ID: 1003123929

View in Genome Browser
Species Human (GRCh38)
Location 6:3340132-3340154
Sequence GGATGGCCTGGAGAAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901
Summary {0: 1, 1: 1, 2: 3, 3: 79, 4: 817}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123920_1003123929 2 Left 1003123920 6:3340107-3340129 CCACAAAAGCGGTATTATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG 0: 1
1: 1
2: 3
3: 79
4: 817
1003123917_1003123929 15 Left 1003123917 6:3340094-3340116 CCAGAGAGCGCTCCCACAAAAGC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG 0: 1
1: 1
2: 3
3: 79
4: 817
1003123916_1003123929 16 Left 1003123916 6:3340093-3340115 CCCAGAGAGCGCTCCCACAAAAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG 0: 1
1: 1
2: 3
3: 79
4: 817
1003123915_1003123929 21 Left 1003123915 6:3340088-3340110 CCTAGCCCAGAGAGCGCTCCCAC 0: 1
1: 1
2: 1
3: 19
4: 190
Right 1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG 0: 1
1: 1
2: 3
3: 79
4: 817
1003123919_1003123929 3 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG 0: 1
1: 1
2: 3
3: 79
4: 817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003123929 Original CRISPR GGATGGCCTGGAGAAGGGAA TGG Intronic
900096373 1:941731-941753 GGGGCGCCTGGAGAAGGGAGGGG + Intronic
900342138 1:2194401-2194423 GGAGGGCCTGGGGAAGGTAGAGG + Intronic
900371375 1:2333659-2333681 GAATGGGGTGGAGAAGGGCAGGG - Intronic
900603945 1:3515590-3515612 GGCTGGCATGGAGCAGGGAGTGG + Intronic
901117978 1:6864363-6864385 GACTGGGCTGGAGAAGGCAAGGG - Intronic
901129751 1:6954891-6954913 GGGTGGTCTTGAGAAGGGGAGGG - Intronic
901751482 1:11412612-11412634 GGATGGCCTGGAATAGATAAAGG + Intergenic
902219170 1:14953992-14954014 AGATGGGCTGCAGAAGGGCAAGG + Intronic
902517781 1:16998948-16998970 GGCTGCCCTGGGGAGGGGAAGGG + Intronic
902649753 1:17829412-17829434 GGAGGGCCTGGAGAGGAGATGGG + Intergenic
903172455 1:21562749-21562771 GGGAGTCCTGGAGAAGGGAGAGG - Intronic
903193137 1:21667951-21667973 TGAGGTCATGGAGAAGGGAATGG + Intronic
903342947 1:22665969-22665991 GGACTGCCTGGAAAAGGGACCGG + Intergenic
904492492 1:30869738-30869760 GGAAGGCCTGGGGGAGGGAATGG + Intronic
904625609 1:31800223-31800245 GGGTGGACTGGAGGAGGGAGGGG - Intronic
904702598 1:32366749-32366771 GTATGGCCTGGGGTAGGGGATGG - Intronic
904804744 1:33122890-33122912 GGATGGACTGTGGAGGGGAAAGG - Intergenic
905014232 1:34766210-34766232 GGAGGGCAGGGAGAATGGAAAGG - Intronic
905121189 1:35683177-35683199 AAAAGGCCTGGAGAAGGCAAGGG - Intergenic
905175950 1:36135432-36135454 GGTCCCCCTGGAGAAGGGAAAGG + Intergenic
905269622 1:36778956-36778978 GGTCATCCTGGAGAAGGGAAGGG + Intergenic
905403538 1:37718899-37718921 GGATGGACAGGAGAAGGGGAGGG + Intronic
905435036 1:37950144-37950166 GGATGGGCTGGACTGGGGAATGG + Intergenic
905758149 1:40530144-40530166 GAATGTCCTTGAGAAGAGAAGGG - Intergenic
905942437 1:41874844-41874866 GGACACACTGGAGAAGGGAAAGG - Intronic
906146952 1:43565915-43565937 GGCTGGCCTGGAGCGGGGAGGGG + Intronic
906152825 1:43597947-43597969 GGTGGGCCTGGAGAAGTGGACGG + Exonic
906193590 1:43914791-43914813 GCTGGGCCTGGAGAAGGGACAGG + Intronic
906208298 1:43998553-43998575 GGAGGCCCTGCAGAAGGAAATGG - Intronic
906667005 1:47628911-47628933 AGATGGGCTGGGGAAGGGAGGGG + Intergenic
906709818 1:47920867-47920889 GAATGGCCTGGCAAGGGGAAGGG + Intronic
907602146 1:55782700-55782722 GAATGCCCTGTAGAAGGGAAAGG + Intergenic
907796190 1:57720259-57720281 GGATTGCTTTGAGTAGGGAATGG - Intronic
907888770 1:58618581-58618603 GGAAGCCCTGGAGAAGAGGAAGG + Intergenic
907918119 1:58889167-58889189 GGAAGCACTGGAGAAGGAAAAGG - Intergenic
908795355 1:67825785-67825807 AGTTGGCCTGGTGCAGGGAATGG - Intronic
910047366 1:82933805-82933827 AGATGGCCTGCAGAAGGCATGGG + Intergenic
910427701 1:87132635-87132657 GGGGGACCGGGAGAAGGGAACGG - Intronic
910437131 1:87216725-87216747 GGATGCACAGGAGAAGGGGATGG - Intergenic
912510930 1:110189720-110189742 GGATGGTGTGTAAAAGGGAATGG - Intronic
913195691 1:116454437-116454459 GGAAGGGGTGCAGAAGGGAAGGG + Intergenic
913436122 1:118849602-118849624 GGATGGCCTGAACAATGGTATGG - Intergenic
913957729 1:143320010-143320032 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
913958584 1:143323059-143323081 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
914052039 1:144145374-144145396 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
914052901 1:144148439-144148461 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
914126296 1:144818102-144818124 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
914127158 1:144821167-144821189 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
914812276 1:151037677-151037699 GGGTGGCTGGGAGAAGGGAGGGG + Intronic
914843327 1:151265988-151266010 GAAGGGCCTGGTGAAGGGCAGGG - Exonic
915516440 1:156415552-156415574 GCCTGGCCTGGAGAAGAGACTGG + Intronic
915911697 1:159919489-159919511 GGCTGGAATGGAGAAGGGTATGG - Intronic
916463643 1:165050490-165050512 GGCTGGCCAGGAGGAGGGAATGG + Intergenic
916740869 1:167646000-167646022 AGGTGGCCTTGAGAATGGAAAGG + Intronic
916998366 1:170326897-170326919 TTAAGGCCTGGAGAAGGGAACGG + Intergenic
917136090 1:171789323-171789345 TGATACCCTGGAGCAGGGAAGGG + Intronic
917417756 1:174828482-174828504 GGAGTGCCTGGAGAAGGCAGAGG + Intronic
917447668 1:175120353-175120375 GGATGTCTTGCAGATGGGAAGGG + Intronic
917495960 1:175540397-175540419 GGATGGTGAGGAGAAGGGAAAGG + Intronic
918242351 1:182631747-182631769 GGTTGGCTTGGGTAAGGGAAGGG - Intergenic
920252445 1:204630689-204630711 AGAGGTCCTGGGGAAGGGAATGG - Intronic
920310230 1:205044169-205044191 GAATGGTATGGGGAAGGGAAGGG + Intronic
920929051 1:210369762-210369784 TGATGGCTGGGAGACGGGAAAGG + Intronic
921493438 1:215807130-215807152 TGCTGGCCTGGAAAATGGAAGGG + Intronic
921890012 1:220344395-220344417 GTAAGGCCTGGAGAAGTGTAAGG + Intergenic
922461362 1:225816680-225816702 GGAGGGTCTGGAGAGGGGAAGGG - Intronic
922505516 1:226123375-226123397 GGAGGGCCTGGAGAGGAGAGGGG - Intergenic
922547219 1:226466899-226466921 GGAGGGGTAGGAGAAGGGAATGG + Intergenic
923079619 1:230641407-230641429 TGATGGCCTGTAAAAAGGAATGG - Intergenic
923602056 1:235412123-235412145 GGAAGGGGAGGAGAAGGGAAAGG - Intronic
924435840 1:244041336-244041358 GGAAGGCGGGGAAAAGGGAAGGG - Intergenic
924778338 1:247126609-247126631 CGGGGGTCTGGAGAAGGGAAGGG + Intronic
924783320 1:247171811-247171833 CGGGGGTCTGGAGAAGGGAAGGG - Intronic
924805624 1:247359275-247359297 GGATGCCAGGGTGAAGGGAATGG - Intergenic
1063166991 10:3472260-3472282 GGATGGTCTGAATAAGGAAATGG + Intergenic
1063914322 10:10866269-10866291 GAATGCCCTGGTGTAGGGAAAGG + Intergenic
1064004650 10:11690313-11690335 TGAGTGCCTGGAGAAGGGAATGG - Intergenic
1064218216 10:13417979-13418001 GGATGGCCTCGAAAATGGAGTGG + Intergenic
1064414490 10:15136597-15136619 GGAGGGTCAGGAGAAGGGCAGGG - Intronic
1064753190 10:18553029-18553051 AAATGGAATGGAGAAGGGAATGG - Intronic
1064753212 10:18553153-18553175 GAATGGAATGGAGAATGGAATGG - Intronic
1064753248 10:18553353-18553375 GAATGGAATGGAGAATGGAAGGG + Intronic
1064753259 10:18553416-18553438 GAATGGAATGGAGAATGGAATGG + Intronic
1064753269 10:18553484-18553506 GAATGGAATGGAGAATGGAATGG + Intronic
1064753297 10:18553644-18553666 GAATGGAATGGAGAATGGAATGG + Intronic
1064753333 10:18553939-18553961 GAATGGAATGGAGAATGGAAGGG + Intronic
1064753371 10:18554221-18554243 GAATGGACTGGAGACTGGAAGGG + Intronic
1064753485 10:18555043-18555065 GAATGGAATGGAGAATGGAATGG + Intronic
1064753505 10:18555179-18555201 GAATGGAATGGAGAATGGAATGG + Intronic
1064753526 10:18555346-18555368 GAATGGTATGGAGAATGGAATGG + Intronic
1064753529 10:18555363-18555385 GAATGGAATGGAGAATGGAATGG + Intronic
1064753546 10:18555497-18555519 GGATGGTATGGAGAATGGAATGG + Intronic
1064753572 10:18555671-18555693 TGATGGTATGGAGAATGGAATGG + Intronic
1064753577 10:18555700-18555722 GAATGGAATGGAGAATGGAATGG + Intronic
1064753588 10:18555773-18555795 GAATGGAATGGAGAATGGAATGG + Intronic
1064753607 10:18555895-18555917 GAATGGAATGGAGAATGGAATGG + Intronic
1064753613 10:18555922-18555944 GAATGGAATGGAGAATGGAAGGG + Intronic
1064753644 10:18556146-18556168 GAATGGAATGGAGAATGGAATGG + Intronic
1064753685 10:18556454-18556476 GGATGAAATGGAGAATGGAATGG + Intronic
