAAAGGGG + Intergenic
940861316 2:158773287-158773309 AGGGGGCATGGCTTGGAGAGGGG + Intergenic
941173943 2:162174089-162174111 AGTAGGAATGACCTGTAGAATGG + Intronic
941263272 2:163323992-163324014 AGGAGTGAGGGCTGGGAGAAAGG + Intergenic
941419974 2:165271705-165271727 AGGAGGGATTGACAGGAAAAGGG - Intronic
941746008 2:169087786-169087808 AGGAGGTAGGGCCTGGAATAGGG + Intronic
942445016 2:176071936-176071958 AGGAGGGACGGCCAGGCGAGAGG - Intergenic
942734764 2:179097093-179097115 AGGAGGTAGGGCCTGGAATAGGG + Intergenic
943040986 2:182804733-182804755 AGGAGGGAGGAAGTGGAGAAAGG - Intergenic
944081425 2:195792799-195792821 GGGAGGGATGGTCAGGGGAAGGG + Intronic
944221796 2:197310677-197310699 GGAAGGGATTGCCAGGAGAAGGG + Exonic
945839261 2:214868656-214868678 AGGAGGGATATACTGGAGGATGG - Intergenic
946140915 2:217689995-217690017 AGGAGGGATGGCCCAAAGAGAGG + Intronic
946305470 2:218854652-218854674 AGGAGAGTTGGCCTGGAGGTTGG - Intergenic
946418223 2:219551171-219551193 AGGAGGGACAGGCTGGAGGAAGG + Intronic
946441983 2:219704399-219704421 AGGATGGATTGCCTGGGGGAGGG - Intergenic
946519121 2:220446693-220446715 AGGAGGGAGGGAGGGGAGAAGGG - Intergenic
946679593 2:222199379-222199401 AGGAGGGAGGGAGAGGAGAAAGG + Intergenic
946903748 2:224396477-224396499 TGGAGGGATGGTCTGCAGAGAGG + Intronic
948334932 2:237200492-237200514 ACCAGGGATGGCCTGAAGCATGG - Intergenic
948761709 2:240196468-240196490 AGGAGGAATGGCCTGGCTAGGGG - Intergenic
1168799592 20:635586-635608 AGGAGGGCAGGCCTGGGGAAGGG - Intergenic
1169154845 20:3321051-3321073 GGGTGGGATGGCATGGCGAAGGG - Intronic
1169661720 20:7985788-7985810 TGGAGGCTTGGCCTGAAGAAAGG - Intronic
1169764874 20:9138147-9138169 AGGAGGAATGGCATGAAGGAAGG + Intronic
1170107325 20:12765680-12765702 AAGTGGGATGGCATGGACAAAGG + Intergenic
1170329308 20:15190982-15191004 AGGAGGGATGGCCTCTATCAGGG - Intronic
1170591051 20:17772131-17772153 AGGAGGGAAGGCAAAGAGAAGGG - Intergenic
1171361713 20:24590643-24590665 GGGAGGGATGCCCTGGACCAGGG + Intronic
1171365291 20:24618354-24618376 AGGGGGGAGAGCCTGGGGAAGGG + Intronic
1172203976 20:33148899-33148921 AGGAGGGGTGGCTGGGAGGATGG + Intergenic
1172587398 20:36093986-36094008 AGGAGGGATTCCCTGGAGTGAGG - Intronic
1172834827 20:37866436-37866458 AGGAGCTATGGCTTGGAGAGGGG - Intronic
1172901281 20:38336602-38336624 AGGATTGATGGCCTGGACATTGG - Intronic
1173162707 20:40664280-40664302 AGGAGGGAGGGGATGGAGGAAGG - Intergenic
1173225870 20:41162121-41162143 AGGAGGGGAGGCCTGGAGTGTGG + Intronic
1173586572 20:44187212-44187234 AGGAGGGCAGGATTGGAGAAGGG - Exonic
1173614410 20:44393437-44393459 GTGAGAGATGGCCAGGAGAAGGG - Intronic
1173784066 20:45779850-45779872 AGGAAGCCTGGCCTGGAAAAGGG - Intronic
1173836391 20:46128780-46128802 AGGGGGGAGGGCTTGGGGAAGGG + Intronic
1173893021 20:46528025-46528047 AGGGAGGATGTCCTGGAGGAGGG + Intergenic
1174555762 20:51394347-51394369 AGGAGAAATGGCATGGTGAAAGG - Intronic
