ID: 1003123934

View in Genome Browser
Species Human (GRCh38)
Location 6:3340143-3340165
Sequence AGAAGGGAATGGTAAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 944}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123926_1003123934 -5 Left 1003123926 6:3340125-3340147 CCAGGAGGGATGGCCTGGAGAAG 0: 1
1: 0
2: 2
3: 41
4: 321
Right 1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG 0: 1
1: 0
2: 6
3: 75
4: 944
1003123920_1003123934 13 Left 1003123920 6:3340107-3340129 CCACAAAAGCGGTATTATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG 0: 1
1: 0
2: 6
3: 75
4: 944
1003123919_1003123934 14 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG 0: 1
1: 0
2: 6
3: 75
4: 944
1003123916_1003123934 27 Left 1003123916 6:3340093-3340115 CCCAGAGAGCGCTCCCACAAAAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG 0: 1
1: 0
2: 6
3: 75
4: 944
1003123917_1003123934 26 Left 1003123917 6:3340094-3340116 CCAGAGAGCGCTCCCACAAAAGC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG 0: 1
1: 0
2: 6
3: 75
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003123934 Original CRISPR AGAAGGGAATGGTAAGGGCA GGG Intronic
900118539 1:1038872-1038894 AGAAGGGAAGTGAAAGGGCCAGG + Intronic
900259369 1:1716366-1716388 AGAAGAGAAGGGAAATGGCAAGG - Exonic
900291789 1:1926770-1926792 GGAAGGGCATGCTGAGGGCAGGG + Intronic
900478631 1:2887759-2887781 AGAGGGCAATGCCAAGGGCAGGG + Intergenic
900801266 1:4738562-4738584 AGAAGGGAAGAGTAAGGAGAGGG + Intronic
900831516 1:4969144-4969166 GGAAGGGAATGGAAAGGGAGTGG + Intergenic
900863417 1:5249889-5249911 AGAAACGAATGCTAAGGGAATGG + Intergenic
901123269 1:6912002-6912024 AGAAGGGAAGGGAGAGGGAAGGG - Intronic
902164684 1:14560772-14560794 AGAAGGGAAAGGGAAGGCAAAGG + Intergenic
902946048 1:19839973-19839995 GGAAGGGAATGGTGTGGTCACGG - Intergenic
903161623 1:21493104-21493126 AGAAGGGAATGGAAGGGGAAGGG + Intergenic
903836175 1:26204581-26204603 AGTAGGGAAGGGGAAGGGGAAGG - Intergenic
903964329 1:27077042-27077064 AGAAGGGGATGGGAAGGGAGGGG - Intergenic
904168063 1:28571407-28571429 GGATGGGATTGGTAAGGACAGGG + Intronic
904352421 1:29917354-29917376 AGAAAGGAAGGGGAAGGGGAGGG - Intergenic
904449597 1:30602320-30602342 AGAAGGGAGTGGATGGGGCAGGG - Intergenic
904626081 1:31803784-31803806 AGAAAGGAAAGGAAAGGGAAAGG + Intronic
905242789 1:36591808-36591830 AGTGGGGAATAGTAAGAGCATGG + Intergenic
905489778 1:38334310-38334332 AGAAGGATATGGAAAAGGCAAGG - Intergenic
905727928 1:40270550-40270572 GGAAGGGAAAGGCAAGGGAAGGG - Intronic
906387747 1:45386408-45386430 AGAAAGGAAGGGAAAGGGAAAGG + Intronic
906560368 1:46752245-46752267 AGCAGGGATTGGGAAGGGAAGGG + Intergenic
908420928 1:63957570-63957592 GGAAGGGAATGGAAAGCACATGG + Intronic
909506096 1:76391589-76391611 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
909845660 1:80390706-80390728 GGATGGGAAAGGTAGGGGCAAGG + Intergenic
910333117 1:86098321-86098343 AGAAAGGAAAGGAAAGGGGAGGG + Intronic
911290107 1:96046965-96046987 AGCATGGAATGGGGAGGGCATGG + Intergenic
911609805 1:99948333-99948355 AGAAAGGAAAGGAAAGGGAAGGG - Intergenic
912194435 1:107380775-107380797 AGCAGGGGATGGTCAGGGTATGG - Intronic
912320346 1:108706987-108707009 AGAAGGGGGATGTAAGGGCATGG + Intergenic
912917110 1:113826393-113826415 AGAAGGGGAAGGGAAGGGAAGGG + Intronic
913296793 1:117329482-117329504 AGAAGGGAAGGGAAAGGAAAAGG - Intergenic
913532024 1:119740394-119740416 AGAAGGCACTGGTAAGGGCCTGG - Exonic
913957433 1:143318576-143318598 AGAAGGCCATGGTAGGGCCAAGG + Intergenic
914051747 1:144143940-144143962 AGAAGGCCATGGTAGGGCCAAGG + Intergenic
914127450 1:144822601-144822623 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
914243207 1:145866682-145866704 ACTAGGCAATGGTATGGGCAGGG - Exonic
914666461 1:149836960-149836982 TGAAGGGAATGGGAAGGTCGTGG + Intergenic
914669306 1:149856838-149856860 TGAAGGGAATGGGAAGGTCGTGG - Intronic
914939208 1:152007238-152007260 AGAAAGGAAAGGTTAGGGAAGGG - Intergenic
915119449 1:153619559-153619581 TCAGGGGAATGGCAAGGGCATGG + Intronic
915128958 1:153683991-153684013 AGAAGGGAATGGCAGGGCGAGGG + Intronic
915282235 1:154830421-154830443 AGGTGGGACCGGTAAGGGCAGGG - Intronic
915895400 1:159807922-159807944 AGAAGGGGAGGGGAAGGGAAAGG + Intronic
916065145 1:161130757-161130779 GGAAGGGAATGGAAATAGCATGG - Intronic
916292666 1:163183803-163183825 AGAAGGAAATGGTATTGGCTTGG + Intronic
916476123 1:165170630-165170652 AGAAGGAGATGGAAAGGGAAGGG - Intergenic
918243932 1:182642799-182642821 AAGAGGGAATGGTGAGGGCTTGG + Intergenic
918388161 1:184031881-184031903 AAAAGGAAAAGGTAAGGGAAGGG - Intronic
918431671 1:184467270-184467292 AGAAGGGAATGATGAGGAGATGG + Intronic
918451232 1:184661189-184661211 GGAAGGGAATGTCAGGGGCAAGG - Intergenic
918639613 1:186823795-186823817 AGAAGTGGATGGTATGGGTAGGG + Intergenic
918649625 1:186945176-186945198 AGAAGGGAATAGCAAGTGTAAGG + Intronic
918780760 1:188697177-188697199 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
918780770 1:188697216-188697238 AGAAGGGAAGGGGAAGGGGAAGG + Intergenic
919509770 1:198447643-198447665 AGAAGGGAAGGGAAAGGGAAAGG - Intergenic
919757118 1:201073200-201073222 AGATGGGAATGAGCAGGGCAGGG + Intronic
920071946 1:203308423-203308445 AGAAGGGAAGGGGGAGGGGAGGG - Exonic
920330247 1:205202113-205202135 AGAAGGGGAAGGGAAGGGAAGGG + Intronic
920330252 1:205202124-205202146 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
920760892 1:208782831-208782853 AGAAAGGAATGGGTAGGGGAGGG + Intergenic
920887941 1:209951275-209951297 AGAAGGGAATGGAGAGGGGCAGG - Intronic
922236542 1:223726615-223726637 AGAAGGGAAAGGAAAGGCCTGGG + Intronic
922564101 1:226590084-226590106 AGAAGGGGATGGTGGGGGGAAGG - Intronic