1064753703 10:18556578-18556600 GGATGGTGTGGAGAATGGAATGG + Intronic
1064753755 10:18556866-18556888 GAATGGAATGGAGAAAGGAAGGG + Intronic
1064753772 10:18556949-18556971 GAATGGAATGGAGAATGGAAGGG + Intronic
1064753822 10:18557352-18557374 GGATGGTATGGAGAATGAAATGG + Intronic
1064753832 10:18557403-18557425 GAATGGAATGGAGAATGGAATGG + Intronic
1064753854 10:18557544-18557566 TGATGGTATGGAGAATGGAATGG + Intronic
1064753859 10:18557577-18557599 GAATGGAATGGAGAATGGAATGG + Intronic
1064753869 10:18557650-18557672 GAATGGAATGGAGAATGGAATGG + Intronic
1064753933 10:18558110-18558132 GAATGGACTGGAGAATGGAATGG + Intronic
1064753938 10:18558155-18558177 GAATGGAATGGAGAATGGAATGG + Intronic
1064753972 10:18558345-18558367 GGATGGAATGGAGAATGGAATGG + Intronic
1064753975 10:18558362-18558384 GAATGGAGTGGAGAATGGAATGG + Intronic
1064753988 10:18558452-18558474 GAATAGAATGGAGAAGGGAATGG + Intronic
1064754009 10:18558612-18558634 GAATGGCGTGGAGAATGGAATGG + Intronic
1064754011 10:18558624-18558646 GAATGGAATGGAGAATGGAATGG + Intronic
1064754055 10:18558923-18558945 GAATGGACTGGACAATGGAATGG + Intronic
1064754075 10:18559054-18559076 GGATGGTATGGAGAATGGAATGG + Intronic
1064754078 10:18559071-18559093 GAATGGAATGGAGAATGGAATGG + Intronic
1064754154 10:18559588-18559610 GAATGGAATGGAGAATGGAATGG + Intronic
1064754159 10:18559617-18559639 GAATGGAATGGAGAATGGAATGG + Intronic
1064754184 10:18559821-18559843 GAATGGAATGGAGAAAGGAATGG + Intronic
1064754226 10:18560074-18560096 GAATGGAATGGAGAATGGAATGG + Intronic
1064754229 10:18560086-18560108 GAATGGAATGGAGAAAGGAAGGG + Intronic
1064754288 10:18560513-18560535 GAATGGAATGGAGAATGGAATGG + Intronic
1064754306 10:18560637-18560659 GAATGGAATGGAGAATGGAATGG + Intronic
1064754311 10:18560668-18560690 GAATGGAATGGAGAATGGAATGG + Intronic
1064754340 10:18560866-18560888 GAATGGAATGGAGAATGGAATGG + Intronic
1064754346 10:18560895-18560917 GGATGGTATGGAGAATGGAATGG + Intronic
1064754373 10:18561075-18561097 GAATGGAATGGAGAATGGAATGG + Intronic
1064754390 10:18561221-18561243 GGATGGAATGGAGAATGGAATGG + Intronic
1064754399 10:18561277-18561299 GGATGGTATGGAAAATGGAATGG + Intronic
1064754402 10:18561294-18561316 GAATGGAATGGAGAATGGAATGG + Intronic
1064754420 10:18561420-18561442 GGATGGTATGGAAAATGGAATGG + Intronic
1064754423 10:18561437-18561459 GAATGGAATGGAGAATGGAATGG + Intronic
1064754440 10:18561583-18561605 GGATGGAATGGAGAATGGAATGG + Intronic
1064754449 10:18561639-18561661 GGATGGTATGGAAAATGGAATGG + Intronic
1064754452 10:18561656-18561678 GAATGGAATGGAGAATGGAATGG + Intronic
1064754475 10:18561860-18561882 GGCTGGAATGGAGAATGGAATGG + Intronic
1064754488 10:18561954-18561976 GAATGGAATGGAGAATGGAATGG + Intronic
1064754520 10:18562175-18562197 GAAGGGACTGGAGAATGGAATGG + Intronic
1064754526 10:18562224-18562246 GAATGGAATGGAGAATGGAATGG + Intronic
1064754550 10:18562407-18562429 GAATGGAATGGAGAATGGAATGG + Intronic
1064754584 10:18562636-18562658 GAATGGAATGGAGAATGGAAGGG + Intronic
1064754594 10:18562699-18562721 GAATGGAATGGAGAATGGAATGG + Intronic
1064754631 10:18562932-18562954 GAATGGAATGGAGAATGGAATGG + Intronic
1064754719 10:18563581-18563603 GAATGGAATGGAGAATGGAATGG - Intronic
1064754736 10:18563720-18563742 GAATGGAATGGAGAATGGAACGG - Intronic
1064754739 10:18563737-18563759 GAATGGTATGGAGAATGGAATGG - Intronic
1064754759 10:18563870-18563892 GAATGGAATGGAGAATGGAATGG - Intronic
1064754887 10:18564770-18564792 GAATGGAATGGAGAATGGAATGG - Intronic
1064754904 10:18564914-18564936 GAATGGAATGGAGAATGGAATGG - Intronic
1064754909 10:18564963-18564985 GAATGGAATGGAGAATGGAATGG - Intronic
1064754956 10:18565312-18565334 GAATGGAATGGAGAATGGAATGG - Intronic
1064754985 10:18565483-18565505 GAATGGAATGGAGAATGGAATGG - Intronic
1064755003 10:18565630-18565652 GGAAGGAATGGAGAATGGAATGG - Intronic
1064755029 10:18565795-18565817 GAATGGAGTGGAGAAAGGAATGG - Intronic
1064755032 10:18565812-18565834 GAATGGAATGGAGAATGGAATGG - Intronic
1064755041 10:18565880-18565902 GAATGGAATGGAGAATGGAATGG - Intronic
1064755053 10:18565943-18565965 GAATGGAATGGAGAATGGAAGGG - Intronic
1064755084 10:18566140-18566162 GAATGGAATGGAGAATGGAATGG - Intronic
1064755087 10:18566157-18566179 GAATGGAATGGAGAATGGAATGG - Intronic
1064755100 10:18566254-18566276 GAATGGAATGGAGAACGGAATGG - Intronic
1064755103 10:18566271-18566293 GAATGGGATGGAGAATGGAATGG - Intronic
1064755118 10:18566371-18566393 GAATGGAATGGAGAATGGAATGG - Intronic
1064755129 10:18566461-18566483 GAATGGAATGGAGAATGGAATGG - Intronic
1064755132 10:18566478-18566500 GAATGGAATGGAGAATGGAATGG - Intronic
1064755142 10:18566544-18566566 GAATGGAATGGAGAATGGAATGG - Intronic
1064755148 10:18566593-18566615 GAAGGGACTGGAGAATGGAATGG - Intronic
1064755183 10:18566826-18566848 GAATGGAATGGAGAATGGAATGG - Intronic
1064755210 10:18567015-18567037 GAATGGAATGGAGAATGGAATGG - Intronic
1064755219 10:18567078-18567100 GGATGGTATGGAAAATGGAATGG - Intronic
1064755227 10:18567134-18567156 GGATGTAATGGAGAATGGAATGG - Intronic
1064755272 10:18567458-18567480 GGATGGTATGGAGAATGGAATGG - Intronic
1064755278 10:18567487-18567509 GAATGGAATGGAGAATGGAATGG - Intronic
1064755284 10:18567526-18567548 GAATGGAATGGAGAACGGAATGG - Intronic
1064755338 10:18567923-18567945 GAATGGAATGGAGAATGGAATGG - Intronic
1064755398 10:18568377-18568399 GAATGGAATGGAGAAAGGAAGGG - Intronic
1064755401 10:18568389-18568411 GAATGGAATGGAGAATGGAATGG - Intronic
1064755463 10:18568807-18568829 GAATGGAATGGAGAACGGAATGG - Intronic
1064755518 10:18569178-18569200 GAATGGAATGGAGAATGGAATGG - Intronic
1064755532 10:18569268-18569290 GGATGGTATGGAGAATGGAATGG - Intronic
1064755584 10:18569579-18569601 GAATGGTGTGGAGAATGGAATGG - Intronic
1064755618 10:18569829-18569851 GGATGGAATGGAGAATGGAATGG - Intronic
1064755625 10:18569863-18569885 GAATGGAATGGAGAATGGAATGG - Intronic
1064755655 10:18570064-18570086 GAATGGAATGGAGAATGGAATGG - Intronic
1064755666 10:18570144-18570166 GAATGGAATGGAGAATGGAATGG - Intronic
1064755703 10:18570407-18570429 GAATGGAATGGAGAATGGAAGGG - Intronic
1064755706 10:18570419-18570441 GAATGGAATGGAGAATGGAATGG - Intronic
1064755709 10:18570436-18570458 GAATGGAATGGAGAATGGAATGG - Intronic
1064755722 10:18570509-18570531 GGATGGAATGGAGAATGGAATGG - Intronic
1064755734 10:18570577-18570599 GAATGGAATGGAGAATGGAATGG - Intronic
1064755740 10:18570611-18570633 GAATGGAATGGAGAATGGAATGG - Intronic
1064755743 10:18570628-18570650 TGATGGTATGGAGAATGGAATGG - Intronic
1064755760 10:18570747-18570769 GAATGGAATGGAGAATGGAATGG - Intronic
1064755767 10:18570781-18570803 GGATGGTATGGAGAATGGAATGG - Intronic
1064755783 10:18570893-18570915 GAATGGAATGGAGAATGGAATGG - Intronic
1064755808 10:18571092-18571114 GAATGGAATGGAGAATGGAATGG - Intronic
1064755832 10:18571267-18571289 GAATGGAATGGAGAAAGGAAGGG - Intronic
1064755902 10:18571689-18571711 GAATGGAATGGAGAATGGAATGG - Intronic
1064755914 10:18571774-18571796 GGATGGTATGGAGAATGGAATGG - Intronic
1064755937 10:18571927-18571949 GAATGGAATGGAGAATGGAATGG - Intronic
1064755973 10:18572163-18572185 GAATGGAATGGAGAATGGAAGGG - Intronic
1064756006 10:18572355-18572377 GAATGGAATGGAGAATGGAATGG - Intronic
1064756064 10:18572705-18572727 GAATGGAATGGAGAAGGGAATGG - Intronic
1064756087 10:18572821-18572843 GAATGGAATGGAGAATGGAATGG - Intronic
1064756105 10:18572933-18572955 GAATGGAATGGAGAAAGGAATGG - Intronic
1064756121 10:18573047-18573069 GAATGGAATGGAGAAGAGAATGG - Intronic
1064756157 10:18573290-18573312 GAATGGAATGGAGAATGGAATGG - Intronic
1064756160 10:18573307-18573329 GAATGGAATGGAGAATGGAATGG - Intronic
1064756171 10:18573370-18573392 GAATGGAATGGAGAATGGAAAGG - Intronic
1064756183 10:18573430-18573452 GAATGGAATGGAGAATGGAATGG - Intronic
1065285742 10:24186031-24186053 GGAAGGGGAGGAGAAGGGAAGGG - Intronic
1065881625 10:30042340-30042362 GGAGGGGCTGGACAAGGGAGAGG - Intronic
1066640963 10:37553682-37553704 GGAAGGTGTGGAGAAGGGAAGGG + Intergenic
1066759079 10:38737517-38737539 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1066759938 10:38740567-38740589 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1066961679 10:42232202-42232224 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1066962548 10:42235253-42235275 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1067050782 10:43018789-43018811 GGATGCCCTGTAGAAGGTTAAGG - Intergenic