1175221161 20:57417308-57417330 GGGAGGGAGGGACTGAAGAAAGG + Intergenic
1175367851 20:58467736-58467758 AGGAGGGCTGGGGGGGAGAAAGG - Intronic
1175926970 20:62475838-62475860 AGGACGCAGGGCCTGGAGAGCGG + Intronic
1175983940 20:62755044-62755066 GGGAGGGATGGAGTGCAGAATGG - Intronic
1177713010 21:24804251-24804273 AGGAGTGATCACCTGGACAAGGG - Intergenic
1178539016 21:33433824-33433846 AGGTGGCCTGGCCTGGAGATTGG + Intronic
1179051138 21:37889443-37889465 GGGAGGGCTGGGCTGGGGAAAGG + Intronic
1179274205 21:39876906-39876928 AGGACGGTTGACCTTGAGAAAGG + Intronic
1179920980 21:44507192-44507214 GGGAGGGAGGGGCTGGAAAAGGG + Intronic
1180063853 21:45403265-45403287 AGGAGGGAGGGGCTGGGGCAGGG - Intergenic
1180639776 22:17288953-17288975 AGGAGGGAACTCCTGGAGCAAGG + Intergenic
1180743101 22:18067423-18067445 AGCAGGGATGGACAGGAGGATGG - Intergenic
1180976874 22:19853577-19853599 AGGGGGGATGGCCAGCAGATAGG - Intronic
1181033202 22:20157956-20157978 AGGAGGGCTGGCCAGGAGGCTGG + Intergenic
1181306538 22:21920350-21920372 TGGAGAGCTGGGCTGGAGAAAGG + Exonic
1181351328 22:22260514-22260536 AGGAGGGGGGGACTGGAGGAGGG + Intergenic
1181510105 22:23385276-23385298 AGGAGGGCTGGCCGGGAGGCTGG - Intergenic
1181711755 22:24695748-24695770 AGGAGGGCCGGCCTGGAGGACGG - Intergenic
1182008336 22:26979796-26979818 AGGAAGGATGGGCGGGATAAAGG - Intergenic
1182280052 22:29213398-29213420 AGGTGGGAAGGCTGGGAGAAGGG - Intronic
1182292608 22:29293038-29293060 AGGAGGGAAGGCCGGGCGTAGGG - Intronic
1183474324 22:38027498-38027520 AGAAGGAATGGCCTGGGCAAAGG - Intronic
1183639804 22:39085980-39086002 AGGAGGGACAGCCTGGATCAGGG - Intronic
1184336766 22:43858421-43858443 AGGAGGCTTGACCTGGGGAAGGG - Intronic
1184460547 22:44635306-44635328 AGGGGGCATGGCAGGGAGAAGGG + Intergenic
1184710486 22:46246766-46246788 TGGAGGGATCTCCAGGAGAAGGG - Intronic
949366773 3:3290322-3290344 GGGAAGGATGGCCCTGAGAAAGG - Intergenic
950175197 3:10868624-10868646 AGAAGGGTGGGCGTGGAGAAAGG - Intronic
950198445 3:11026144-11026166 TGGAGGGGTGGCCCGGAGGAGGG - Intronic
950509859 3:13419768-13419790 AGGAGGGGTGGCCTGGGGAGCGG - Intronic
952534594 3:34296280-34296302 AGGAGCAATTGTCTGGAGAAGGG + Intergenic
952585736 3:34890037-34890059 AGGGGAGATGGAATGGAGAAAGG - Intergenic
952892909 3:38055637-38055659 AGGAGAGTGGTCCTGGAGAAAGG + Intronic
953430453 3:42835457-42835479 AGGAGAGTGGTCCTGGAGAAAGG - Intronic
953701148 3:45196748-45196770 AGGAGGAATGGGCTGAAGGAGGG + Intergenic
954450945 3:50571369-50571391 AGGAGGGAGGACTTGGGGAAGGG + Intronic
954579345 3:51694811-51694833 AGCAGGGAGAGCCTGCAGAAGGG - Intronic
955067076 3:55543066-55543088 AGGAAGGCAGGCCAGGAGAAGGG - Intronic
955272590 3:57516458-57516480 AGGAGGGAAGAGCTGGAGTAGGG - Intronic
955598081 3:60613563-60613585 AGGAGGGAAGGGCTGGAGGGAGG - Intronic
956111102 3:65870586-65870608 AGGAGGGAGGGAGAGGAGAAGGG + Intronic
956227716 3:66978168-66978190 AGGAGGTATGGTCTGCAGCAGGG + Intergenic