922691190 1:227692994-227693016 AGAAGGGTATGGTGAGGGTAGGG - Intergenic
923002656 1:230020461-230020483 GGAAGGCAATGGTCAGGGAAGGG - Intergenic
923210496 1:231799867-231799889 AGGAGGGAAGGGGAAGGGGAAGG - Intronic
923589039 1:235302208-235302230 GGAAGGGAAGGGGAAGGGAAAGG + Intronic
923602051 1:235412112-235412134 AGAAGGGAAAGGGATGGGAAGGG - Intronic
923615520 1:235534047-235534069 GGAAGGGAAAGGAAAGGGAAGGG - Intergenic
924211001 1:241767311-241767333 AGAAGTGGATGGTATGGGGAGGG - Intronic
924574884 1:245270411-245270433 AGAAAGGAAAGGAAAGGGAAAGG - Intronic
1063081424 10:2771055-2771077 AGAAGGGGATGGTACGGCCAGGG + Intergenic
1063207581 10:3849129-3849151 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1063286247 10:4692067-4692089 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1063492803 10:6480483-6480505 TGTTGGCAATGGTAAGGGCATGG + Intronic
1063621013 10:7649165-7649187 AGAAGGGAAGGGGAAGGGGAAGG - Intronic
1063920300 10:10926012-10926034 AGAAGGACATTGTAAGGGAAAGG - Intergenic
1064414418 10:15136249-15136271 GGAAGGGAAGGGAAAGGGAAGGG + Intronic
1064414420 10:15136254-15136276 GGAAGGGAAAGGGAAGGGAAGGG + Intronic
1064529919 10:16297373-16297395 GGAAGGGAAAGGAAAGGGAAGGG + Intergenic
1064538275 10:16380214-16380236 AAAAGGGAACGATAAGGACAAGG - Intergenic
1064753724 10:18556687-18556709 CGAATGGAATGGAAAGGGGAAGG + Intronic
1064755867 10:18571485-18571507 GGAATGGAATGGAAAGGGGAAGG - Intronic
1064822107 10:19348962-19348984 TGAAGGGAAGGGGAAGGGAAGGG - Intronic
1064979478 10:21151720-21151742 GCAAGGGAATAGCAAGGGCACGG - Intronic
1065174295 10:23061953-23061975 AGAAGGGGAGGGAAAGGCCAGGG + Intergenic
1065203059 10:23331647-23331669 AGAAGGGAAGGGGAAAGGAAAGG + Intronic
1065638233 10:27752968-27752990 AGAAGGGCAAGGGAAGGGAAAGG - Intergenic
1066334625 10:34463189-34463211 AGAAGGGGAAGGAAAGGGGAAGG + Intronic
1066697445 10:38091598-38091620 AGAGGGGACAGGGAAGGGCATGG + Intergenic
1066962431 10:42234811-42234833 GCAAGGCAATGGTAGGGGCAGGG + Intergenic
1066977212 10:42380288-42380310 AGAAGAGAAAGGCCAGGGCACGG + Intergenic
1066995095 10:42555871-42555893 AGAAGGGACAGGGAAGGGCATGG - Intergenic
1067286308 10:44909988-44910010 AGAAAGGAAGGGGAAGGGGAAGG + Intergenic
1067424222 10:46191306-46191328 AGAATAGAATGGTTAGGGGAAGG + Intergenic
1067523737 10:47026449-47026471 AGAAGGGAATGGTGAGTGGGAGG - Intergenic
1067816108 10:49477881-49477903 AGCTGGGAATGCTGAGGGCAAGG - Intronic
1068345967 10:55778438-55778460 AGAGTAGAATGGTAAGGGGAAGG - Intergenic
1068905003 10:62312864-62312886 GGAGGGGAATGCTAAGGGCAGGG + Intergenic
1069081797 10:64096361-64096383 AGAAGAGAAGGGTATTGGCATGG + Intergenic
1069182825 10:65384722-65384744 AGAGGGAAAGGATAAGGGCAAGG + Intergenic
1069274004 10:66566976-66566998 AGAAGAGGATGGTAGGGGGAGGG + Intronic
1069646732 10:70005100-70005122 AGAAAGGAAAGGGAAGGGGAGGG + Intergenic
1069666275 10:70162358-70162380 AGAAAGGAAAGGGAAGGGAAAGG + Intronic
1069851581 10:71408805-71408827 AGAGGGGAATGGGAAAGGCCAGG + Intronic
1070331882 10:75423330-75423352 AGAAAGGAAAGGAAAGGGGAAGG - Intergenic
1070900311 10:80022674-80022696 AGACTGGACTGGGAAGGGCATGG + Intergenic
1071055515 10:81504384-81504406 AGAAAGGAATGTTAAGGTCTGGG + Intergenic
1071570512 10:86694238-86694260 AGGAGGGAAGGGGAAGGCCAAGG - Intronic
1072042865 10:91626065-91626087 AGCAGGAGATGGTATGGGCAGGG + Intergenic
1072599386 10:96911018-96911040 AGAATGTAATTGTAAGGGAAAGG + Intronic
1072645481 10:97251160-97251182 GGAAGGGAAGGGGAAGGGAAAGG + Intronic
1072645509 10:97251227-97251249 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072645524 10:97251260-97251282 GGAAGGGAATGGGAAGGGAAGGG + Intronic
1072645540 10:97251305-97251327 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072645568 10:97251377-97251399 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072645573 10:97251388-97251410 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072645614 10:97251493-97251515 GGAAAGGAAGGGTAAGGGGAGGG + Intronic
1072645643 10:97251548-97251570 GGAAGGGAAGGGGAAGGGGAGGG + Intronic
1072645663 10:97251596-97251618 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072645706 10:97251704-97251726 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072645725 10:97251753-97251775 AGAAGGGAAGGGAAGGGGAAGGG + Intronic
1072645727 10:97251758-97251780 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1072839075 10:98750468-98750490 TGAAGGGGATGGGAAGAGCAAGG + Intronic
1073078496 10:100839881-100839903 AGAAAGGAAAGGAAAGGGAAGGG + Intergenic
1073313231 10:102559284-102559306 AGAAGGGAATGGCCAGGAAAAGG + Intronic
1073625367 10:105091142-105091164 GGAAGGGAAGGGAAGGGGCAAGG - Intronic
1074664824 10:115709517-115709539 AAAAGGGAATGGAAAAGGCAGGG + Intronic
1075013129 10:118891801-118891823 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1076232405 10:128832542-128832564 GGAAGGGAAGGGAAAGGGAAGGG + Intergenic
1076232408 10:128832547-128832569 GGAAGGGAAAGGGAAGGGGAGGG + Intergenic
1076540830 10:131213735-131213757 TGAAGGGACTCTTAAGGGCAAGG + Intronic
1077443848 11:2581168-2581190 AGAAGGGCCTGGGCAGGGCAGGG - Intronic
1077483783 11:2829607-2829629 ATAAGGGAGTGGGGAGGGCAGGG + Intronic
1077532394 11:3103376-3103398 AGGAGGGAAGGGTCAGGGAAAGG - Intronic
1077631593 11:3814919-3814941 AGAAAGGAAAGGAAAGGGAAAGG - Intronic
1077674862 11:4187124-4187146 AAAAGGGAATGGGGAGGGAAGGG - Intergenic
1077767454 11:5175751-5175773 GGAAGGGAAAGGAAAGGGAAGGG - Intronic
1077848746 11:6053654-6053676 GGAAGGAAATGATAAGGGAAGGG + Intergenic
1078064044 11:8066320-8066342 TGAAGGGAATTGGAAGGGCCTGG + Intronic
1078330323 11:10414001-10414023 TGAAGGGAAAGGTGAGGGCAGGG + Intronic