1067081963 10:43217138-43217160 CGATGGCCTGCAGAAGACAATGG + Intronic
1067216911 10:44310937-44310959 GGACTGCATGGAGAAGGGGAGGG + Intergenic
1067294681 10:44968513-44968535 AGTTGGCCTGGAGAAGGGGAAGG - Intronic
1067296012 10:44975490-44975512 GAGGGGACTGGAGAAGGGAATGG - Intronic
1067729575 10:48800409-48800431 GGAAGTCATTGAGAAGGGAATGG + Intronic
1067805349 10:49388323-49388345 GGATGCCCTGGGGAATTGAAGGG - Intronic
1068459718 10:57311592-57311614 GGATTTGCTTGAGAAGGGAATGG - Intergenic
1068802005 10:61152068-61152090 GAATTTCCTGGAGAAGGAAATGG - Intergenic
1069766028 10:70861083-70861105 TGAAGGCCTGGAGCAGGAAATGG - Intronic
1069777141 10:70933782-70933804 GGAAGGCATGGAGCAGGGGAGGG + Intergenic
1069852498 10:71419194-71419216 GTATTGCAAGGAGAAGGGAAGGG - Intronic
1070288326 10:75099434-75099456 GCATGGCCTGGGGCCGGGAATGG + Intronic
1070563425 10:77585019-77585041 GGACAGCTTGGAGAAGGGTAGGG - Intronic
1070675789 10:78410395-78410417 TCATGGTCTGGAGAAGGCAAAGG - Intergenic
1070841075 10:79488310-79488332 GGATGAGCTGAAGAAGGAAATGG + Intergenic
1071372151 10:84963105-84963127 GGATGGTCTGGAGAGCAGAATGG - Intergenic
1072362047 10:94669071-94669093 TGATGCCTTAGAGAAGGGAAAGG + Intergenic
1072645720 10:97251742-97251764 GGAAGGGAAGGAGAAGGGAAGGG + Intronic
1073065148 10:100754106-100754128 ACATGGCCTGGAGAGGGGAGAGG + Intronic
1073080595 10:100857867-100857889 GGCTAGACTGGAGAAGGCAATGG - Intergenic
1073532986 10:104249967-104249989 GAATGGCATTGAGATGGGAAAGG - Intronic
1073632329 10:105161387-105161409 GGAAGGCATGGATATGGGAAAGG - Intronic
1073805855 10:107096934-107096956 GGATAGCATGGAGAAGTGAATGG - Intronic
1074105812 10:110388999-110389021 GGGTGACCTGTAGCAGGGAAAGG + Intergenic
1074853120 10:117454543-117454565 GCATGGACTGGGGAAGGGGATGG + Intergenic
1075012650 10:118887811-118887833 GGATGTCCTGGAGGATGGTAGGG - Intergenic
1075086799 10:119419115-119419137 CGGTGGGCTGGAGAAGGGAGAGG - Intronic
1075516011 10:123108829-123108851 GGATGGGGTGGAGAAGTGAGTGG - Intergenic
1075936936 10:126350931-126350953 GGAGAGCCTGGACAGGGGAAGGG - Intronic
1076038254 10:127219818-127219840 GGATGGGCTGAAGACGGGGATGG - Intronic
1076043967 10:127275676-127275698 GGCTGGCCTGGAGAGGAGCAAGG + Intronic
1076150059 10:128154587-128154609 TGATGGCCTGGAGAAGCCATAGG - Intergenic
1076252555 10:128995800-128995822 GGATGGCCTGCAGCAGGCCAGGG - Intergenic
1076677814 10:132156539-132156561 GGATGGGCAGGAGAAGGAAAGGG - Intronic
1077229312 11:1451461-1451483 GGCTGGCCGGGAGAGGGGCATGG + Intronic
1077515945 11:3002337-3002359 GGAAGGCCTGGCCAAGGGGAAGG - Intronic
1077840790 11:5972589-5972611 AGCTGGCTTGGAGAAGGGGATGG - Intergenic
1078245346 11:9569469-9569491 GGAAAGTCTGGAGTAGGGAATGG + Intergenic
1078738688 11:14046146-14046168 GGAGGGCCTGAAGAAGCAAAAGG + Intronic
1079372230 11:19861325-19861347 GGAAAGCCTGGAGGAGGAAACGG + Intronic
1079887163 11:26003242-26003264 GGAGGCTCTGGAAAAGGGAAAGG + Intergenic
1080305572 11:30831189-30831211 GGAAGGACTGGAGAAGGAGATGG + Intronic
1080379283 11:31750877-31750899 CTATAGGCTGGAGAAGGGAAAGG - Intronic
1080512580 11:32989616-32989638 GGATGGCCATGGGAAGGGAAGGG + Intronic
1080697054 11:34611743-34611765 GGTGGGCCTGGAAAAGGGATAGG + Intergenic
1080767471 11:35309957-35309979 GGCTGGCGTGGGGCAGGGAATGG + Intronic
1081605800 11:44526492-44526514 GCAGGGCCTGGAGAAGGGGGTGG - Intergenic
1081668303 11:44929295-44929317 AGATGGCCAGGAGAAGGGCCAGG + Exonic
1082101812 11:48179051-48179073 GGATGGCCTGAAGACCAGAAGGG - Intergenic
1083026844 11:59558342-59558364 GAATGAACTGGAGGAGGGAAAGG + Intergenic
1083278126 11:61608988-61609010 GGGTTGCCTGGAGAAGGACAGGG - Intergenic
1083669655 11:64292695-64292717 GGAGGGCACCGAGAAGGGAAAGG - Exonic
1083890635 11:65594036-65594058 GAATGGCCTAGAGAGGGTAAGGG - Intronic
1083936864 11:65873756-65873778 GGATGGCAAGGGGAAAGGAAGGG - Intergenic
1084149352 11:67280972-67280994 GGATGGCCAGGACATGGGTATGG + Intronic
1084421444 11:69062593-69062615 GGATGGCCTGGGACAGGGACAGG + Intronic
1084934257 11:72578662-72578684 GGATGGCCTGAGGCAGGGAGTGG + Intronic
1084934963 11:72581941-72581963 GGATGGCCTGGAGAGGGCAGAGG + Exonic
1085251743 11:75148451-75148473 GGTTGGCTTGAAGAAGGTAAGGG + Intronic
1085643426 11:78207687-78207709 GCAGGTCCTGGGGAAGGGAAAGG - Intronic
1085667553 11:78428399-78428421 GGGTGGGGTGGAGAAAGGAAGGG + Intergenic
1086453709 11:86941634-86941656 GAATGGGCTAGGGAAGGGAAAGG - Intronic
1087075888 11:94127069-94127091 GGAAGGCCTGGAGGAGGCCAAGG + Intergenic
1088545926 11:110958802-110958824 GGAGGGGATGGAGAAGGAAAGGG + Intergenic
1089148030 11:116344604-116344626 GGATGGGGTGGAGACGGGACTGG + Intergenic
1089184783 11:116607388-116607410 GGAGGGACAGGAGAAGGAAAAGG - Intergenic
1089272047 11:117308062-117308084 GGATGGCTTGGTGACAGGAAGGG + Intronic
1089275264 11:117331016-117331038 AGATTGACTGGAGAAGGTAAAGG - Intronic
1089842035 11:121426872-121426894 TGAAGCCCTGGAGAAGGGACTGG - Intergenic
1090263344 11:125338496-125338518 GGATGGGAAGGAGAAGGAAACGG - Intronic
1090366704 11:126212224-126212246 GGGGGCCCTGGATAAGGGAAGGG - Intronic
1090434254 11:126673672-126673694 GGATGTCCTGGAGCAGGACAGGG + Intronic
1090666504 11:128918235-128918257 AGATTGCCTGGGGAAGGCAAAGG + Exonic
1090716215 11:129433660-129433682 GGAGAGCCTGGAGAAGGTACGGG - Intronic
1090807299 11:130210489-130210511 TGCTGGCCTAGAGAAGGCAACGG - Intergenic
1091007498 11:131966764-131966786 GGATGGCTTTGAGCAGGGTAGGG + Intronic
1091406165 12:210850-210872 GGAGGGCAGGGAGAAGGGAAGGG - Intronic
1091481877 12:841259-841281 GGATGGGTTGGAGAGGAGAATGG - Intronic
1092228765 12:6765813-6765835 GGATGGCCTTGAGGAGGGATGGG - Intronic
1092237726 12:6820523-6820545 GAATGGTCTGGAGGAGGGTAAGG - Exonic
1093077837 12:14775177-14775199 GGGTGGCCTGGAGGTGGGCAGGG + Intronic
1093126174 12:15331017-15331039 GGAAGGCCTGGAGATGTGAATGG + Intronic
1093280284 12:17185892-17185914 TGATGACCTGAAGAAGCGAAAGG + Intergenic
1093348574 12:18069900-18069922 GGAGGCTCTGGAAAAGGGAAAGG + Intergenic
1093807469 12:23452119-23452141 AGATGGATTGGAGAAGGGCAAGG - Intergenic
1094458211 12:30662873-30662895 AGATGGCCTGGGGCAGGGAAGGG - Intronic
1095184685 12:39187459-39187481 GGATGGCTTTGAAATGGGAAAGG - Intergenic
1095531366 12:43190300-43190322 GGAAGCCTTGGAAAAGGGAAGGG + Intergenic
1095850485 12:46798430-46798452 GGATGGAGTGGAGGAGGGAGGGG - Intronic
1095970666 12:47899965-47899987 GGATAGCCAGGAGAGGGAAAAGG + Intronic
1096256266 12:50063978-50064000 GGAGGGGCTGCTGAAGGGAAAGG + Intronic
1096407105 12:51351947-51351969 GTACGACCTGGAGTAGGGAAGGG - Exonic
1096472773 12:51889545-51889567 GGAAGGCTTGGAGGAGGGACTGG - Intronic
1097011711 12:55957843-55957865 GGATGGACTGGAAAGGAGAAAGG - Intronic
1097106428 12:56628957-56628979 AGATGTTCTGGAGAAGGGATTGG + Intronic
1097683051 12:62667406-62667428 GGCTGGGCAGGAAAAGGGAAGGG - Intronic
1098905672 12:76159783-76159805 GGAGGGACAGGAGACGGGAAAGG - Intergenic
1099905761 12:88768040-88768062 GGATGGCCTCCTAAAGGGAATGG + Intergenic
1101716278 12:107315794-107315816 GGATGGTTTGGAGAAGGTAGGGG + Intergenic
1102215477 12:111158552-111158574 GCCTGGGCTGGGGAAGGGAATGG + Intronic
1102460647 12:113097627-113097649 AGAAGGCCTGGAGATGGGAAGGG - Exonic
1102888628 12:116540771-116540793 GGTTGTCGGGGAGAAGGGAATGG - Intergenic
1103212369 12:119176234-119176256 GGATGGCCTGGGAAGGGAAAAGG + Intergenic
1103383849 12:120516147-120516169 GTATGGACAGGAGAATGGAATGG + Intronic
1103985088 12:124761600-124761622 GGATGGTCTCTGGAAGGGAAGGG + Intergenic
1104038063 12:125112226-125112248 TGAGTGCCTGGGGAAGGGAAGGG + Intronic
1104258902 12:127165095-127165117 GGATGGCCTGTATAAAGGGATGG - Intergenic
1104415376 12:128593412-128593434 GGCTTGCCTGGAGAGTGGAAAGG - Intronic
1104471712 12:129034740-129034762 GGTTAGCCTGGAGAAGGGTGGGG + Intergenic
1104651816 12:130540221-130540243 GGATGGCCTTGGGAAGAGGATGG + Intronic
1105472444 13:20705024-20705046 GGACAGCCTGCAGAAGGGGAAGG + Intronic
1106365375 13:29074067-29074089 AGATGGGCTGGAGAGGGGCAAGG - Intronic
1107448933 13:40491458-40491480 GAATGGCCTGTAGAAGGGGAAGG - Intergenic