956261508 3:67348164-67348186 GAGAGGGATGGACTGCAGAAAGG + Intergenic
956326712 3:68060754-68060776 TGGAGGGGTGGGCTTGAGAAAGG + Intronic
956517160 3:70062027-70062049 TGGAGGGTTTGCCTGTAGAATGG - Intergenic
956905846 3:73764140-73764162 AGGAGGTAGGGCCTTAAGAAAGG - Intergenic
958461621 3:94405088-94405110 AGGAGGGATAGCATGGTGAAAGG + Intergenic
958564713 3:95795181-95795203 AGGAGGGAAGGAAGGGAGAAAGG - Intergenic
958993151 3:100871013-100871035 ATGAGGGATGGGATGGAGAGGGG + Intronic
961376480 3:126469525-126469547 AGGTGGGATGGCCTGGACGGGGG - Intronic
961490468 3:127253824-127253846 AGAAGGGATGGGCTGGGGAAAGG - Intergenic
961664904 3:128488905-128488927 AGGAGGGAGGTCCAGGACAAAGG + Intronic
961958118 3:130825374-130825396 AGGAGGGAAGGCAGGGAGGAGGG + Intergenic
962382518 3:134909204-134909226 TGAAGGGATGCCATGGAGAAAGG + Intronic
963432293 3:145223708-145223730 AGCAGGGATAGACTGGAGGATGG + Intergenic
964892910 3:161557980-161558002 AAGAGGGATTTCCTGGGGAAAGG + Intergenic
966850913 3:184164580-184164602 CGGAGGGATGGCCCAGAGCATGG + Exonic
967228154 3:187312746-187312768 AGGTGGCATGGCCTGGAAGAGGG - Intergenic
967235891 3:187383245-187383267 AGGAGGGAGAGGCTGGGGAATGG + Intergenic
967806610 3:193719711-193719733 AGGAAGGATGCCCTGGAGGTGGG + Intergenic
967893842 3:194382033-194382055 AGGGGTGAGGGGCTGGAGAAGGG + Intergenic
968233336 3:197016911-197016933 AGGAGGGCTGGCCAGGAGAGGGG - Intronic
968324540 3:197801577-197801599 AGGAGGGATGGTAGAGAGAAAGG - Intronic
968485639 4:859711-859733 AGAAGAGGGGGCCTGGAGAAGGG + Exonic
968647631 4:1748435-1748457 TGGAGTGATGGGCTGGAGGAGGG - Intergenic
968712428 4:2128571-2128593 AAGAGGAATGGCCTGGGCAAGGG + Intronic
969046328 4:4339271-4339293 GGCAGGGATGCCCTGGAGGAGGG - Intergenic
969134542 4:5019642-5019664 AGGAGGGGCTGCCTGGAGGAGGG + Intergenic
969226265 4:5800521-5800543 AGGATGGAGGGCCTGGTGAAGGG + Intronic
969424848 4:7118182-7118204 AGGATGGATGGACTGAGGAATGG + Intergenic
969502613 4:7562388-7562410 AGGAGGGATGGCCTGGGATGAGG + Intronic
969510579 4:7615364-7615386 AGGTGCCTTGGCCTGGAGAAAGG + Intronic
969525350 4:7701426-7701448 AGGAGGAAACGCCTGGGGAAGGG + Intronic
969943003 4:10753697-10753719 AGTTGGGATGGCCTGGAGGCTGG - Intergenic
970169780 4:13278141-13278163 AGGAAGGAGGCCCTGGAGACAGG + Intergenic
970443883 4:16108346-16108368 AGGAGGGTTGGGGAGGAGAAAGG + Intergenic
971350057 4:25847397-25847419 AGGCGGGATGGTCTGCAGGAGGG + Exonic
971352517 4:25865835-25865857 TGGAGGGAGGGGCTGGAGAAAGG + Intronic
971423268 4:26492780-26492802 AGGAGGGATGGAGGGAAGAAAGG - Intergenic
971503030 4:27336968-27336990 AGGAGAGGTGGTCTGGGGAAAGG + Intergenic
972267264 4:37473821-37473843 AGGGGGGCAGGGCTGGAGAAAGG - Intronic
976299812 4:83507024-83507046 AGGCGGGAGGGACTGGAGGAGGG + Intronic
977351797 4:95897826-95897848 TGTAGGGATTGCCTGGTGAAGGG + Intergenic
977420170 4:96789627-96789649 AGGAGGGATGGCAGGAAGGAAGG - Intergenic