1078429705 11:11279737-11279759 AGAAGGGACTGGGAAGGTGATGG + Intronic
1079150654 11:17896544-17896566 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150661 11:17896560-17896582 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150668 11:17896576-17896598 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150675 11:17896592-17896614 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150680 11:17896603-17896625 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150685 11:17896614-17896636 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1079150693 11:17896631-17896653 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150698 11:17896642-17896664 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1079150701 11:17896653-17896675 GGAAGGGAAGGGTAACGGGAAGG + Intronic
1079150708 11:17896670-17896692 GGAAGGGAAGGGGAAGGGAAAGG + Intronic
1079150716 11:17896688-17896710 AAAGGGGAAGGGTAAGGGAAGGG + Intronic
1079150720 11:17896699-17896721 GTAAGGGAAGGGTAAGGGAAGGG + Intronic
1079150739 11:17896759-17896781 GGAAGGGAAGGGTAAGGGAAGGG + Intronic
1079150743 11:17896770-17896792 GTAAGGGAAGGGTAAGGGAAGGG + Intronic
1079150747 11:17896781-17896803 GTAAGGGAAGGGTAAGGGAAGGG + Intronic
1079150751 11:17896792-17896814 GTAAGGGAAGGGTAAGGGAAGGG + Intronic
1079150755 11:17896803-17896825 GTAAGGGAAGGGTAAGGGAAGGG + Intronic
1079150768 11:17896841-17896863 GGAAGGGAAGGGTAAGGGAAGGG + Intronic
1079153090 11:17919299-17919321 AAAAGGAAAGGGTAAGGGGAGGG + Intronic
1079484552 11:20921756-20921778 AGAAGGTTATGGCAAGAGCAAGG + Intronic
1079597514 11:22269142-22269164 AGAAAGGAAAGGAAAGGGAAGGG + Intronic
1079597525 11:22269178-22269200 AGAAGGAAAAGGGAAGGGAAGGG + Intronic
1079597539 11:22269256-22269278 AGAAGGAAAAGGGAAGGGAAGGG + Intronic
1079597553 11:22269334-22269356 AGAAGGAAAAGGGAAGGGAAGGG + Intronic
1080440927 11:32293845-32293867 AGAAGTGAAAGGGAGGGGCAGGG + Intergenic
1081155479 11:39684428-39684450 AGAAGGGAAGGGGAAGGAGAAGG - Intergenic
1082132424 11:48506500-48506522 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1082244394 11:49904952-49904974 AGAAGGAAAGGGAAAGGGGAAGG + Intergenic
1082657059 11:55869012-55869034 AGAAGGGGGTGGGAGGGGCACGG + Intergenic
1084620545 11:70267513-70267535 ACAAAGGAAGGGTAAGGGGAGGG + Intergenic
1084635206 11:70387614-70387636 AGAGAGGAAGGGCAAGGGCAAGG - Intergenic
1084909607 11:72377654-72377676 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1084909612 11:72377665-72377687 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1084909616 11:72377676-72377698 GGAAGGGAAGGGGAAGGGAAAGG + Intronic
1084909621 11:72377687-72377709 GGAAGGGAAAGGGAAGGGGAAGG + Intronic
1085386036 11:76158862-76158884 AGGAGGGAGTGCTAAGGGCAGGG + Intergenic
1087026476 11:93654639-93654661 AGAAAGGAATGGGAAGGGTATGG + Intergenic
1087074305 11:94114925-94114947 AGCTGGGAAAGGTAAGGGAAAGG + Intergenic
1087490595 11:98822322-98822344 AGTAAGGAAAGGTAAGTGCAGGG - Intergenic
1088771778 11:113042747-113042769 AGAAGGGAATGGAAAAGTCAGGG - Intronic
1088953179 11:114590638-114590660 AGAAAGGAAAGGAATGGGCATGG + Intronic
1089000165 11:115045163-115045185 AGAAGGGAATGCTAAGCTTAGGG - Intergenic
1089196286 11:116695693-116695715 AGAAAGGAATGGAAAAGACAAGG - Intergenic
1089299386 11:117489487-117489509 AGAAGGGAAGGGCTAGGGCTAGG + Intronic
1089632329 11:119791613-119791635 AGAAAGGGATGGAAAGGGCAGGG - Intergenic
1089741186 11:120585507-120585529 TTAAGAGAATGGAAAGGGCACGG - Intronic
1090350409 11:126104442-126104464 GGAAAGGAATGGAAATGGCAGGG - Intergenic
1090422004 11:126581852-126581874 GGAAGGGAATGGAAGGGACAAGG + Intronic
1090617563 11:128529369-128529391 AGATGGGAATGAAAAGGACAGGG + Intronic
1090875438 11:130784996-130785018 AGGACGGCAAGGTAAGGGCAGGG - Intergenic
1091115165 11:133005991-133006013 AGAAGGAAAAGAGAAGGGCAAGG - Intronic
1091192425 11:133706840-133706862 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1091192469 11:133706979-133707001 AGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1091192524 11:133707158-133707180 GGAAGGGAAAGGGAAGGGGAAGG + Intergenic
1091192531 11:133707175-133707197 GGAAGGGAAGGGAAAGGGAAGGG + Intergenic
1091192543 11:133707233-133707255 AAAAGGGAAGGGGAAGGGAAAGG + Intergenic
1091192582 11:133707378-133707400 GGAAGGGAAAGGGAAGGGGAAGG + Intergenic
1091192587 11:133707395-133707417 GGAAGGGAATGGAAAGTGGAGGG + Intergenic
1091192643 11:133707566-133707588 GGAAGGGAATGGGAAGTGGAGGG + Intergenic
1091192666 11:133707645-133707667 GGAAGGGAATGGGAAGTGGAAGG + Intergenic
1091192678 11:133707678-133707700 AGAAAGGAAGGGGAAGGGAAAGG + Intergenic
1091192702 11:133707758-133707780 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1091192712 11:133707785-133707807 AGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1091192734 11:133707838-133707860 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1091192750 11:133707876-133707898 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1091410993 12:239234-239256 TGAAGGGAATGGTGTGGGAATGG - Intronic
1092092099 12:5812041-5812063 GGAAGGGAAGGGTAAGGGAGGGG + Intronic
1092387987 12:8050840-8050862 GGAAGGGAAGGGGAAGGGAAAGG - Intronic
1092387993 12:8050856-8050878 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1092387998 12:8050867-8050889 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1092388003 12:8050878-8050900 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1092388008 12:8050889-8050911 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1092388024 12:8050927-8050949 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1092388043 12:8050975-8050997 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1092388054 12:8051002-8051024 GGAAGGGAAAGGGAAGGGGAAGG - Intronic