1107728717 13:43326744-43326766 GTATGACCGGGAGAAGGGCAAGG + Intronic
1108259716 13:48644439-48644461 GCAGGGCGTGGAGGAGGGAATGG - Intergenic
1109030522 13:57182912-57182934 GGATGGCTTGGATAATTGAAAGG + Intergenic
1111501079 13:89120639-89120661 GGATATCCTGGAAAAGGGAGAGG - Intergenic
1112119266 13:96392087-96392109 AAAGGGCATGGAGAAGGGAAGGG - Intronic
1113638398 13:111938118-111938140 CGAGGGCCTGGAGGTGGGAAGGG + Intergenic
1114400888 14:22409388-22409410 TGATGGCCTAGAGATGGGGAGGG + Intergenic
1114565998 14:23633219-23633241 GGAGGCCCTTCAGAAGGGAACGG - Intronic
1114696776 14:24633159-24633181 GGATAGCCTGGAGTTGGGAGTGG + Intronic
1114897767 14:27012982-27013004 GGAAAGGCTGGACAAGGGAAAGG + Intergenic
1115472501 14:33783023-33783045 GGAGGGCCTGCAGACTGGAAGGG - Intronic
1115803446 14:37023013-37023035 TGACGGCCTGCAGAAGGCAATGG - Intronic
1118462435 14:65999229-65999251 GGATAGACAGGTGAAGGGAAAGG + Intronic
1118843361 14:69528454-69528476 GGATGGGCGGGGGAGGGGAAGGG + Exonic
1119220132 14:72899885-72899907 GGATGACCTGGAGGAGGAAAGGG + Intergenic
1119680230 14:76586548-76586570 GCAAGGCCTGGAGATGGGAAGGG + Intergenic
1119769286 14:77210449-77210471 GGATGGTATGGGGCAGGGAAGGG + Intronic
1120045364 14:79799667-79799689 GGGTGGGCTGGAGAAGGAGAAGG - Intronic
1121251818 14:92505341-92505363 GGATGGCTGGGATGAGGGAATGG + Intergenic
1122036073 14:98950306-98950328 GGAAAGACAGGAGAAGGGAAGGG + Intergenic
1122676764 14:103421754-103421776 GAATGGCCAAGAGAAGGGAAGGG - Intronic
1122966887 14:105135046-105135068 GGGCTGCCGGGAGAAGGGAATGG + Intergenic
1123050014 14:105536794-105536816 GAATGGCGTGGAGTAGGGACGGG + Intergenic
1123067811 14:105627142-105627164 GGATGGCCTGGCTGAGGGCAGGG - Intergenic
1123071830 14:105645867-105645889 GGATGGCCTGGCTGAGGGCAGGG - Intergenic
1123091494 14:105744143-105744165 GGATGGCCTGGCTGAGGGCAGGG - Intergenic
1123097262 14:105772484-105772506 GGATGGCCTGGCTGAGGGCAGGG - Intergenic
1202929823 14_KI270725v1_random:27121-27143 GCAAGGCCTGGATAAGGGCAGGG - Intergenic
1202930656 14_KI270725v1_random:30080-30102 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1123421701 15:20141337-20141359 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1123422481 15:20144112-20144134 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1123443354 15:20305177-20305199 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1123530927 15:21147877-21147899 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1123531709 15:21150652-21150674 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1124103451 15:26716706-26716728 GGATGGCCTGTGAAAGAGAAAGG - Intronic
1124612372 15:31216752-31216774 GGATGCCCAGGAGCAGGGAAAGG - Intergenic
1124811534 15:32944099-32944121 GGAGTGCCTGGGGAAGGGGAAGG + Intronic
1124900810 15:33820731-33820753 GGATTTCATGGAGCAGGGAAGGG - Intronic
1125697584 15:41651903-41651925 GGAAGGAGTGGAGAAGGGAAAGG - Intronic
1125898132 15:43319802-43319824 GGATGGCTTGGAAATGGGATAGG + Intergenic
1126475508 15:49061810-49061832 GGATGGACTGGAGAAGAGGCTGG - Intergenic
1126499939 15:49334629-49334651 GGGTGGGCAGGAGACGGGAATGG + Intronic
1126507778 15:49427834-49427856 GGAGGGCATGGAGAAAGAAAAGG + Intronic
1127070226 15:55281712-55281734 GGAAGGAAGGGAGAAGGGAAGGG + Intronic
1127340366 15:58036888-58036910 GTATGACCTGGAGTAGGGAATGG + Intronic
1127363435 15:58264978-58265000 GGAGGCCCTGGGGAAGGGAGTGG + Intronic
1129977781 15:79836835-79836857 GGATGGCCTGGAGGATGGCCTGG + Intronic
1130299945 15:82672870-82672892 GGACGGCCTCTAGAAGGCAAGGG + Intronic
1130745863 15:86653317-86653339 GGGTGGCAGGGAGAAGGGAAAGG - Intronic
1130785249 15:87088472-87088494 GGATGGCCTAAAGAAGGGATTGG - Intergenic
1130936798 15:88477765-88477787 GGGTGGCGTAGAGAAGGGAACGG - Intronic
1131151550 15:90050400-90050422 GCATGGGACGGAGAAGGGAAGGG - Intronic
1132219463 15:100094371-100094393 GGAGTGGATGGAGAAGGGAAAGG + Intronic
1132318556 15:100908642-100908664 GGGTGGGCTGGAGAGAGGAAGGG - Intronic
1133033260 16:3021508-3021530 GGCTGGCCTGGAGAGGGGCGAGG + Intronic
1133113562 16:3563793-3563815 GGAGGGGCAGGAGAAGGGCAAGG - Exonic
1133160743 16:3909994-3910016 GGAAGGCCTGGAGCTGGGAGAGG - Intergenic
1133362607 16:5186397-5186419 GGGTGCCCTGGAGCAGGGAGTGG + Intergenic
1133431623 16:5742186-5742208 GGAAGGACTGGAGGAAGGAAGGG - Intergenic
1133822134 16:9246259-9246281 GGATGGCCTAAACAAGAGAATGG - Intergenic
1134673312 16:16071879-16071901 GCAGAGCCTGCAGAAGGGAAGGG + Intronic
1135203395 16:20460276-20460298 GGCTGACATGGAGAAGGTAATGG + Exonic
1135215608 16:20564662-20564684 GGCTGACATGGAGAAGGTAATGG - Exonic
1135568175 16:23528070-23528092 CGAAGGGCTGGAAAAGGGAAGGG + Intronic
1135624477 16:23982271-23982293 GGAAGGGAAGGAGAAGGGAAAGG - Intronic
1135995836 16:27247546-27247568 GGATGGCATAGAGGAGGGATAGG - Intronic
1136173532 16:28502609-28502631 GCATGGGATGGAGAAGGGATGGG - Intronic
1136248585 16:28989308-28989330 TGGTGGCCTGGACAAGGGCAAGG - Intronic
1136381335 16:29897256-29897278 GGCTGGGGTGGGGAAGGGAAAGG - Intronic
1136718687 16:32303306-32303328 GCAGGGCCTGGATAAGGGTAGGG + Intergenic
1136722865 16:32338710-32338732 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1136723715 16:32341670-32341692 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1136773226 16:32858653-32858675 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1136837058 16:33509570-33509592 GCAGGGCCTGGATAAGGGTAGGG + Intergenic
1136841186 16:33544709-33544731 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1136842046 16:33547714-33547736 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1136862270 16:33711237-33711259 GCAGGGCCTGGATAAGGGTAGGG - Intergenic
1136897389 16:34002866-34002888 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1137272135 16:46908770-46908792 AGAGGTCCTGGAGGAGGGAAGGG + Intronic
1137436117 16:48455525-48455547 CGATGGGCTGGAGGAGGGGATGG + Intergenic
1137558341 16:49487445-49487467 GGTTACCTTGGAGAAGGGAAGGG - Intergenic
1137660777 16:50204172-50204194 CAATGGCCTGGAAAAGGGAGAGG + Intronic
1137822755 16:51461540-51461562 GGATGTCATGGAAAAGGCAATGG + Intergenic
1138193756 16:55036928-55036950 GGATTGAATGGAGGAGGGAAGGG - Intergenic
1138226774 16:55302725-55302747 GGATGGCAGGGAGGAGAGAAAGG - Intergenic
1138308795 16:56005422-56005444 GGATGGAATAGAGAAGGGTAAGG - Intergenic
1138565111 16:57827503-57827525 GGACAGGCAGGAGAAGGGAAGGG - Intronic
1139246822 16:65452614-65452636 GCATGGCCTGGAGTGAGGAATGG - Intergenic
1139286239 16:65817000-65817022 GGAGGTCCTGGAGTAGAGAAAGG + Intergenic
1139487309 16:67265133-67265155 GGATGGGAGGGAGGAGGGAAAGG + Intronic
1139558025 16:67724960-67724982 GGCTGCCCTGGAGGAGGAAAGGG - Exonic
1140214342 16:72995315-72995337 GGGTGCCCTGGAGGACGGAACGG + Intronic
1140386441 16:74544013-74544035 AAATGGCTTGGAGAAGTGAAAGG + Intronic
1140641926 16:76984886-76984908 TGCTGCTCTGGAGAAGGGAAGGG + Intergenic
1140849970 16:78925967-78925989 AGAGGGCAGGGAGAAGGGAAGGG + Intronic
1141210433 16:81974164-81974186 GGGTGGTGTGGGGAAGGGAAAGG + Intergenic
1141423444 16:83931423-83931445 GGAGGGCCTGGAGCAGGGAGGGG + Intronic
1141575029 16:84958312-84958334 GGATGGAAAGGAGAAGGGGAGGG + Intergenic
1141855392 16:86677726-86677748 GGATGGCGGGGAGAGGGGAGGGG - Intergenic
1141945403 16:87305741-87305763 GGATGGCCTGGAGGAGGGTCAGG + Exonic
1142401056 16:89858966-89858988 GGAAGGCCTGGGGAAGGGCTTGG + Intronic
1203002716 16_KI270728v1_random:176095-176117 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1203003566 16_KI270728v1_random:179054-179076 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1203007744 16_KI270728v1_random:214465-214487 GCAGGGCCTGGATAAGGGTAGGG - Intergenic
1203075648 16_KI270728v1_random:1120763-1120785 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1203123763 16_KI270728v1_random:1559420-1559442 GCAGGGCCTGGATAAGGGTAGGG - Intergenic
1203134322 16_KI270728v1_random:1712501-1712523 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1203135174 16_KI270728v1_random:1715461-1715483 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1203147235 16_KI270728v1_random:1809849-1809871 GCAGGGCCTGGATAAGGGTAGGG + Intergenic