978837886 4:113175480-113175502 AGGAGTGCTGGGCTGGAGAGGGG - Intronic
979846915 4:125525170-125525192 ATGAGAGAAGGACTGGAGAAGGG - Intergenic
980226872 4:129998498-129998520 AGGAGCTATGGCCTGGAAAGAGG - Intergenic
982117272 4:152108007-152108029 AGGAGGGCTGGGCTGGGTAAGGG + Intergenic
983633370 4:169872641-169872663 AGGTGGGATGGCCAGAGGAAAGG + Intergenic
984760097 4:183356430-183356452 AGAAGGGAAGGCAGGGAGAAAGG - Intergenic
984949972 4:185000856-185000878 CGGTAGGATGGCTTGGAGAAAGG - Intergenic
986018541 5:3779540-3779562 AGGAGGGCTGGCCCGGAGTGGGG + Intergenic
986370497 5:7075459-7075481 AGGAGTGAGGGCCTGGGGCAGGG - Intergenic
986380619 5:7181706-7181728 ATGAGGGGTAGGCTGGAGAAAGG - Intergenic
986779904 5:11055659-11055681 TAGAGGGATGGCCTGGAGTCTGG + Intronic
988542650 5:32125510-32125532 AGCAGGGGTGGCCAGAAGAAGGG + Exonic
990185314 5:53204462-53204484 AGGCGGGAGGGACTGGAGGAGGG - Intergenic
990306375 5:54497525-54497547 AGGAGGGGGAGCCTGAAGAAAGG - Intergenic
991609645 5:68436861-68436883 AGGAGGCAGTGCCTGGATAATGG + Intergenic
992024745 5:72659207-72659229 ATGAGACATGGCTTGGAGAAAGG + Intergenic
992873189 5:81026131-81026153 AGGAAGGATGGAAGGGAGAAAGG - Intronic
994002073 5:94792234-94792256 AGATGTGGTGGCCTGGAGAAGGG - Intronic
995762625 5:115579460-115579482 ATCAGGGATGGGGTGGAGAATGG - Exonic
997691915 5:135833006-135833028 AGAAGGGATGGCCTGGATCCTGG + Intergenic
998145400 5:139724982-139725004 AGGATGGATGGTATGGAGTAGGG + Intergenic
1000068780 5:157719844-157719866 AGGAGGCTGGGCCAGGAGAATGG + Intergenic
1000642370 5:163718190-163718212 CGGAGGGAAGGCATTGAGAATGG + Intergenic
1001802448 5:174555982-174556004 AGGAGGGATGGCATGTGCAAAGG - Intergenic
1001833620 5:174811258-174811280 TGGAGGGTTGGCCTGGAGGATGG - Intergenic
1001881791 5:175251024-175251046 AGGTGGGGTGGCATGGAGGAGGG - Intergenic
1002042036 5:176521519-176521541 AGGAGGGATAGGCTGAAGAGGGG + Intergenic
1002094371 5:176822488-176822510 AGGAAGGTTGGCGTGGTGAAGGG + Intronic
1002781839 6:372969-372991 AAGACGGATGTGCTGGAGAAAGG + Intergenic
1003016530 6:2472502-2472524 TGGCAGGATGGCCTGGAGATGGG - Intergenic
1003123928 6:3340127-3340149 AGGAGGGATGGCCTGGAGAAGGG + Intronic
1004135024 6:12957791-12957813 ACGTGGGATGGAATGGAGAAGGG - Intronic
1004710085 6:18161615-18161637 AGTAGGGAGGGCCTTGAGGAGGG - Intronic
1005913860 6:30334819-30334841 AGGATGGATGGCCTGAACACTGG - Intronic
1006503043 6:34470042-34470064 GGGAGGGCTGGGCTGGAGACTGG + Intronic
1006669163 6:35718957-35718979 AGTGGGGAGGGCCTGGAGGAGGG + Intronic
1006731677 6:36240740-36240762 AGGAGGGTGGGGCTGGAGAGAGG - Intergenic
1007302302 6:40876527-40876549 AGGAGGGATGGAAGGGGGAAGGG - Intergenic
1007303275 6:40884745-40884767 AGAGGGGATGGCCCAGAGAAGGG + Intergenic
1008026533 6:46642922-46642944 AGGAGGGAACGCATGGAGAATGG - Intronic
1008392266 6:50966090-50966112 AGGAGGGAAGGCATAGATAATGG + Intergenic
1008395642 6:51003598-51003620 AGGAGGCATGGCATGGTGGAAGG + Intergenic