1092388056 12:8051007-8051029 GGAAGGGAAGGGAAAGGGAAGGG - Intronic
1092388083 12:8051077-8051099 GGAAGGGAAGGGAAAGGGAATGG - Intronic
1092388089 12:8051094-8051116 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1092388096 12:8051110-8051132 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1093772604 12:23034958-23034980 AGAAAGGAAAGGAAAGGGAAGGG - Intergenic
1093967935 12:25346730-25346752 GGAAGGGAAGGGTAAAGGGAAGG - Intergenic
1094047382 12:26182571-26182593 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1094624219 12:32107238-32107260 AGAAGGAAATGGGAAGGGATGGG - Exonic
1095596434 12:43964284-43964306 ACAAGGGCATGGTAAGTGCATGG + Intronic
1095904895 12:47367786-47367808 AGTAGGGAGTGATGAGGGCAAGG + Intergenic
1096526542 12:52213367-52213389 AGATGGGAAATGGAAGGGCAGGG - Intergenic
1096887283 12:54730675-54730697 AGAAGGGAAGGGAAGGGGAAGGG - Intergenic
1097050785 12:56221860-56221882 GGAAGGGAAGGGAAAGGGGAAGG + Exonic
1097575483 12:61388172-61388194 AGAAGAGAAAGGTAAGGGGGAGG + Intergenic
1097649291 12:62275924-62275946 AGAAGGGTATGCTATGGACATGG + Intronic
1099646085 12:85358989-85359011 AGAAGGGAAGGGGAGGGGGAAGG - Intergenic
1100286502 12:93172048-93172070 AGAAGGCAGTGGTCTGGGCATGG - Intergenic
1100434313 12:94558127-94558149 AGGAGAGAATGGGAAGGGCATGG + Intergenic
1100448617 12:94684100-94684122 AGAAGGGAAGGGTAGAGGAAAGG + Intergenic
1100710150 12:97247263-97247285 AGTGGTGAATGGTGAGGGCAGGG - Intergenic
1100777606 12:97989642-97989664 GGAAGGGAAGGGAAAGGGGAAGG + Intergenic
1100777612 12:97989659-97989681 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1101624557 12:106426191-106426213 AGCTGGAAATTGTAAGGGCAGGG + Intronic
1101649176 12:106659294-106659316 AGGAGGGAATGGTCAGGGAAAGG - Intronic
1102512992 12:113428273-113428295 GGAGGGGAAAGGTAAGGGCAGGG + Intronic
1102745287 12:115244142-115244164 AGGAGGGGAAGGTAAGGGAAGGG + Intergenic
1103029454 12:117600860-117600882 AGGAAGAAATGGTAAAGGCATGG + Intronic
1103274613 12:119701178-119701200 AGAAGGGAAGGGGGAGGGGAGGG + Intronic
1103291555 12:119850454-119850476 GGAAGGGAAGGGGAAGGGAAAGG + Intronic
1103291574 12:119850507-119850529 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1103291578 12:119850518-119850540 GGAAGGGAAGGGAAAGGGAAGGG + Intronic
1104014491 12:124952943-124952965 AGAAGGGAAGGATGAGGCCAGGG - Intronic
1104072066 12:125354457-125354479 AGAAGGGAGTGGTGGGGACAGGG - Intronic
1104499299 12:129269390-129269412 GGAAGGGAAGGGGAAGGGAAAGG - Intronic
1104554423 12:129786897-129786919 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1104956792 12:132470674-132470696 AGAAGGGAAAAGGAAGGGGAGGG + Intergenic
1106882100 13:34143046-34143068 AGAAGAGAAAGGTGAAGGCAAGG - Intergenic
1106999942 13:35531550-35531572 ACAAAGGAAAGGTAAGGGCTAGG - Intronic
1107205901 13:37787963-37787985 CGAGGGGAATGGTATAGGCAGGG + Intronic
1107220923 13:37978908-37978930 AGAAAGGAAAGGGAAGGGAAAGG + Intergenic
1107278953 13:38711216-38711238 AGACGGGGATGGGAAGGGAAAGG - Intronic
1107852591 13:44586232-44586254 AGCAGTGAATGGGAAGGGAAGGG - Intergenic
1108298049 13:49045024-49045046 AAAAGGGAAAGGAAAGGGAAAGG - Intronic
1108675952 13:52738516-52738538 AGAAGGGAATGTTCATGGCTAGG + Intronic
1108711284 13:53034986-53035008 AGAAGGGATGAATAAGGGCAAGG - Intronic
1109155556 13:58905635-58905657 AGAAGGGCATGGGAAAAGCAAGG - Intergenic
1109313418 13:60721817-60721839 AGAAAGGAAAGGAAAGGGAATGG - Intergenic
1109529441 13:63622683-63622705 AGAAGAGAGTGATAAGAGCATGG + Intergenic
1109552181 13:63917869-63917891 AGAAGGGGAAGGGAAGGGTAGGG - Intergenic
1110358334 13:74595405-74595427 AGAAGGGAAGGGGAGGGGAAGGG - Intergenic
1110592931 13:77285787-77285809 AGAAAGGAAAGGAAAGGGAAAGG + Intronic
1110883180 13:80598676-80598698 AGAAGGGAAAGTTTAGGTCAGGG + Intergenic
1111266551 13:85822666-85822688 TGAATGGAATTCTAAGGGCAAGG + Intergenic
1111462667 13:88566972-88566994 AGGAGGGAAGGGGAAGGGAAGGG + Intergenic
1111504861 13:89174227-89174249 AAAAGGGAAGGGCAAGGGGAGGG - Intergenic
1111648137 13:91057662-91057684 AGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1111785532 13:92782064-92782086 GGAAGGGAACGGGAAGGGGAGGG + Intronic
1111849397 13:93553395-93553417 AGAAGGGAATGAGATGGGCCAGG + Intronic
1112015732 13:95330038-95330060 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1112362459 13:98730220-98730242 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1112362465 13:98730231-98730253 GGAAGGGAAGGGGAAGGGGAGGG + Intronic
1112532210 13:100216071-100216093 AGAGGGGAAGGGGAAGGGGAGGG - Intronic
1112532224 13:100216100-100216122 AAAAGGGAAGGGGAAGGGAAAGG - Intronic
1113135276 13:107081998-107082020 GGAAGGGTATGGGAAGGGCAAGG + Intergenic
1113982603 13:114288924-114288946 AGATGGAAATGGGAGGGGCAGGG - Intronic
1114198002 14:20495768-20495790 GGAAGGGAAAGGTAAAGGAAAGG - Intergenic
1114275069 14:21135652-21135674 AGATGGGAGTGGGAAGAGCAGGG - Intergenic
1114601651 14:23960177-23960199 AGAAACGAATGAGAAGGGCAGGG - Intronic
1114611318 14:24042855-24042877 AGAAACGAATGAGAAGGGCAGGG - Intergenic
1114934230 14:27513734-27513756 AGAAGGTGATGGGAAGGGGATGG - Intergenic
1115262818 14:31471010-31471032 AGAAGGGAATGGGGAAGTCAAGG - Intergenic
1115499760 14:34038932-34038954 AGAAGGGCTTGGAAATGGCAAGG - Intronic
1116628449 14:47297503-47297525 GGAAGGGAAGGGAAGGGGCAGGG + Intronic
1117099674 14:52333570-52333592 CAAAGGGAATGGGGAGGGCAGGG - Intergenic
1117678992 14:58184167-58184189 AGAGGGGAATGGTAAGGCCAGGG + Intronic
1118073430 14:62271240-62271262 GGAAGGGAAGGGGAAGGGAAAGG - Intergenic