1203151351 16_KI270728v1_random:1845006-1845028 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1203152211 16_KI270728v1_random:1848011-1848033 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1142688427 17:1591121-1591143 GGAAGGCCTGGGGGAGGGAAAGG - Intronic
1142752926 17:1998972-1998994 GGATGGCATCGTGCAGGGAAGGG - Intronic
1143019832 17:3911599-3911621 GGAGGGCCTGGAGCAGGCAGGGG - Intronic
1143378342 17:6480338-6480360 GGAAGGCCCAGGGAAGGGAAGGG + Intronic
1143582023 17:7833278-7833300 GGATGGGCTGGAGCAGAGAATGG - Intronic
1143686763 17:8523633-8523655 GAATGGCCTGGGGAAGGGGGAGG + Intronic
1143964550 17:10747722-10747744 GGAGGAACTGGAGAAGGGAAAGG - Intergenic
1144236292 17:13263387-13263409 GGAGGCCTTGAAGAAGGGAATGG + Intergenic
1144632634 17:16881875-16881897 GGATGGCCTGGAGGACAGAGGGG - Intergenic
1144636248 17:16911101-16911123 GTATGTCCAGGAAAAGGGAAGGG + Intergenic
1144649514 17:16998304-16998326 GGGTGGCATGGGGATGGGAATGG + Intergenic
1144702172 17:17347078-17347100 GGCAGGGCTGGGGAAGGGAAGGG - Exonic
1145035479 17:19537579-19537601 GGACGGATTGGAGGAGGGAACGG - Intronic
1147327290 17:39675535-39675557 GAATGGCCTGGAGGTGGGGAGGG + Intronic
1147387095 17:40089145-40089167 CGAAGGCCTGGAGATGGGGAGGG - Intronic
1147561059 17:41509516-41509538 GGTTGGCCTGAGAAAGGGAAAGG - Intergenic
1148152937 17:45406923-45406945 AGATGGGCTGGAGAATGGAGGGG + Intronic
1148760950 17:49999717-49999739 GAATGGCAGGGAGAAGGGAAGGG + Intergenic
1149304532 17:55335260-55335282 GGATGGGCTGGAGACAGGGAGGG - Intergenic
1149315150 17:55431896-55431918 GGAAGGGCAGGAGAGGGGAAGGG + Intergenic
1149381675 17:56100692-56100714 GCTTGGCTTGGAGAAGGGAAGGG - Intergenic
1149570303 17:57667566-57667588 GGAGGGCCCCGGGAAGGGAAAGG - Intronic
1149686596 17:58539086-58539108 GGATGGCATGGAGATGGGCCAGG - Intronic
1150270225 17:63859413-63859435 GGTTACCCTGGAGAAGGGCAAGG - Intergenic
1150733522 17:67716234-67716256 GGATGGCATGAAGGAGGGGAGGG - Intergenic
1151149873 17:72076020-72076042 GGATGGTGTGGGGAGGGGAAAGG - Intergenic
1151163242 17:72183447-72183469 GATTGGCCAGGAGAAGGGATGGG + Intergenic
1151393447 17:73803407-73803429 GAGTAGCCTGGAGGAGGGAAAGG - Intergenic
1151794480 17:76334212-76334234 TGATGACGTGGGGAAGGGAAGGG - Intronic
1152006774 17:77687280-77687302 GGATGCCCTGCAGATTGGAAAGG + Intergenic
1152061329 17:78077958-78077980 GGATGTCCTAGGGATGGGAAAGG - Intronic
1152474978 17:80512147-80512169 GGAGGGTCTTGAGAAGGAAAGGG + Intergenic
1152884780 17:82843348-82843370 GGACGGCGAGGGGAAGGGAAGGG - Intronic
1152884819 17:82843480-82843502 GGATGGTGAGGGGAAGGGAAGGG - Intronic
1152884828 17:82843513-82843535 GGATGGTGAGGGGAAGGGAAGGG - Intronic
1152884859 17:82843612-82843634 GGATGGGGAGGGGAAGGGAAGGG - Intronic
1153647160 18:7205763-7205785 GGAGGGACTGGAGAAGGTTATGG - Intergenic
1154133452 18:11755747-11755769 GGATGGCTTGGAGAGGGCAAGGG + Intronic
1155087395 18:22471663-22471685 GCAGGGCCAGGAGAGGGGAAAGG - Intergenic
1155188850 18:23411389-23411411 GGAAGGCAGAGAGAAGGGAATGG + Intronic
1155246925 18:23919672-23919694 AGAAGGCCTGGAGGTGGGAAGGG + Intronic
1156636136 18:39031839-39031861 GGATGGCCAAGAAAAGGGCAGGG + Intergenic
1157160940 18:45313869-45313891 GGATGGCATAGTGAAGGTAAGGG - Intronic
1157531414 18:48424005-48424027 GTGTGCCCTGGAGGAGGGAAAGG + Intergenic
1157627160 18:49060609-49060631 GGGTGGCTTAGAGAAGGGAGGGG + Intronic
1157689880 18:49672782-49672804 GGAAGGCTTGGAGAGGGGACAGG + Intergenic
1157800848 18:50619835-50619857 GAAAGGACTGCAGAAGGGAAAGG - Intronic
1158419437 18:57279828-57279850 TGTTGGCCTGGAGAAGGAAATGG - Intergenic
1160074522 18:75659893-75659915 GGATGGAATGGGGATGGGAAGGG - Intergenic
1160709979 19:547036-547058 GGAGGTCCTGGAGAGGGGATTGG + Intronic
1160770476 19:828689-828711 GGGAGGCCCAGAGAAGGGAAGGG + Intronic
1160770509 19:828791-828813 GGGAGGCCCAGAGAAGGGAAGGG + Intronic
1160865580 19:1254478-1254500 GGTGAGCCTGGGGAAGGGAAGGG + Exonic
1160918022 19:1506922-1506944 GGAGGACCTGGAGCAGGGGAGGG + Exonic
1161217182 19:3100374-3100396 CGATGGCGACGAGAAGGGAAGGG - Intronic
1161288392 19:3480160-3480182 AGAAGGGCTGGAGAGGGGAAAGG + Intronic
1161355076 19:3814524-3814546 GGGAGGCCCTGAGAAGGGAAGGG - Intronic
1161632357 19:5364659-5364681 GGAAGGAGTGGAGAAGAGAAGGG - Intergenic
1161841866 19:6686718-6686740 GGTTGGCCTGGAGGGGTGAAGGG - Intronic
1161854331 19:6754725-6754747 CTGTGGCCTGCAGAAGGGAATGG + Exonic
1162345317 19:10115123-10115145 GGACGGCCTGGGGTAGGGGAGGG + Exonic
1163268358 19:16234565-16234587 AGATGGCCTGGGGAAGGCAGGGG - Exonic
1163327752 19:16616054-16616076 GCATGGACTGGAGAGAGGAAGGG + Intronic
1163492979 19:17627825-17627847 GGCAGGGCTGGAGAAGGGATGGG - Intronic
1163739045 19:18999523-18999545 GTGTGGCCTGGATAAGGGCACGG - Intronic
1163779796 19:19240203-19240225 GTAAGAGCTGGAGAAGGGAAGGG - Intronic
1164323131 19:24168351-24168373 GGAGGCTCTGGAAAAGGGAAAGG - Intergenic
1164616411 19:29669248-29669270 GGATGGCATGGAGGAAGGGAAGG - Intronic
1164827641 19:31296229-31296251 GAATGGCATGGAGAGAGGAAGGG + Intronic
1165125353 19:33592007-33592029 GGATGACGTGGAGGAGGGAACGG - Intergenic
1166584901 19:43937158-43937180 AAATGGCCTGGAAAAAGGAAAGG - Intergenic
1166941471 19:46368940-46368962 TGATAGCTTGCAGAAGGGAAGGG - Intronic
1167003045 19:46757018-46757040 GGATGTCGCGGAGAGGGGAAGGG + Exonic
1167197476 19:48040562-48040584 GGATGGCCGGGGTTAGGGAAGGG - Intronic
1167201367 19:48067724-48067746 GAATGGGCTGGAGTAGGGGAAGG - Intronic
1167476212 19:49702749-49702771 GGAGGGTTTGGAGCAGGGAAGGG + Intronic
1167618739 19:50549861-50549883 GGAGGGGATGGGGAAGGGAAGGG + Intronic
1168044982 19:53788088-53788110 GGAAAACCTGGGGAAGGGAAGGG + Intergenic
1168114095 19:54211353-54211375 GGATGGACTGGAGTAGGGATGGG + Intronic
1202691438 1_KI270712v1_random:97798-97820 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1202692298 1_KI270712v1_random:100863-100885 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
925050534 2:811336-811358 GGTTGAACTGGGGAAGGGAAAGG + Intergenic
925385933 2:3461736-3461758 GAGGGGGCTGGAGAAGGGAAGGG - Intronic
926133276 2:10318887-10318909 GGCTGGCATGGAGAAGGCACGGG - Intronic
926148014 2:10408596-10408618 GGAGGGGCTGCAGAAGGAAAAGG - Intronic
926458949 2:13103689-13103711 GGATGGGGTGGGGAAGGGCAGGG - Intergenic
928159227 2:28906841-28906863 GGAAGGCCTGGAGGAGGAGAAGG + Intronic
928901461 2:36322765-36322787 GGTTGGACTGGAGAAGTTAAGGG + Intergenic
929543993 2:42843839-42843861 GGATGGGCTGGGGAATGTAATGG + Intergenic
929555443 2:42922849-42922871 GAAGGGGCTGGAGAAGGGATGGG - Intergenic
930032299 2:47065933-47065955 GGAGGGGCTGGGGAAGGGGAGGG - Exonic
930056591 2:47257050-47257072 GGACGGCCTCCAGAATGGAATGG + Intergenic
930563806 2:52994702-52994724 GGAAGGGTAGGAGAAGGGAAAGG + Intergenic
931456533 2:62413919-62413941 GGCTGGCCTGGAACAGGGACTGG - Intergenic
931998163 2:67858732-67858754 GGATGACTTGGAGCAGGGAGAGG - Intergenic
932486655 2:72088037-72088059 GGATGGGCTGGAGAGGGGAAAGG - Intergenic
933954100 2:87353109-87353131 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
933954953 2:87356152-87356174 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
934239142 2:90252366-90252388 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
934274041 2:91564332-91564354 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
934274894 2:91567381-91567403 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
934322414 2:91981866-91981888 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
934323261 2:91984907-91984929 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
934460720 2:94212689-94212711 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
934461581 2:94215720-94215742 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
934759167 2:96844052-96844074 GGAGCGCCTGGAGACGGGCAGGG + Intronic
935160717 2:100527323-100527345 GGATGACTTGTGGAAGGGAATGG - Intergenic
935173094 2:100625974-100625996 GGAGGGCTTGGAGCAGGGCAGGG + Intergenic
935196254 2:100818844-100818866 GGAAGCCCGGGAGAGGGGAAAGG - Intergenic
935287804 2:101580709-101580731 GCATGTCCTAGAGCAGGGAATGG - Intergenic
936079582 2:109423199-109423221 GGTTGGCCTGCAACAGGGAAAGG + Intronic
936866287 2:117078860-117078882 GGACAGCCAGGAGATGGGAAGGG - Intergenic