1008716614 6:54296258-54296280 TGGAGGGAAGGCCTTGAGAATGG - Intergenic
1010014919 6:71093419-71093441 AGGAGGGATGGAGAGGAGCAAGG + Intergenic
1011222178 6:85066239-85066261 AGGTGTGATGGCCAGGAGAGAGG - Intergenic
1011259659 6:85457653-85457675 AGAAATGATGGCCTGGGGAATGG + Intronic
1012930219 6:105308975-105308997 AGGATGGAGGGCCAGGAGTAGGG + Intronic
1013606116 6:111750334-111750356 AGGAGAGAGGGCTAGGAGAAAGG - Intronic
1013609581 6:111781631-111781653 AGGAGGGATGGCCTGCCTAGAGG - Intronic
1013693494 6:112673017-112673039 AGGAGGGAAGGGGAGGAGAAGGG - Intergenic
1015464102 6:133528686-133528708 AGGAGGGATGGGAGAGAGAAGGG - Intronic
1016063646 6:139656098-139656120 AGGAGGGAAGGGAGGGAGAAAGG - Intergenic
1016271378 6:142294012-142294034 AGGAGTGATGTTCTAGAGAAGGG - Intergenic
1016881972 6:148920481-148920503 AGGAGGGTTGGAGTGGAAAAAGG - Intronic
1017442272 6:154475290-154475312 AGGAGGGACGAGGTGGAGAAGGG - Intronic
1018297809 6:162367965-162367987 CGGAGGAGTGGCATGGAGAAGGG + Intronic
1018721097 6:166573095-166573117 AGGAGGGATGGCCCGGTGCAGGG + Intronic
1019463259 7:1172613-1172635 AGCGGGGATGGCCTGGACAGAGG - Intergenic
1019515638 7:1438709-1438731 TGGAGGGAAAGCCTGGAGGAAGG - Intronic
1019549522 7:1595055-1595077 TGGAGGGATGGACAGGAGGATGG - Intergenic
1020211519 7:6161678-6161700 AGGTGGGATGGCCTGGCCGAAGG - Intergenic
1021961518 7:25877866-25877888 AAGAGAGATGGGATGGAGAAAGG - Intergenic
1022003477 7:26246748-26246770 AGGCGGGAGGGACTGGAGGAGGG - Intergenic
1022213382 7:28233954-28233976 AGGAGGGAAGGAATGGAGGAAGG - Intergenic
1022358696 7:29639656-29639678 AGGAAGGCTTGCCAGGAGAAAGG - Intergenic
1022532374 7:31075129-31075151 AGGTGAGATGGCCTGGGGCAGGG - Intronic
1022568008 7:31422872-31422894 GGGAGGGATGGGATGCAGAAAGG + Intergenic
1022586410 7:31617166-31617188 AGGAAGAAAAGCCTGGAGAAGGG + Intronic
1022647571 7:32245468-32245490 ACGAGGATTGGGCTGGAGAAGGG - Intronic
1023043851 7:36194996-36195018 AAGAGGGATGGGCTGGAAATTGG - Intronic
1023660848 7:42469543-42469565 AGGAGGGCTGTCTTGAAGAAAGG - Intergenic
1023750159 7:43364638-43364660 AGAAGGGATGGCCTGTACAAAGG + Intronic
1024188967 7:46985861-46985883 AGGATGGATGGCTTAGAGAATGG - Intergenic
1026108457 7:67439261-67439283 AGCAGAGATTTCCTGGAGAAAGG - Intergenic
1026138382 7:67683446-67683468 AGCAGGGTTGGCTTGGAGACTGG - Intergenic
1027141677 7:75662025-75662047 AGGAGGGGTGGACTGGAGAGTGG + Intronic
1027188565 7:75985490-75985512 AGTGGGGCTGGCCTGCAGAACGG + Intronic
1028032152 7:85930014-85930036 AGGAGGCTGGGGCTGGAGAATGG - Intergenic
1029201734 7:98843708-98843730 AAGAGGGATGGCGTGAGGAAGGG - Intergenic
1029314195 7:99696634-99696656 AGGAGGAATGTCCTGGAAATTGG - Intronic
1029319835 7:99749126-99749148 AGGAGGAATGTCCTGGAAATTGG - Intergenic
1029322888 7:99780874-99780896 AGGAGGAATGACCTGGAAATTGG - Intronic
1029378575 7:100197749-100197771 AGGAGGGAAAACCAGGAGAATGG - Intronic