1119673746 14:76538938-76538960 AGAAGGGAAGGAAAAGGGAAGGG - Intergenic
1119673762 14:76538978-76539000 AGAAGGGAAGGAAAAGGGAAGGG - Intergenic
1119730386 14:76947470-76947492 AGAAGGGCAGGGTGGGGGCAGGG - Intergenic
1119732481 14:76959576-76959598 AGAAGGGAAGGGTGAGGCCAGGG - Intergenic
1119909581 14:78337439-78337461 GGAAGGTAATGGGAACGGCAGGG + Intronic
1120539986 14:85739494-85739516 AGAAGTGAGTGGTAAGTTCAGGG + Intergenic
1120880752 14:89413813-89413835 AGAAGGGAAAAGGAAGGGAAGGG + Intronic
1121326567 14:93023593-93023615 GGAAGGGAAGGGAAAGGGAAGGG + Intronic
1121464897 14:94109371-94109393 GGCAGGGAAGGGCAAGGGCAAGG + Intronic
1121865241 14:97356693-97356715 AGAAGGGAGAGGTAGAGGCAGGG - Intergenic
1122031970 14:98918984-98919006 AGGAGGGGATGGTAAGAGCTGGG - Intergenic
1122034668 14:98938542-98938564 AGAAGGGAAACCTAAGGACATGG + Intergenic
1122797352 14:104212656-104212678 AGAAGGGAATGGTGAGAGGTAGG + Intergenic
1202930947 14_KI270725v1_random:31514-31536 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1124353728 15:28979247-28979269 AGAAGAGAATGGCAAGGAGAGGG - Intronic
1124371870 15:29108574-29108596 AGAAGGGGAGGGCCAGGGCATGG + Intronic
1125013367 15:34905167-34905189 AGAAGGGAATGGAAAATGGATGG - Intronic
1125127901 15:36245932-36245954 AGAAAGGGTTGGTAAGGACAGGG - Intergenic
1126167439 15:45665872-45665894 AGAATGGAATGGGCTGGGCACGG - Intronic
1126950667 15:53877290-53877312 AGAAGGCATTGGAGAGGGCAAGG - Intergenic
1127421969 15:58815255-58815277 AGGAGGGAAGGGTAAAGGGAAGG - Intronic
1127978516 15:64016800-64016822 AGAAGGGAAGGGGAAGGGGAAGG + Intronic
1128316029 15:66659987-66660009 AGAAAGGAAAGGGAAGGGGAGGG - Intronic
1128324841 15:66717630-66717652 AGAAGGGAATGGATAGGCAAAGG - Intronic
1128660044 15:69493437-69493459 AGAGGGGAGTTGTAAGGGAAAGG + Intergenic
1130049820 15:80474578-80474600 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1130277404 15:82488514-82488536 AGAAGGGAAAGGAAAGGGAAGGG + Intergenic
1130395390 15:83496660-83496682 GCAGGGGAGTGGTAAGGGCAGGG + Intronic
1130561735 15:84964249-84964271 GGAAGGAAACGATAAGGGCATGG + Intergenic
1130957342 15:88637025-88637047 AGGTGGGAATGGTAAGGGCATGG + Intronic
1131772178 15:95750399-95750421 GCAAGGGAATGGTAAATGCATGG + Intergenic
1131890808 15:96969697-96969719 AGAAGGTAATGGTAGGAGCATGG - Intergenic
1132042503 15:98537015-98537037 GGAAGGGAAAGGCAAGGGGAAGG + Intergenic
1132042510 15:98537032-98537054 GGAAGGGAAAGGGAAGGGAAGGG + Intergenic
1132101085 15:99024128-99024150 AGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1132120207 15:99169422-99169444 AGAAGGGCATGGGAAGGTAAAGG + Intronic
1132325769 15:100968799-100968821 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1133137262 16:3720705-3720727 AGAAGGGAATGGAAAGAGGGTGG + Intergenic
1133155365 16:3871006-3871028 AGAAGGGGAGGGGAAGGGGAAGG + Intronic
1133588319 16:7217100-7217122 AGAAAGGAAAGGAAAGGGAAGGG - Intronic
1133910351 16:10060173-10060195 AGAAGGGAAAGGTCAGAGAAAGG + Intronic
1134229478 16:12417760-12417782 AGAAGGAAAGGGGAAGGGAAAGG - Intronic
1134310457 16:13071498-13071520 GGAATGGAATGGAAAGGCCAGGG - Intronic
1134596280 16:15498571-15498593 AAAAGGAAATGGGAAGGGAAGGG + Intronic
1134803260 16:17104847-17104869 AAAAGGGCATGGTGGGGGCAAGG - Exonic
1134871840 16:17659037-17659059 AAAAGAGAATTGTAAGGGCATGG + Intergenic
1135055377 16:19227635-19227657 AGAAGGAACTGGAAAGGGGAAGG - Intronic
1135071620 16:19357129-19357151 ATAATGGAATGGGAAGGACAGGG + Intergenic
1135088143 16:19490963-19490985 AGAAGGGGAAGGGAAGGGAAGGG - Intronic
1135186088 16:20317001-20317023 GGAAGGGAATGGGAAGGTGAAGG - Intronic
1135610968 16:23866931-23866953 AGAAAGGAAGGGGAAGGGAAGGG - Intronic
1135624220 16:23981609-23981631 AAAAGGGAAGGGAAAGGGAAAGG - Intronic
1135624239 16:23981682-23981704 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624247 16:23981699-23981721 GGAAGGGAAAGGGAAGGGGAAGG - Intronic
1135624252 16:23981710-23981732 GGAAGGGAAGGGGAAGGGAAAGG - Intronic
1135624256 16:23981721-23981743 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624261 16:23981732-23981754 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624266 16:23981743-23981765 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624271 16:23981754-23981776 GGAAGGGAAGGGGAAGGGAAAGG - Intronic
1135624275 16:23981765-23981787 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624280 16:23981776-23981798 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624285 16:23981787-23981809 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624290 16:23981798-23981820 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624298 16:23981815-23981837 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1135624318 16:23981859-23981881 GGAAGGGAAGGGGAAGGGGAGGG - Intronic
1135624332 16:23981887-23981909 GGAAGGGAAGGGGAAGGGGAGGG - Intronic
1135624341 16:23981904-23981926 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1135624348 16:23981920-23981942 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624353 16:23981931-23981953 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624367 16:23981970-23981992 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624389 16:23982039-23982061 GGAAGGGAAAGGGAAGGGGAAGG - Intronic
1135624409 16:23982100-23982122 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624414 16:23982111-23982133 GGAAGGGAAGGGGAAGGGAAAGG - Intronic
1135624418 16:23982122-23982144 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624423 16:23982133-23982155 GGAAGGGAAAGGGAAGGGAAAGG - Intronic
1135624429 16:23982150-23982172 GGAAGGGAAAGGGAAGGGGAAGG - Intronic