937119955 2:119434134-119434156 GGTAGGGCTGGAGAAGGGACAGG + Intronic
937467371 2:122146201-122146223 GGGTGGCATGAAGAAGGGTATGG - Intergenic
937879138 2:126851988-126852010 GGATGGACTGGTGGTGGGAATGG - Intergenic
937985030 2:127634580-127634602 TGATGACCTGGGGAAGGGGAAGG - Exonic
938399441 2:130976679-130976701 GGATGTGGTGGAGAAGGAAAAGG + Intronic
938594451 2:132773150-132773172 GGGTGGCCTGGAGGAGCTAAAGG + Intronic
938655816 2:133432437-133432459 GGGTGGCATGGAGGAAGGAAGGG - Intronic
938943783 2:136192234-136192256 AGATGGGCTGGAGCAGGGCAGGG - Intergenic
939552764 2:143636115-143636137 GAATGGGCTGGAAATGGGAAAGG - Intronic
941394446 2:164956749-164956771 TGAAGGCCTGGGGAAAGGAATGG - Intergenic
942515000 2:176742543-176742565 GGCTGGTGTGGAGAAGGTAATGG + Intergenic
942624372 2:177883820-177883842 GGAGGGAGGGGAGAAGGGAAGGG + Intronic
942816510 2:180059567-180059589 GGAGGCTCTGGAAAAGGGAAAGG + Intergenic
942953903 2:181751737-181751759 GGAAGGGAAGGAGAAGGGAATGG + Intergenic
943047038 2:182871725-182871747 GGTTTGCGTGGAGATGGGAAAGG - Intergenic
943062466 2:183052927-183052949 GGATGGAGTGCAGAAGGGTAAGG + Intergenic
944039329 2:195336421-195336443 GGAGGCTCTGGAAAAGGGAAAGG - Intergenic
944324164 2:198383938-198383960 GAATGGCATGGAGCAAGGAATGG - Intronic
944478679 2:200132649-200132671 GGGTTCCCAGGAGAAGGGAAGGG - Intergenic
946299229 2:218812436-218812458 AGAGGGGCTGGGGAAGGGAATGG + Intronic
946307553 2:218864924-218864946 GGGAGGCCTGGAGGGGGGAATGG - Intronic
946450024 2:219771832-219771854 GGATAGACTGAAGAAGGGAATGG - Intergenic
946490324 2:220143270-220143292 GGATAGACTGCAGAAGGGCAAGG - Intergenic
946762355 2:223007158-223007180 GGATGGCATGAACAAAGGAAGGG + Intergenic
947436169 2:230074301-230074323 GGATGACAGGGAGAAGGGATGGG + Intergenic
947542424 2:230988173-230988195 AGCTGCCCTGGAGAAAGGAAAGG + Intergenic
947590179 2:231380943-231380965 GGATGGAGTGGAGAAGAGAGTGG - Intergenic
947590204 2:231381067-231381089 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590223 2:231381150-231381172 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590236 2:231381193-231381215 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590256 2:231381277-231381299 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590267 2:231381313-231381335 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590274 2:231381337-231381359 GGATGGGGTGGAGGATGGAATGG - Intergenic
947590298 2:231381421-231381443 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590321 2:231381521-231381543 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
948011169 2:234650165-234650187 GGAAAGCCTGGGAAAGGGAAAGG + Intergenic
1168845986 20:945001-945023 GGCTGGACTGGAGGAGAGAAGGG - Intergenic
1169408333 20:5345076-5345098 TGGTGGCCTAGGGAAGGGAAAGG + Intergenic
1170341690 20:15335876-15335898 GAATGGTGAGGAGAAGGGAACGG - Intronic
1171295734 20:24015176-24015198 GTCTGGGCTGGAAAAGGGAAAGG - Intergenic
1171567575 20:26208965-26208987 GGGAGGCCTGGGGAAGGGAGGGG + Intergenic
1171795063 20:29560165-29560187 GGATGGCGAGGAGAAGGCAGGGG - Intergenic
1172147754 20:32768685-32768707 GGAGGCTCTGGAGATGGGAATGG + Intronic
1172212800 20:33212891-33212913 GGGTAGCCTGGAGAGGGCAAAGG - Intergenic
1172619436 20:36309294-36309316 GGCTGGTGTGGAGAAGGGCAGGG + Intronic
1172672778 20:36645790-36645812 GGATGGCCTGGAGACAGGTGAGG - Intronic
1172840816 20:37901967-37901989 GGGAGGCCTGGGGAAGGGCAAGG + Intergenic
1172906174 20:38371178-38371200 GGATGGGCTTGAGAAGGCACAGG - Intronic
1173551892 20:43938244-43938266 TGATGGCCAGGAGAAGGGCCTGG + Intronic
1173897760 20:46563545-46563567 GGATGGCCTGGGCCAGGAAAAGG + Exonic
1174714270 20:52740226-52740248 GAATGGACTTGAGAAGTGAAGGG - Intergenic
1174771833 20:53307466-53307488 TAATGGCCTGGAGAAGGGGCTGG - Intronic
1174863503 20:54114299-54114321 GAATGGGCTGGAGTAGGGAGTGG + Intergenic
1175898854 20:62352148-62352170 AGCGGGGCTGGAGAAGGGAAAGG - Intronic
1176591849 21:8655731-8655753 GCAAGGCCTGGATAAGGGCAGGG - Intergenic
1176592676 21:8658703-8658725 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1176866830 21:14058665-14058687 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1177937603 21:27368588-27368610 ATAGGGCCTGGAGAAGGAAACGG - Intergenic
1178532229 21:33385401-33385423 GGAGTGCCTGGAGTAGGGACTGG + Intergenic
1179013599 21:37575329-37575351 AGGTGGCCTGGAGAGTGGAAAGG - Intergenic
1179071913 21:38079454-38079476 GGAAGGCCTGGATTAGGGAGTGG + Intronic
1179155952 21:38851510-38851532 GGCTGCCCTGGAGCAGGGATGGG + Intergenic
1179900447 21:44390640-44390662 GCATGGCCAGGAGGAGGGCAGGG + Intronic
1180274690 22:10632832-10632854 GCAAGGCCTGGATAAGGGCAGGG - Intergenic
1180275531 22:10635845-10635867 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1180549168 22:16527776-16527798 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1180550005 22:16530778-16530800 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1181354665 22:22291036-22291058 GTAAGGCCTGAAGATGGGAAGGG - Intergenic
1181355524 22:22294065-22294087 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1181454917 22:23053664-23053686 GTTTGGCCTAGAGAAGTGAATGG + Intergenic
1181695709 22:24591920-24591942 GGAGGAGGTGGAGAAGGGAAGGG + Intronic
1181861598 22:25823394-25823416 GGCTGGCCTGGAGATTGGGAGGG + Intronic
1182194122 22:28496687-28496709 GAATAGACTGGAGAAGGCAAGGG - Intronic
1182355886 22:29722072-29722094 GGATGGTCAGGAGGAGGGGATGG - Intronic
1183078405 22:35441186-35441208 GGAGAGGCTGGAGAAGGGACTGG + Intergenic
1183300865 22:37058561-37058583 GGAAGGGGTGGAGCAGGGAATGG - Intronic
1183371579 22:37435549-37435571 GCAGGGCCTGGAGATGGGAAGGG + Intergenic
1183571558 22:38656851-38656873 GGAGGGCCTGGGGAAGGGGACGG + Intronic
1183663475 22:39234645-39234667 AGATGGCAGGGAGAAAGGAAAGG - Intronic
1184103107 22:42351907-42351929 GGATGCACTGGAGGAGGGGAGGG + Intergenic
1184103855 22:42355959-42355981 GGGTAGCCTGGAGATAGGAAGGG + Intergenic
1184259126 22:43304726-43304748 GCAGAGCCTGGAGATGGGAAGGG - Intronic
1184513722 22:44947487-44947509 GAATGGCCTGGCAGAGGGAAGGG + Intronic
1184648199 22:45907418-45907440 GCGTGGCGTGGAGAGGGGAATGG + Intergenic
1185047028 22:48533665-48533687 GGGTGGCCTCGAGTTGGGAAAGG - Intronic
1185137298 22:49080182-49080204 GGATGGCCTGGGGCTGGGGAAGG - Intergenic
1185287886 22:50010605-50010627 GGGTGGGCTGGAGAGGCGAAGGG + Intronic
949852431 3:8432801-8432823 GGATGGGAGGGAGAAAGGAAGGG + Intergenic
949913511 3:8936802-8936824 GGATGGTGTGGAGAAGGGGATGG - Intronic
950025823 3:9819319-9819341 GGATGGCCTGAAGAACAGATAGG - Intronic
950095456 3:10326894-10326916 TCTGGGCCTGGAGAAGGGAAGGG + Exonic
950158337 3:10740594-10740616 CAAAGGCCTGGAGAAGGGAATGG - Intergenic
950201774 3:11049597-11049619 GGAGGGCCTGGTGCAGGGAAAGG - Intergenic
950202189 3:11052782-11052804 GGGTGGCTGGGAGAAGGGAGTGG - Intergenic
950330825 3:12154907-12154929 GGAAGGGCTGGAAAGGGGAAGGG - Intronic
950941359 3:16896289-16896311 TGATGGCCTGGAGAGGGGGTGGG + Intronic
951665704 3:25121097-25121119 GGAAAGCCTGAAGAAGGGGAAGG + Intergenic
952181271 3:30918810-30918832 GGATGTGGTGGAGAAGGGATAGG + Intergenic
952348424 3:32510491-32510513 TGAGTGCCTGGGGAAGGGAAAGG + Intergenic
952922207 3:38293303-38293325 GGAGGCTCTGGAAAAGGGAAAGG - Intronic
953075993 3:39570785-39570807 GGAAAACCTGGAGAAGTGAAGGG - Intergenic
953531803 3:43746162-43746184 GGATGGTGTGGGGAGGGGAATGG + Intergenic
953610434 3:44443190-44443212 GGCTGGCATGGGGAAGGGACAGG + Exonic
953680678 3:45035944-45035966 GGGGGGCCTGGAGGAGGGCAGGG + Exonic
953917929 3:46932549-46932571 GGGTGGGCTGGATAAGAGAAGGG - Intronic
954654475 3:52185636-52185658 AGATGGCCTGGAGAAGGCCAGGG - Intergenic
954659803 3:52221031-52221053 GCATGGACAGGAGGAGGGAAGGG - Intergenic
954700111 3:52446498-52446520 GGCTGGCCTGGAGGTGGGCAAGG + Intergenic
956265241 3:67389019-67389041 GGATGTCCTGGAGAGAGTAATGG + Intronic
958707403 3:97673264-97673286 GGAAGGCATAGAGATGGGAAAGG + Intronic
959197912 3:103209750-103209772 GGATGGGGTGCAGAAGGGTAGGG - Intergenic
959575668 3:107930400-107930422 GCATGGCCAAGAGAAAGGAATGG - Intergenic
960094719 3:113678025-113678047 GGAAGGGAGGGAGAAGGGAAGGG - Intronic
960436900 3:117637179-117637201 GGATGACCTTGGGAAGAGAAAGG + Intergenic