1029496194 7:100896495-100896517 AGGTGGGAGGGCATGGAGACAGG + Intronic
1029514928 7:101018355-101018377 AGGAGGGAGTCCCAGGAGAAGGG - Intronic
1029886453 7:103877779-103877801 AGAAGGGAGGGCCTGGAGGCAGG - Intronic
1030292513 7:107886772-107886794 AGGAGGAAAGGGCTTGAGAAAGG + Intergenic
1031597048 7:123660434-123660456 CCGAGTGATGGCCTGGGGAAGGG - Intronic
1032013196 7:128360052-128360074 AGGAGGAAGGTCCTGGAGAGAGG + Exonic
1032068818 7:128791589-128791611 AGGAGGGATGGAGGAGAGAAAGG - Intronic
1032459395 7:132098599-132098621 AGGAGGGAATTCCTGAAGAAGGG + Intergenic
1032482035 7:132254990-132255012 AGGGGGGGTGGCCTGGGGGAAGG + Intronic
1033272698 7:139947055-139947077 AGGAGGGAGGGCCTGATGAGTGG - Intronic
1033599534 7:142878649-142878671 AGGAAGGAAGGCCTGGAGCCAGG - Intronic
1034210808 7:149360432-149360454 AGGAGGGAGAGACAGGAGAATGG - Intergenic
1034338005 7:150335781-150335803 AGCAGGGGTGGCCTGGTGGAGGG - Intronic
1034707477 7:153158488-153158510 AGGATGGATGTCCTGGTGTATGG + Intergenic
1034822520 7:154230136-154230158 AGGAGGGAGGGGTTGGAGGAGGG - Intronic
1035090558 7:156306607-156306629 TGGAGGGATGGGCTGCAGAACGG - Intergenic
1035168244 7:157004017-157004039 AGGAGGAAGGCCCGGGAGAAGGG + Intronic
1035417450 7:158702331-158702353 TGGAGGAATGGCCTTTAGAAAGG - Intronic
1036062716 8:5342278-5342300 AGGAGAGAAGGACTGGAGAGGGG - Intergenic
1036453787 8:8891736-8891758 TGGAGGGATGCCCAGGAGGAGGG - Exonic
1036563032 8:9913666-9913688 AGGAGGTAGGGCCTGGAGCTGGG - Intergenic
1037339804 8:17832243-17832265 AGGAGGGATGGCGGGAGGAAGGG + Intergenic
1037366597 8:18128941-18128963 AGGAGCAATGGCCTGGAGTCAGG - Intergenic
1037676693 8:21057204-21057226 AGGTGGGAAGGACTAGAGAAGGG + Intergenic
1037787251 8:21910409-21910431 AGCAGGAAGGGCCTGGAGAGGGG - Intronic
1037804288 8:22050514-22050536 GGGAGGGAGGGGCCGGAGAAAGG - Intronic
1037944823 8:22982243-22982265 AGGTGGGAAGGCCAGGAGACAGG - Intronic
1037987502 8:23299130-23299152 AGGAAGCATGGCCTGGAAGAGGG + Intronic
1038052556 8:23827439-23827461 AGGAGGGGTGGCCTGGCCCAGGG + Intergenic
1038454955 8:27667074-27667096 AGGAGAGAAGGGCTAGAGAAGGG - Intronic
1038455367 8:27669175-27669197 AGGAGGGAGTGGCAGGAGAAGGG + Intronic
1039241317 8:35559728-35559750 AGGAGGGAAGAAATGGAGAAGGG - Intronic
1039607193 8:38891143-38891165 AGGAGGGGTGGCCTGGTGGGGGG - Intergenic
1041151929 8:54944171-54944193 AGGAGCCATGGGCTGGAGCAGGG - Intergenic
1041278729 8:56190291-56190313 AGGAGGGACTATCTGGAGAATGG + Intronic
1041485190 8:58368861-58368883 AGGAGGAATGGTAGGGAGAAGGG + Intergenic
1041632502 8:60103924-60103946 AGGCGGGATGGGCTTGAGCACGG - Intergenic
1042369349 8:67973110-67973132 AGCAGGGGAGGCCTGGAGAAAGG - Intronic
1042880247 8:73479947-73479969 AGGAGGGAAAGACTGGAGACAGG - Intronic
1042956635 8:74257977-74257999 ATGAGAAATGACCTGGAGAATGG - Intronic
1042962611 8:74320579-74320601 GGGAGGGTTGGGCTGGAGAGAGG - Intronic