1135624447 16:23982200-23982222 CGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624460 16:23982233-23982255 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624465 16:23982244-23982266 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
1135624472 16:23982260-23982282 AGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624484 16:23982293-23982315 GGAAGGGAAAGGGAAGGGAAGGG - Intronic
1135624489 16:23982304-23982326 GGAAGGGAAAGGGAAGGGAAAGG - Intronic
1135624502 16:23982338-23982360 GGAAGGGAAAGGGAAGGGAAAGG - Intronic
1135624513 16:23982366-23982388 GGAAGGGAAAGGCAAGGGAAAGG - Intronic
1135624516 16:23982377-23982399 AGAAGCGAAGGGGAAGGGAAAGG - Intronic
1135708694 16:24696760-24696782 GGAAGGGAAGGGAAAGGGGAGGG + Intergenic
1136070464 16:27784323-27784345 GGAAGGGAATGGATAGGGAAGGG - Intergenic
1136419296 16:30122402-30122424 AGGAGAGAATGGACAGGGCAGGG + Intronic
1136489186 16:30594320-30594342 GAAAGGGAAGGGTAGGGGCAAGG + Intergenic
1136723596 16:32341228-32341250 GCAAGGCAATGGTAGGGGCAGGG + Intergenic
1136841928 16:33547273-33547295 GCAAGGCAATGGTAGGGGCAGGG + Intergenic
1137428278 16:48398215-48398237 TGAAAGGAAAGGGAAGGGCAGGG + Intronic
1137546485 16:49408081-49408103 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1138154004 16:54686026-54686048 GGAAGGGAAAGGGAAGGGAAAGG - Intergenic
1138458802 16:57135947-57135969 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1139097796 16:63726892-63726914 GGAAGGGAAAGGGAAGGGAAGGG - Intergenic
1139200741 16:64974197-64974219 ATAAGGGAGTGGAAAGGGAAGGG - Intronic
1140047422 16:71451104-71451126 AGAAGTGAAAGGAAAAGGCAAGG - Intronic
1141079701 16:81039135-81039157 AGAAGGTAGGGGTAAGGACAAGG + Intronic
1141204546 16:81923447-81923469 AGAAGGAAAAGGTCAGGCCAGGG - Intronic
1141210167 16:81972362-81972384 AGAAGGGAGAGGTAAGAGGAGGG - Intergenic
1141239700 16:82254299-82254321 AGAAGAGCAGGGAAAGGGCAGGG + Intergenic
1141261709 16:82460237-82460259 AGGAGGGAACAGCAAGGGCAAGG - Intergenic
1141263452 16:82474543-82474565 AGAAGGGAATGGGAAGATAATGG + Intergenic
1141371087 16:83486970-83486992 AGAAGGGAGAGGGAAGGACAAGG + Intronic
1203002835 16_KI270728v1_random:176537-176559 GCAAGGCAATGGTAGGGGCAGGG - Intergenic
1203134441 16_KI270728v1_random:1712943-1712965 GCAAGGCAATGGTAGGGGCAGGG - Intergenic
1203152093 16_KI270728v1_random:1847570-1847592 GCAAGGCAATGGTAGGGGCAGGG + Intergenic
1142640946 17:1285729-1285751 GGAAGGGAAGGGTAAGGTCGAGG + Intronic
1143228910 17:5334218-5334240 AGAAGGAAAGGGGAAGGGAAAGG - Intronic
1144759062 17:17697060-17697082 AGTAGGGATAGGTCAGGGCAAGG - Intronic
1145017902 17:19411049-19411071 AGAAGGGAAAGATAAGGACAGGG - Intergenic
1145390708 17:22453743-22453765 CGAAGGGGAGGGTAGGGGCAGGG - Intergenic
1145404254 17:22571483-22571505 AGAAGGGAAAGAGAATGGCAAGG + Intergenic
1146168908 17:30617424-30617446 AGAAAGGAATGGGAAGGCTAGGG - Intergenic
1146170654 17:30630025-30630047 AGAAAGGAATGGGAAGGCTAGGG + Intergenic
1147652863 17:42072125-42072147 AGAAGGGAAGGGGTAGGGGAGGG - Intergenic
1147754184 17:42757368-42757390 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1148356870 17:46981159-46981181 ACAAGGGGATGGAAAGGGCATGG + Intronic
1148666339 17:49377728-49377750 AAAAGGGAAGGGGAAGGGAAGGG - Intronic
1148806683 17:50267343-50267365 AGAGGGAAATGGAGAGGGCAGGG + Intergenic
1148854696 17:50572405-50572427 GGAAGGGACTGGGCAGGGCAGGG - Intronic
1149393988 17:56220687-56220709 AGAAAGGAAAGGAAAGGGAAAGG + Intronic
1149864429 17:60142735-60142757 AGAAGGGAGTGGCTAGGACAGGG + Intergenic
1150685324 17:67316081-67316103 GGAAGGGAAGGGAAAGGGGAAGG - Intergenic
1150781863 17:68129953-68129975 AGAAGGGAATGAGAAGGCTAGGG - Intergenic
1150918890 17:69462758-69462780 AAAAGGGCATTCTAAGGGCAAGG - Intronic
1151215447 17:72573940-72573962 AGAATGGAAAGGTAAGGAAATGG + Intergenic
1151272317 17:73006444-73006466 AGAAGGGAAAGGAAGGGGAAGGG + Intronic
1151537414 17:74746769-74746791 AGAAGTTAAAGGAAAGGGCATGG - Exonic
1152960024 18:74024-74046 AGAAAGGAAGGGGAAGGGGAAGG + Intergenic
1153003338 18:475850-475872 AGGAGGGAACGGTGATGGCAAGG + Intronic
1155188808 18:23411229-23411251 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1155702499 18:28764848-28764870 AGAAGGGATTTGTAAAGACAAGG + Intergenic
1156706452 18:39888805-39888827 AGTAGGGAAGGGGAAGGGAAGGG - Intergenic
1156738634 18:40296244-40296266 ATAAGCGAGTAGTAAGGGCAGGG + Intergenic
1157331914 18:46710480-46710502 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1158321714 18:56270698-56270720 GGAAGGGAAAGGAAAGGGAAGGG + Intergenic
1158592451 18:58789095-58789117 AAAAGGGAGTGGTAGGTGCATGG + Intergenic
1160135335 18:76266472-76266494 AGAAGGGAAGGGAAGGGGGAGGG + Intergenic
1160672312 19:371620-371642 AGAAGGGAATGGAGAAGGCCTGG - Intronic
1160705062 19:525803-525825 GGAAGGGAAGGGGAAGGGAATGG + Intergenic
1160721402 19:598592-598614 AGAAGGGAAGGGTGGGTGCAGGG - Intronic
1161139306 19:2638389-2638411 AGAAGGGGATGGGAAGGGAAAGG + Intronic
1161139385 19:2638542-2638564 AGAAGGGAAGGGGGAGGGGAGGG + Intronic
1161248910 19:3270298-3270320 GGAAGGGAAGGGTCAGGGAAGGG + Intronic
1161254459 19:3299662-3299684 AGAAGGGGAAGGGAAGGGGAAGG - Intergenic
1161255707 19:3308138-3308160 AGGATGGAATAGTGAGGGCAGGG - Intergenic
1161649861 19:5477886-5477908 AGTAGGGAAGGGACAGGGCAAGG - Intergenic
1161755642 19:6131503-6131525 GGAAGGGAAAGGGAAGGGAAGGG + Intronic
1162551076 19:11358589-11358611 AGAAGGGAAAGGAAAAGGGAAGG - Intronic
1162647060 19:12057577-12057599 AGAAGGGAAGGGAAAGGGACAGG + Intergenic
1162686178 19:12386466-12386488 AGAACGGAAGGGAAAGGGGAAGG + Intronic
1162690506 19:12426022-12426044 AGAAGGGAAGGGAAAGGGGAAGG + Intronic