960691710 3:120352863-120352885 GGAGGCACTGGAGAAGGTAAAGG + Intergenic
961088302 3:124089268-124089290 GGAGGGGATGGAGAAGGGCATGG + Intronic
961382915 3:126507797-126507819 GAATGACCTGGAGAAGAGGATGG + Exonic
961631132 3:128299623-128299645 GGAAGGCCTGGAGGAAGGCATGG + Intronic
962834900 3:139181301-139181323 GGATGGCTTGGTGCTGGGAAGGG + Intronic
962838076 3:139206295-139206317 GGATGGCAGGGAGAGTGGAATGG - Intronic
963045162 3:141096926-141096948 GGATGCCAGGGAGAAGGCAATGG - Intronic
964835110 3:160929713-160929735 GGACTGCCTGGAGCAGTGAAAGG - Intronic
964989785 3:162794894-162794916 GGAAGGCCTGAAGAAAGGGAGGG + Intergenic
965805402 3:172536639-172536661 AGAAGGCCTGGAGAAAGGGAAGG - Intergenic
966212194 3:177464846-177464868 GTAAGTCCTGGAAAAGGGAATGG + Intergenic
966304094 3:178511481-178511503 GGATGGGCTACAGAAGGGCATGG - Intronic
967987470 3:195106454-195106476 TGAGGCCCGGGAGAAGGGAAGGG - Intronic
968090422 3:195895519-195895541 GGACGGGCTGCAGGAGGGAATGG - Exonic
968090749 3:195896865-195896887 GGAGAGGCTGGAGAGGGGAATGG - Intronic
968603340 4:1520640-1520662 GGAGGGGCTGGAGGAGGGAGAGG - Intergenic
969105493 4:4804364-4804386 TGAAGGCCTGGAGAAAGGTAAGG + Intergenic
969443144 4:7228948-7228970 GGACGGCCTGGCCACGGGAATGG - Intronic
969531737 4:7734202-7734224 GGATGGGCTGGGGATGGGACAGG + Intronic
969610105 4:8223011-8223033 GCAGGGGCTGCAGAAGGGAAAGG - Intronic
971418281 4:26453390-26453412 GGAGGAGCTGGAGCAGGGAATGG - Intergenic
973687948 4:53393184-53393206 GGATGGGCTGTAGAATGAAAGGG + Intronic
974520485 4:62975551-62975573 GGAGGCTCTGGAAAAGGGAAAGG + Intergenic
975562785 4:75723354-75723376 GGATGGACTGGAGATTGGACTGG + Intronic
977376130 4:96206429-96206451 GAGTAGCCTGGAGAAGAGAATGG - Intergenic
977589799 4:98813664-98813686 GGATGGCCTGCAGCAGGGTGGGG - Intergenic
977600240 4:98928280-98928302 GGCTGTCATGGAGGAGGGAAGGG - Intronic
981015998 4:139975082-139975104 GGATGGCTCTGAGAAGAGAATGG - Intronic
981686848 4:147464422-147464444 GGGTGGCCGGGAGAGGGCAAAGG - Intergenic
982660643 4:158202161-158202183 TGAAGGCCTGGAGGAGGGAGTGG - Intronic
982974217 4:162032899-162032921 GGATGCCTTTGGGAAGGGAAAGG + Intronic
983271445 4:165567159-165567181 GGAAAGACTGGAGAAGAGAAGGG - Intergenic
983632114 4:169859970-169859992 GGAGGGCCAGGAGAGGGGAGCGG + Intergenic
984123895 4:175781291-175781313 GGATGCCCTGAAGAAATGAAGGG + Intronic
984207996 4:176809873-176809895 GGAAGGCAGGGAGGAGGGAAGGG - Intergenic
986287912 5:6373631-6373653 GGATGGCCGGGAGGAGGAAGAGG + Intronic
986776103 5:11015424-11015446 GGATGGACTGGACAAATGAATGG - Intronic
988129651 5:27086268-27086290 GGCTGTCCTGGAAAATGGAATGG - Intronic
988416990 5:30957902-30957924 GGATGGGCTGGAGAAGCAAAAGG - Intergenic
988457075 5:31395849-31395871 GGAGGCTCTGGAAAAGGGAAAGG - Intergenic
988778329 5:34496981-34497003 AGATGGGCTGGAGCAGGAAAGGG + Intergenic
991013387 5:61907248-61907270 GGAGAGCCTGGAGATGGCAAAGG + Intergenic
991650177 5:68844687-68844709 GTATGGCCTGGCTCAGGGAAGGG - Intergenic
992078802 5:73215669-73215691 GGCTGGGCTGGCTAAGGGAAAGG + Intergenic
993572994 5:89566223-89566245 AAATGGCTTGGAGAATGGAAAGG - Intergenic
994071170 5:95604367-95604389 GGATGGCAGGGAAGAGGGAAAGG - Exonic
994509790 5:100688900-100688922 GGGTGCCCTGGAGCAGGGACCGG + Intergenic
994941017 5:106324364-106324386 GCATGGCCTGAAGACTGGAAGGG - Intergenic
995256406 5:110051646-110051668 AGAAGGCAAGGAGAAGGGAAGGG + Intergenic
995459353 5:112386897-112386919 GGATGGATAGCAGAAGGGAAAGG - Intronic
995523457 5:113031931-113031953 GCCTGGCCTTCAGAAGGGAATGG + Intronic
995845086 5:116484898-116484920 GGATGAACTAGAGAAGGAAATGG + Intronic
997894365 5:137702970-137702992 GGATGGACTGGAGGAGGGAAAGG + Intronic
998137547 5:139682075-139682097 GATTGGCTTGGAGAAGGCAAGGG + Intronic
998139712 5:139693017-139693039 GGAAGAGCAGGAGAAGGGAAGGG - Intergenic
998145402 5:139724987-139725009 GGATGGTATGGAGTAGGGTAGGG + Intergenic
998818847 5:146040412-146040434 GGGTGGCCAGGAGAAGTGCAAGG + Intronic
998899137 5:146833729-146833751 GGATGGGATGGGGAAGGGCAGGG - Intronic
999018152 5:148132199-148132221 TGGTGGCCAGGAGAAGGGAAGGG - Intronic
999115619 5:149160957-149160979 GGCTGGCCGAGAGATGGGAAAGG - Intronic
999275721 5:150328797-150328819 GGATGATCTGGAGCAGGGCAGGG + Intronic
1000479927 5:161760298-161760320 GGAGGGGTTGGAGAAGGGAAGGG + Intergenic
1000959819 5:167586551-167586573 GGACACCCTGGAGAAGGAAAGGG - Intronic
1001540092 5:172531781-172531803 GGATGGCAGGGAGAATGGAGGGG - Intergenic
1001567086 5:172706841-172706863 GAGTGCCCTGGAGAGGGGAAAGG + Intergenic
1002043906 5:176531727-176531749 GGCCGCCGTGGAGAAGGGAAGGG - Intronic
1002136596 5:177111682-177111704 GGAGAACCTGGAGATGGGAAAGG + Intergenic
1002207634 5:177574616-177574638 GGAAGGCAGGGAGAAAGGAAGGG - Intergenic
1002399134 5:178981497-178981519 GGCTGGCCTTGAGAAGGAACTGG - Exonic
1002452291 5:179325845-179325867 GGATGGCCTGTGGGAGGGACAGG + Intronic
1002781840 6:372974-372996 GGATGTGCTGGAGAAAGGACAGG + Intergenic
1002952958 6:1833527-1833549 GGAAGGGGAGGAGAAGGGAAAGG - Intronic
1002968685 6:1992373-1992395 GGTTAGCCTGAAGAAGGGGAGGG - Intronic
1003016528 6:2472497-2472519 GGATGGCCTGGAGATGGGAAGGG - Intergenic
1003123929 6:3340132-3340154 GGATGGCCTGGAGAAGGGAATGG + Intronic
1003662807 6:8078734-8078756 GATTTGCCTGGAGAAGAGAAAGG + Intronic
1003816743 6:9850463-9850485 GTCTGGCCTGGAGAAGGAAAAGG + Intronic
1004135021 6:12957786-12957808 GGATGGAATGGAGAAGGGGAGGG - Intronic
1004154816 6:13158238-13158260 GGAAGGGCTGGAGAAGGGACAGG - Intronic
1004405964 6:15333920-15333942 GGATGTTCTGGAGAATAGAAGGG + Intronic
1005500132 6:26422135-26422157 GGCTGGCCGGGAGAAGTGCAGGG - Intergenic
1005504609 6:26458653-26458675 GGCTGGCCGGGAGAAGTGCAGGG - Exonic
1005704719 6:28440042-28440064 GGAAGGCCTTGATAAGGTAATGG + Intronic
1006669165 6:35718962-35718984 GGAGGGCCTGGAGGAGGGGCAGG + Intronic
1006807894 6:36800336-36800358 GGGAGGCCAGGTGAAGGGAAGGG - Intronic
1007774463 6:44217180-44217202 GGAATGCCTGGAGCTGGGAACGG + Intergenic
1008716612 6:54296253-54296275 GGAAGGCCTTGAGAATGGATGGG - Intergenic
1010176753 6:73036497-73036519 GGTCAGGCTGGAGAAGGGAAGGG - Intronic
1010327176 6:74577856-74577878 GAATGGCCTGGAGGAAGGATGGG + Intergenic
1011547670 6:88499171-88499193 GAAAGACCTGGAGAAGGGGAGGG + Intergenic
1011754506 6:90485096-90485118 GCAGGGCCGGGAGAAGTGAAAGG - Intergenic
1012260001 6:97077204-97077226 GGTTGTCCCGCAGAAGGGAAGGG + Intronic
1013636321 6:112033170-112033192 GGATGGGATAGAGAGGGGAAGGG - Intergenic
1013939444 6:115644399-115644421 GGATGGCCTGGACATGCAAAAGG + Intergenic
1014157863 6:118132954-118132976 GGAAGGCATGGAGATGGGAAAGG + Intronic
1014899374 6:126944320-126944342 ATTGGGCCTGGAGAAGGGAAAGG + Intergenic
1017676154 6:156816335-156816357 GGATGGCTTGGAGAGAGGTAAGG + Intronic
1018292236 6:162303871-162303893 GGAGGGCCAGGAGGAGGCAATGG + Intronic
1018476062 6:164142935-164142957 GGAGGGTCTGGAGGAAGGAAGGG + Intergenic
1018716000 6:166533232-166533254 GGACGGGCTGGAGAAATGAAAGG - Intronic
1018958107 6:168426647-168426669 GGAAGGCCTTGAGAGGAGAAAGG + Intergenic
1018994692 6:168701981-168702003 TGGTGGCTTGGAGCAGGGAAGGG - Intergenic
1019037445 6:169073369-169073391 GGGTGGCCTGGAGCAAGGAATGG + Intergenic
1019104862 6:169659933-169659955 GGATGGGCGGCTGAAGGGAAGGG + Intronic
1019430641 7:997427-997449 GGAGGGTCTGGAGGAGGGAAGGG + Exonic
1019486177 7:1290376-1290398 GGTTGGCAGGGAGAAGGGAGAGG + Intergenic
1019549592 7:1595343-1595365 GGATGGGTGGGAGAAGGGATGGG - Intergenic
1019637480 7:2083814-2083836 GGAGGTCCTGGAGATGGGAACGG - Intronic
1019682720 7:2361013-2361035 GGGCGGCCTGAAGAAGTGAACGG - Intronic
1019807268 7:3137123-3137145 TGATGGCCTGGACTAGGGAGTGG - Intergenic
1020465214 7:8470900-8470922 GAATGGCCTAGACATGGGAATGG + Intronic
1021203155 7:17748821-17748843 AGATGGACTGGAAAAGGTAATGG - Intergenic
1021579792 7:22140699-22140721 GGATAGCCTCAAGAAGTGAATGG - Intronic
1021950516 7:25769585-25769607 GGAAGGGAAGGAGAAGGGAAGGG + Intergenic
1021950525 7:25769611-25769633 GGAAGGGAAGGAGAAGGGAAGGG + Intergenic
1022494529 7:30844579-30844601 CGGGGGCCTGGAGAAGAGAAGGG + Intronic
1023303502 7:38798733-38798755 GGATGGCCGGGAGAACAGCAGGG + Intronic
1023395136 7:39745254-39745276 ATATGGCCTGCAGAAGAGAAGGG + Intergenic