1043553037 8:81396471-81396493 ATGAGGGCTAGCCTGGAGCATGG + Intergenic
1044193108 8:89342829-89342851 AGGAGCTAGGGCCTGGAAAAGGG + Intergenic
1044429748 8:92095284-92095306 AGGAGGGGTGGCCAGGAGGAAGG - Intronic
1044565902 8:93661035-93661057 TGGAGGTATGGCCTGGTGAGAGG + Intergenic
1044722228 8:95161467-95161489 AGGAGGGAGGGAATGAAGAAGGG + Intergenic
1045248721 8:100465635-100465657 GGCTGGGATGGCCTGGAAAATGG + Intergenic
1045375579 8:101570778-101570800 AGCTGGGGTGGCTTGGAGAATGG - Intronic
1045601684 8:103723920-103723942 AGGAGGGATGGCCTGGTGCTAGG + Intronic
1045766905 8:105683130-105683152 AGGAGGTAGGGCCTTCAGAAGGG - Intronic
1046178046 8:110605256-110605278 TGGAGGGGAGGCCTGGTGAAAGG - Intergenic
1046871512 8:119209179-119209201 AGGAGGCAGGGCAAGGAGAAAGG + Intronic
1047209884 8:122832726-122832748 AGGCGGGAGGGACTGGAGGAGGG + Intronic
1047917090 8:129593933-129593955 AGGCGTGTGGGCCTGGAGAATGG - Intergenic
1048717501 8:137285118-137285140 AGGCGGGAGGGACTGGAGGAAGG - Intergenic
1049203872 8:141354407-141354429 AGGGGGAATGGCCTGGGCAAAGG - Intergenic
1049755295 8:144308822-144308844 AGAAGGGGCGGCCTGGGGAAGGG + Intronic
1049825871 8:144667397-144667419 ATGAGGGAGGGCCTGGAGATTGG - Intergenic
1049940492 9:541673-541695 TGAAGAGATGGCCTGTAGAATGG + Intronic
1049986337 9:955121-955143 AGTGGGGAGGGCCTGGAGAAAGG + Intronic
1050078529 9:1890321-1890343 AATAGGGTTGGCCGGGAGAAGGG + Intergenic
1050315914 9:4400765-4400787 AGGAGCTAGGGCCTGGAGCAGGG - Intergenic
1051247735 9:15128621-15128643 AGGAGGCTGGGCCAGGAGAATGG - Intergenic
1052427847 9:28327885-28327907 AGGAAGGAAGGCAAGGAGAAAGG + Intronic
1052533387 9:29717243-29717265 AGGAGGGATGGAGTGGAGCAAGG - Intergenic
1053131036 9:35615894-35615916 GGGAGGGATGGATTGGAGCAAGG - Intronic
1053152345 9:35751005-35751027 TGGAGGGAAGGGCTGGGGAAGGG + Intronic
1053152491 9:35751826-35751848 AAGAGGGGTGGCATGTAGAAGGG + Intronic
1053198148 9:36136019-36136041 AGGAGGGACCGCCTGAGGAAAGG + Intergenic
1053304727 9:36976369-36976391 GGGAGGGGGGTCCTGGAGAAGGG + Intronic
1054791424 9:69260203-69260225 AGGAGGGGAGGGCTGGAGCAGGG + Intergenic
1054850884 9:69845636-69845658 AATAAGGATCGCCTGGAGAATGG + Intronic
1054925214 9:70581906-70581928 AGGAGGGAAGGAATGAAGAAGGG - Intronic
1055935780 9:81603167-81603189 AGCAGGGATTCCCTGCAGAAGGG - Intronic
1056222884 9:84467630-84467652 AGGAGAGAAGGCCTGCCGAATGG + Intergenic
1056839910 9:89990280-89990302 AGAGGGGTTGGCCTGGAGACTGG - Intergenic
1057186715 9:93061193-93061215 TGGAGGAAGGGCCTGGAGAGGGG + Intronic
1057314908 9:93961716-93961738 AGGAGGGCTGGCCTGGAGCCAGG - Intergenic
1057891971 9:98876367-98876389 TGGTGGGGTGTCCTGGAGAAAGG + Intergenic
1057975693 9:99603499-99603521 AGGAGGGATGGGCTTAAGAGTGG + Intergenic
1057999274 9:99848747-99848769 AGGTGGGGTGGGATGGAGAAAGG + Intronic
1058914621 9:109553766-109553788 CGGATGGATGGCTTGGTGAATGG + Intergenic
1059375670 9:113879150-113879172 AGGAGAGATGGGCTGGGGAGGGG + Intronic