1163101380 19:15099143-15099165 GGAAGGGAAAGGGAAGGGAAGGG + Intergenic
1163101389 19:15099169-15099191 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1163206039 19:15803438-15803460 AGAAGGGAAGGGAAAGAGGAGGG + Intergenic
1163206071 19:15803510-15803532 AGAAGGGAAGGGGGAGGGAAGGG + Intergenic
1163351034 19:16777147-16777169 GGAAGGGAAGGGGAAGGGAAAGG + Intronic
1163351172 19:16777471-16777493 AGGAGGGAAGGGGAAGGGAAAGG + Intronic
1163351288 19:16777772-16777794 AGGAGGGAAGGGGAAGGGAAAGG + Intronic
1163445261 19:17342111-17342133 AGGAGGGAAGGGTAGGGGAAGGG - Intronic
1164680564 19:30131214-30131236 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1165091379 19:33389894-33389916 ATAAGAGAATGGGAAGGGCTGGG + Intronic
1165400400 19:35596084-35596106 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
1166257183 19:41614968-41614990 AAAAGGGAAGGGGAAGGGGAAGG + Intronic
1166350804 19:42197139-42197161 AAAATGGAAGGGTCAGGGCAAGG + Intergenic
1166614464 19:44230702-44230724 AGAAAGGAAAGGTAAGGGGATGG - Intronic
1166659401 19:44636355-44636377 GGAAAGGAATTGTAAGGGCTTGG - Intronic
1166932019 19:46307018-46307040 AGAGGGGAATAGTAAGCGCAAGG - Intronic
1167067235 19:47195676-47195698 AGAAGCGAAGGGGAAGGGGAAGG - Intronic
1167607215 19:50487799-50487821 AGGAGGGAAAGGAAAGGACAGGG + Exonic
1167678289 19:50902962-50902984 AGAAGGGAAGGGGAGGGGAAGGG - Intergenic
1168507096 19:56945428-56945450 AGAAGGGAAAGGGAAAGACAGGG + Intergenic
1202691143 1_KI270712v1_random:96364-96386 AGAAGGCCATGGTAGGGCCAAGG + Intergenic
925392749 2:3508911-3508933 AGAAGGGAAGGGAAGGGGAAGGG + Intronic
925392751 2:3508916-3508938 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
925445552 2:3923945-3923967 AGGAGGGAAGGGGAAGGGGAAGG - Intergenic
925548254 2:5041654-5041676 AGAAGGGAAAGGGAAGGGAAGGG - Intergenic
925548269 2:5041693-5041715 GGAAGGGAAAGGGAAGGGGAAGG - Intergenic
925548271 2:5041698-5041720 GGAAGGGAAGGGAAAGGGAAGGG - Intergenic
925548280 2:5041725-5041747 GGAAGGGAAAGGGAAGGGAAGGG - Intergenic
925548282 2:5041730-5041752 GGAAGGGAAGGGAAAGGGAAGGG - Intergenic
925548285 2:5041736-5041758 AGAAGGGGAAGGGAAGGGAAAGG - Intergenic
925548316 2:5041816-5041838 GGAAGGGAAAGGGAAGGGGAAGG - Intergenic
925573389 2:5334856-5334878 GGAAGGGAAGGGAAAGGGGAAGG + Intergenic
925683983 2:6453051-6453073 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
925684006 2:6453105-6453127 GGAAGGGAAAGGGAAGGGGAAGG + Intergenic
925684014 2:6453122-6453144 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
925684024 2:6453144-6453166 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
925684029 2:6453155-6453177 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
925684037 2:6453172-6453194 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
925684042 2:6453183-6453205 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
925684064 2:6453228-6453250 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
926197959 2:10775007-10775029 AGAAGGAAATTGAAAGGGAAAGG + Exonic
926760083 2:16270823-16270845 GGAAGGGAAGGGAAAGGGAAAGG - Intergenic
927088025 2:19690090-19690112 AGAGGGGAAGGGGAAGGGGAGGG + Intergenic
927108730 2:19849190-19849212 AGAAGGGAAAGCTCAGGGAATGG + Intergenic
928300661 2:30121364-30121386 GGAAGGGAATGGAAGGGGAAAGG - Intergenic
928765698 2:34642530-34642552 AGCAGGGATAGGGAAGGGCATGG + Intergenic
929091853 2:38225128-38225150 AGAAGGAAAGGGAAAGGGCTAGG + Intergenic
929443789 2:41987183-41987205 AGAAAGGAACAGTAAGAGCATGG + Intergenic
929481214 2:42310282-42310304 AAAGGGGAATGGGAAGGGAAAGG - Intronic
929481234 2:42310336-42310358 AAAAGGGAAGGGGAAGGGGAAGG - Intronic
929618212 2:43328859-43328881 AGGAGGGAAAGGCAAAGGCATGG - Intronic
930029722 2:47050775-47050797 AGGAGGGAATGGTTAAGGGAGGG + Intronic
931152393 2:59588863-59588885 AGAAGGGAGTGGGCAGGGAATGG - Intergenic
931927955 2:67095821-67095843 AGGAGGGACTGGGAAGGACATGG - Intergenic
932112334 2:69012920-69012942 ACATGAGAATGGTAAGGACAAGG + Intergenic
932733359 2:74235952-74235974 AGAAGGCAATTTGAAGGGCAGGG + Intronic
933030086 2:77317698-77317720 TGAGGGGAATGGTAAGGGGCTGG + Intronic
933334319 2:80937359-80937381 AGAAGGGAAGGGAAAGGATACGG - Intergenic
933600847 2:84328440-84328462 AGAAGAGAACAGTAAGGGCATGG + Intergenic
933955247 2:87357586-87357608 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
934069968 2:88374692-88374714 AGAAGGGAATGGGATGGGACAGG + Intergenic
934172448 2:89552153-89552175 AGAGTGGAAGGGCAAGGGCATGG + Intergenic
934239437 2:90253800-90253822 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
934273748 2:91562898-91562920 AGAAGGCCATGGTAGGGCCAAGG + Intergenic
934282761 2:91626505-91626527 AGAGTGGAAGGGCAAGGGCATGG + Intergenic
934461878 2:94217154-94217176 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
934695682 2:96398446-96398468 AGAAGGGAAGGGAAGGGGAAGGG - Intergenic
934977753 2:98816765-98816787 AGAAGGGACTGTGAAGGGAAGGG + Intronic
934982313 2:98853017-98853039 GGAAGGGAAGGGAAAGGGAAGGG + Intronic
934982315 2:98853022-98853044 GGAAGGGAAAGGGAAGGGAAGGG + Intronic
937262623 2:120596203-120596225 GCCAGGGAATGGGAAGGGCAAGG - Intergenic
938042055 2:128083948-128083970 AAATGGGAATGGGCAGGGCACGG - Intergenic
938072356 2:128315412-128315434 AGCAGGGAATGGGAGGGGCTTGG + Intronic
938745298 2:134272176-134272198 AGAAGGAAATGGGAAGGACTTGG + Intronic
940373050 2:152923287-152923309 GGAATGGAATGGGAAGGGAAGGG - Intergenic
940669370 2:156648874-156648896 AGAAAGGAAGGGAAAGGGGAGGG - Intergenic
940946402 2:159623070-159623092 AGAAGGGAAGGGAGAGGGGAGGG + Intergenic
941514453 2:166455549-166455571 GGAAGAGAAGGGGAAGGGCAAGG + Intronic
941595687 2:167474091-167474113 GGAAGGGAAATGTAATGGCATGG + Intergenic