1023750160 7:43364643-43364665 GGATGGCCTGTACAAAGGCACGG + Intronic
1024208746 7:47185972-47185994 GCAAGGCCCTGAGAAGGGAAGGG - Intergenic
1024401422 7:48928415-48928437 GGATGGCCTTAAAAAGGGTAAGG - Intergenic
1024587794 7:50856484-50856506 GCATGGCCTGCAGAAGGAACTGG - Intergenic
1026099012 7:67369249-67369271 GGCTGGCAAGGAGCAGGGAAGGG + Intergenic
1026650135 7:72209467-72209489 GGAAGGAAGGGAGAAGGGAAGGG - Intronic
1026743754 7:72995402-72995424 GGAAGGGAAGGAGAAGGGAAAGG + Intergenic
1026850721 7:73721632-73721654 GGCAGTCCTGGGGAAGGGAAGGG - Intergenic
1027029864 7:74880100-74880122 GGAAGGGAAGGAGAAGGGAAAGG + Intergenic
1027099981 7:75369675-75369697 GGAAGGGAAGGAGAAGGGAAAGG - Intergenic
1027138205 7:75639225-75639247 GGCTGGACCGGAGAAAGGAAGGG + Intronic
1027742767 7:82033059-82033081 GGAAGGCCTGGTGAAGGGGGTGG - Intronic
1028618895 7:92801972-92801994 GGAAGGAAAGGAGAAGGGAAGGG - Intronic
1029188329 7:98755042-98755064 GGAGGGGCGGGAGAGGGGAAAGG - Intergenic
1029365462 7:100113574-100113596 GGGTGGCAGGGAGGAGGGAAAGG - Intronic
1029983032 7:104896702-104896724 GGAGGGGCTGGAGCAGGGAGAGG + Intronic
1030150535 7:106399877-106399899 GGATGGGCTGCAGAGGAGAAAGG + Intergenic
1031530616 7:122871851-122871873 GGCTGAGCTGGAGAAGGAAATGG - Intronic
1032229181 7:130059641-130059663 GGATGCCCTGAGGAAGGGAGTGG - Intergenic
1032423704 7:131803425-131803447 GGTTGGGCTGGAGAGGGGCAAGG - Intergenic
1032790112 7:135236409-135236431 GGATGAGCTGGTAAAGGGAAAGG - Intronic
1033041563 7:137923951-137923973 GGACAGGCTGGAGAAGGGCAAGG - Intronic
1033287001 7:140049844-140049866 GGAAGACCAGGACAAGGGAAAGG - Intronic
1034075239 7:148225259-148225281 GGAGGGCCTGGCCAAGGGGAAGG + Intronic
1034451031 7:151137392-151137414 GGGTGGACTGAAGAAGGGGAAGG + Intronic
1034902810 7:154917962-154917984 GGATGGCCTGGAGAGGTCATGGG + Intergenic
1034938673 7:155216032-155216054 GGAGGACCTGGGGAAGTGAATGG - Intergenic
1035162516 7:156961386-156961408 GAGGGGGCTGGAGAAGGGAATGG + Intronic
1035476825 7:159149731-159149753 GGACGCCCTGGCGAGGGGAAGGG - Intergenic
1035584573 8:761856-761878 GGAGGCCCTGGAGAGGGGATGGG + Intergenic
1035723630 8:1811908-1811930 GGATGCCCTGCAGCAGCGAATGG + Intergenic
1036691170 8:10945777-10945799 CCAGAGCCTGGAGAAGGGAAGGG - Intronic
1037635821 8:20700407-20700429 GGCTGGCGTGGGGAGGGGAAAGG + Intergenic
1037751039 8:21682627-21682649 GCAGGCCCTGGAGAAGGAAACGG - Intergenic
1037787250 8:21910404-21910426 GAAGGGCCTGGAGAGGGGAGAGG - Intronic
1037801120 8:22036586-22036608 GCCTGGTATGGAGAAGGGAACGG + Intronic
1039424835 8:37477320-37477342 GCAGGGGCTGGAGAGGGGAAGGG - Intergenic
1039604784 8:38871481-38871503 GGATGGCGTGGAGAAGGGAGGGG + Intergenic
1039696170 8:39914716-39914738 GGATGGCTATGAGAATGGAAAGG - Intronic
1041431187 8:57782469-57782491 TAAAGGCCTGGAGTAGGGAAGGG + Intergenic
1042068127 8:64901320-64901342 TGATGTCTTGTAGAAGGGAAAGG - Intergenic
1044035590 8:87299280-87299302 GCATGGCCAGGAGAAGGGACAGG - Intronic
1045064737 8:98435241-98435263 GGCTGGCCAGGTGGAGGGAAGGG + Intronic
1045624056 8:104021883-104021905 GGTGGGCATGGAGTAGGGAATGG + Intronic
1045746201 8:105425282-105425304 GAAAGGCCTGCAGAAAGGAAAGG + Intronic
1046110372 8:109715980-109716002 GGATGGGGTGGAGGAGAGAAAGG - Intergenic
1046672509 8:117072072-117072094 GGCTGGGCTGGAGAAGAAAATGG + Intronic
1046746753 8:117884198-117884220 GAATGGCGTGGAGAAAGGAGAGG - Intronic
1046842883 8:118880388-118880410 GGCTGGGCTGGGTAAGGGAATGG - Intergenic
1047170364 8:122486768-122486790 GGAAGGGGTGGAGATGGGAATGG - Intergenic
1047222939 8:122933068-122933090 GGGTGGCCTGGAGGCGGGGATGG + Intronic
1047419191 8:124692607-124692629 GGATGGAGTGGAGGAGGGGAGGG - Intronic
1047443858 8:124902380-124902402 GGAGGCTCTGGAAAAGGGAAAGG - Intergenic
1047885684 8:129247922-129247944 AGATGGCCTGGAAAAGTTAAAGG - Intergenic
1049095739 8:140547164-140547186 GGATGGCCAGGAGATGGAGATGG - Intronic
1049672582 8:143876535-143876557 GGATGGCCTCAGGAAGGGAAGGG - Intronic
1049825869 8:144667392-144667414 GGAGGGCCTGGAGATTGGGAAGG - Intergenic
1050273410 9:3970973-3970995 GGATGGAATGGAGAAAGGGAGGG + Intronic
1050565212 9:6875131-6875153 GGAAGTCCTGGAGAAGAGGAAGG - Intronic
1051499116 9:17758152-17758174 CTGTGGCCTAGAGAAGGGAAAGG - Intronic
1051745369 9:20290429-20290451 GGCTGGCCTGAAGAGGGGCAAGG - Intergenic
1051801156 9:20935862-20935884 GGTTAGCATGGGGAAGGGAAAGG - Intronic
1051889057 9:21924728-21924750 GGATGGCCCTGGGTAGGGAAGGG - Intronic
1052538501 9:29777468-29777490 GGAGGCTCTGGAAAAGGGAAAGG - Intergenic
1053329213 9:37188603-37188625 GGAGGGGCGGGGGAAGGGAAGGG - Intronic
1053691218 9:40588387-40588409 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1054273583 9:63049098-63049120 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1054302478 9:63389358-63389380 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1054401251 9:64715858-64715880 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1054434859 9:65200178-65200200 GCAGGGCCTGGATAAGGGCAGGG - Intergenic
1054495530 9:65821503-65821525 GCAGGGCCTGGATAAGGGCAGGG + Intergenic
1054741122 9:68806666-68806688 AGCAGGCGTGGAGAAGGGAAGGG - Intronic
1055656887 9:78459569-78459591 GGAGGGTTGGGAGAAGGGAAAGG + Intergenic
1056748357 9:89324997-89325019 GGTGGGCTTGGAGCAGGGAAGGG + Intronic
1057426113 9:94951033-94951055 GGAAGGCGTGGGGAAGGGAAAGG + Intronic
1057912316 9:99029402-99029424 GGATTGCTTGGAGAAAGGGAAGG - Intronic
1058770447 9:108226258-108226280 GGAAGGCCTGGACAAAGGCATGG - Intergenic
1059961649 9:119570818-119570840 GGCTGGCCTGGAGATGACAATGG + Intergenic
1060024736 9:120161638-120161660 GGGTGGAAAGGAGAAGGGAAGGG + Intergenic
1060270985 9:122141319-122141341 GGATGGACTGGAGAGGGAGATGG + Intergenic
1060634527 9:125189567-125189589 GGGGGTCCTGGAGAAAGGAAGGG + Exonic
1060758255 9:126227996-126228018 GCAGGGCCTGGAGAAGGACAGGG + Intergenic
1062256785 9:135627437-135627459 GGATTGCAGGGAGAAGGGAATGG - Intronic
1062421864 9:136486494-136486516 GCTTGGCCTGGAGAGAGGAAGGG + Intergenic
1203621890 Un_KI270749v1:134550-134572 GCAAGGCCTGGATAAGGGCAGGG - Intergenic
1203622721 Un_KI270749v1:137509-137531 GTAAGGCCTGAAGATGGGAAGGG + Intergenic
1186447796 X:9646635-9646657 GGATGGCCTGGACAAGGCTCAGG - Intronic
1186508845 X:10115695-10115717 CCATGGCCTGGAGATGGCAACGG + Intronic
1187576210 X:20559119-20559141 GGAAGGAAAGGAGAAGGGAAGGG - Intergenic
1188156421 X:26748434-26748456 GGTGGGCCTGGGGAAGGGACGGG - Intergenic
1188286413 X:28330695-28330717 GGATTGACTGTAGATGGGAATGG - Intergenic
1188905506 X:35786633-35786655 GGAAGGCATAGAAAAGGGAAGGG + Intergenic
1190059715 X:47202927-47202949 AGCAGGCCTGGAGAGGGGAAGGG - Exonic
1190421304 X:50287333-50287355 GGAGGGGCCGGGGAAGGGAAGGG - Intronic
1190552547 X:51599685-51599707 TGATGGACTGGAGAGGGAAAAGG - Intergenic
1190726715 X:53194781-53194803 GGGGGGCCCAGAGAAGGGAAGGG - Intronic
1190731861 X:53231939-53231961 GAATGGCCTCTAAAAGGGAATGG - Intergenic
1190823232 X:53993811-53993833 GGCTGGCCTGGTTAGGGGAATGG + Exonic
1192057785 X:67789877-67789899 GGAAGGCCTGCAGGAGGGGAAGG - Intergenic
1192212509 X:69136931-69136953 GGCTGGCCTGGGGATGGGGAGGG - Intergenic
1192498499 X:71632779-71632801 GAATGGGGTGGAGATGGGAAGGG + Intergenic
1192585264 X:72314054-72314076 GGAGGGGCTGGAGAGGGGAGAGG - Intergenic
1192709614 X:73566245-73566267 GGATGGACTGGAGTAGGGAGAGG - Intronic
1195666091 X:107432685-107432707 GGATGGCCATGAGCAGAGAAAGG + Intergenic
1195668736 X:107451909-107451931 GGAGGGGCAGGAGCAGGGAAGGG - Intergenic
1195740844 X:108063211-108063233 GGTTGGGCTGGAGCAGGGAATGG + Intronic
1196287393 X:113898338-113898360 AAAAGGCCTGGAAAAGGGAAAGG + Intergenic
1196809495 X:119617756-119617778 TGAAGGCCCAGAGAAGGGAAGGG - Exonic
1197188250 X:123613160-123613182 GAATGGAATGGAGAGGGGAAAGG + Intronic
1198425956 X:136520432-136520454 GGAGGGAGTGGAGAAGAGAATGG + Intergenic
1198495403 X:137187183-137187205 GAATGGCCTGGAAATGGCAATGG + Intergenic
1200067616 X:153511596-153511618 CCGTGGCCTGGAGAGGGGAAGGG + Intergenic
1200082923 X:153588218-153588240 AGAAGGGCTGGAGAAGGCAATGG - Exonic
1200141375 X:153904578-153904600 GGAGGCCCTGGGGAAAGGAAGGG + Intronic
1201190681 Y:11439895-11439917 GTAAGGCCTGAAGATGGGAAAGG + Intergenic