1060374607 9:123107195-123107217 AGGAGAGAAGACATGGAGAATGG + Intergenic
1060544260 9:124451099-124451121 AGGAGGGATGGCATGGTCACAGG + Intergenic
1060794155 9:126503377-126503399 AGCAGGGCTGGCCCGGAGACTGG + Exonic
1060800828 9:126545073-126545095 AGTAGGGAAGGACTCGAGAAGGG - Intergenic
1061573128 9:131489878-131489900 AGGAGCGACGGCCTGGAAACTGG - Intronic
1061750947 9:132776623-132776645 AGGATGGAAGGGCTGGAGGATGG + Intronic
1061890551 9:133616965-133616987 AGGAGGGATGACCTGCAGGGTGG - Intergenic
1062217137 9:135395288-135395310 TGGATGGATGGGATGGAGAAGGG + Intergenic
1062394707 9:136348135-136348157 AGGAGGGATGGACAGGAGCCCGG + Intronic
1062421862 9:136486489-136486511 TGGAGGCTTGGCCTGGAGAGAGG + Intergenic
1062623355 9:137432473-137432495 AGGAGGCAGAGCCAGGAGAATGG + Intronic
1185529610 X:806996-807018 AGGAGGGAAGGAATGGAGGAAGG + Intergenic
1185611139 X:1394354-1394376 GGGAGGGAGGGACGGGAGAAAGG - Intergenic
1185873716 X:3685193-3685215 AGGAGGGAAGGGCTGAAGGAAGG - Intronic
1185883335 X:3759596-3759618 AGGATGGATGGAATGGTGAATGG - Intergenic
1185885713 X:3780730-3780752 AGGAGGGCTGGGCTGGATTATGG + Intergenic
1187977574 X:24718722-24718744 TGGAGGGATGGGCTGGTGTAGGG + Intronic
1188254725 X:27947816-27947838 AGACGAGATAGCCTGGAGAATGG - Intergenic
1190122274 X:47672080-47672102 AGGAGCCATGGCCTGGAGTCAGG + Intergenic
1190248444 X:48705790-48705812 AGCAGGGAGGGCGTGGAGAGAGG - Intronic
1190301374 X:49059379-49059401 AGCAGGGATAGGGTGGAGAAGGG - Intronic
1190729371 X:53215237-53215259 AGGAGGGATGGCCTTGAGAAAGG + Intronic
1190945505 X:55089312-55089334 GGGAGGGATTGCCTGAAGATGGG + Intronic
1192341149 X:70264361-70264383 AGGAGGGAGGGAGGGGAGAAAGG + Intergenic
1192946006 X:75966202-75966224 AGGTGGGAGGGACTGGAGGAGGG + Intergenic
1193946995 X:87750760-87750782 AGCTGTGATGGCCTGCAGAAGGG - Intergenic
1194386651 X:93263781-93263803 AGGTGTGATGGCCAGGATAAAGG - Intergenic
1195009289 X:100719627-100719649 AGGATGGATGTCCTGGATGAGGG - Intronic
1195502046 X:105613175-105613197 AGGAGAGATGGCCTGGAAATGGG - Intronic
1196082548 X:111649038-111649060 ATGAGGGCTGGCCTAGAGCATGG + Intergenic
1196508452 X:116476886-116476908 AGGAGCTAGGGCCTGGAAAAGGG + Intergenic
1197873910 X:131084454-131084476 AGGAGGGATGTTCTGGAAATGGG + Intronic
1198087116 X:133292234-133292256 AGGAGGGATGGGGTTGAGGATGG + Intergenic
1198544940 X:137681520-137681542 AGGAGGGATGTTCTGGACTAGGG - Intergenic
1198854978 X:141005955-141005977 AGGAGCGAGTGCCTGGAGCAGGG - Intergenic
1198877034 X:141239185-141239207 AGGAGCGAGTGCCTGGAGCAGGG + Intergenic
1198907714 X:141581414-141581436 AGGAGCGAGTGCCTGGAGCAGGG + Intergenic
1198909077 X:141593010-141593032 AGGAGCGAGTGCCTGGAGCAGGG - Intronic
1199913552 X:152314554-152314576 AGTTGGGATGGGCTGTAGAAAGG - Intronic
1200329622 X:155282550-155282572 TGCAGGGATGGCCTGGACATTGG - Intronic
1200580088 Y:4939087-4939109 CGGAGGGAAGGCATTGAGAATGG - Intergenic