941635380 2:167930265-167930287 AGGAGGGAAAGGTAAAGGAAAGG - Intergenic
941924562 2:170882817-170882839 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
941924572 2:170882844-170882866 GGAAGGGAAAGGGAAGGGAAGGG + Intergenic
941924577 2:170882855-170882877 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
941924586 2:170882876-170882898 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
942379758 2:175376641-175376663 AGAAGAGAAGGGGAAGGGGAAGG + Intergenic
942793831 2:179792814-179792836 GGAAGGGAAGGGAAAGGGAAAGG + Intronic
942953906 2:181751748-181751770 AGAAGGGAATGGGAAGAGAAGGG + Intergenic
942953913 2:181751770-181751792 GGAAGGGAATGGGAAGGAAAAGG + Intergenic
943300361 2:186190865-186190887 AGAAGGGACTGGGAAGAGCATGG + Intergenic
943661775 2:190566619-190566641 AGAAAGGAAGGGGAAGGGAAGGG + Intergenic
944036160 2:195296847-195296869 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
944154983 2:196598458-196598480 AGAAGGGGAGGGAAAGGGGAAGG + Intergenic
944288302 2:197976431-197976453 AGAAGGGAAAGGGAAAGGAAAGG - Intronic
945363437 2:208921357-208921379 AGAAGGGAAGGGGAGTGGCATGG - Intergenic
946316578 2:218919388-218919410 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
946446900 2:219747876-219747898 GGAAAGGAAAGGAAAGGGCAGGG - Intergenic
947006042 2:225512585-225512607 GGAAGGGAAAGGAAAGGGGAAGG - Intronic
947343618 2:229166960-229166982 AGAAAGGAAGGGGAAGGGGAAGG + Intronic
947906355 2:233766211-233766233 AGAAGGGGATGGAATGGGAAGGG + Intronic
947908139 2:233780886-233780908 GTATGGGAAAGGTAAGGGCAGGG - Intronic
948152504 2:235755437-235755459 AAAAGGGAAGGGGAAGGGGAGGG - Intronic
948554277 2:238796507-238796529 AGCAGGGAGTGGGCAGGGCAGGG - Intergenic
948809695 2:240468278-240468300 AGAAGGAAAAGGCCAGGGCACGG + Intergenic
1168853993 20:996235-996257 GGAATGGAATGGTAACGGAATGG - Intronic
1169178654 20:3542630-3542652 AAAAGGGAAGGGGAAGGGGAAGG - Intronic
1169259405 20:4124908-4124930 AGAAGGGAAGGGAAAGGGAAGGG - Intronic
1169299575 20:4430544-4430566 AGAAGGGAAACGAAAGGGGAAGG + Intergenic
1169431151 20:5537633-5537655 AGAAGGGAAGGGAAGGGGGAAGG + Intergenic
1169514996 20:6306743-6306765 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1169565640 20:6850854-6850876 AGAAAAGGATGGTAAGGGCTGGG - Intergenic
1169696185 20:8389386-8389408 AGAAGGTAAGGGAAAGGTCACGG + Intronic
1169822986 20:9734383-9734405 AAAAGGGAATGATAAGAGAAGGG + Intronic
1169920598 20:10730910-10730932 AGGAGGGAAAGGGAAGGGAATGG - Intergenic
1170010098 20:11713365-11713387 AAAAGGGAGTGGAAAGAGCAAGG + Intergenic
1170158486 20:13289628-13289650 AGAAGAGAAGGGGAAGGGCATGG + Intronic
1170543078 20:17408292-17408314 AGAAGGGAATGGGGAAGGAATGG + Intronic
1171201855 20:23248042-23248064 ACAAGGGAAGGGTAAGGACTGGG - Intergenic
1171212732 20:23329259-23329281 AGAGGGCAATGGTGAGGGAAAGG - Intergenic
1171474514 20:25397823-25397845 AAAAGGGAAGGGAAAGGGGAAGG + Intergenic
1171562393 20:26136980-26137002 AGAAGGGAAAGAGAATGGCAAGG + Intergenic
1172113148 20:32559278-32559300 AGAAGGAAAAGGAAAGGGAAGGG - Intronic
1172286294 20:33742764-33742786 AAAAGGAAAAGGAAAGGGCATGG - Intronic
1172439170 20:34953536-34953558 AGGAGGGAAGGGAAAGGGAAAGG - Intronic
1172999112 20:39092732-39092754 AGAAGGGAATGGTGAAGGAGCGG + Intergenic
1173608345 20:44348399-44348421 AGAAAGGAAGGGGAAGGGGAAGG - Intronic
1173890686 20:46507238-46507260 ACAAGGGAAAGGGAAGGGGAAGG + Intronic
1175287377 20:57845907-57845929 AGCTGGAAATGGCAAGGGCATGG + Intergenic
1175486931 20:59353470-59353492 GGAAGGGGAAGGGAAGGGCAAGG + Intergenic
1175651401 20:60727719-60727741 ATCAGAGAAGGGTAAGGGCATGG - Intergenic
1175967345 20:62666136-62666158 AGAGGGGAAGGGGAAGGGGAAGG - Intronic
1176260503 20:64177269-64177291 AGAAGGGAGAGGTGGGGGCAGGG - Intronic
1176592968 21:8660136-8660158 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1176648948 21:9528688-9528710 AGAAGGGAAAGAGAATGGCAAGG - Intergenic
1176705195 21:10111402-10111424 AGAAGGGGAGGGGAAGGGGAGGG + Intergenic
1178174342 21:30078898-30078920 AAAGTGCAATGGTAAGGGCAGGG - Intergenic
1178625194 21:34210529-34210551 AGAATAGAGAGGTAAGGGCACGG - Intergenic
1178857219 21:36260218-36260240 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1178936416 21:36866208-36866230 GGAAGGGAATGGTAAGGGAAGGG + Intronic
1179023597 21:37660518-37660540 AGTAGGGAATGGAAGGGGCAAGG - Intronic
1179572963 21:42288726-42288748 AGAAAGGAAGGGAAAGGGAAAGG + Intronic
1179774618 21:43653190-43653212 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1179774625 21:43653206-43653228 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1179774632 21:43653222-43653244 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1179936699 21:44610588-44610610 AGAAGGGAAATGTAGGGCCAGGG + Intronic
1180275820 22:10637279-10637301 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1181596243 22:23916789-23916811 AGAAAGGAAAGGGAAGGGAAGGG + Intergenic
1182143790 22:27984430-27984452 AGGAGGGGGTGGTGAGGGCAGGG - Intronic
1182561898 22:31166584-31166606 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1182563312 22:31179091-31179113 AGAAAAGAATGGTCAGGGTAGGG + Intronic
1183276467 22:36901189-36901211 AACAGGGATTGGGAAGGGCAAGG - Intergenic
1183848391 22:40562555-40562577 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1183869177 22:40728314-40728336 AAAAGGTAATGGCAAAGGCATGG + Intergenic
1184311952 22:43651510-43651532 AGAAGGGAAATGTGGGGGCAGGG + Intronic
1184483706 22:44763621-44763643 AAAAGGGAATCGGAAGGACAGGG + Intronic
1184813663 22:46854374-46854396 AGCAGGGAACGGGAAGGGGAGGG - Intronic
1185059504 22:48598937-48598959 AGCAGGGAATGGTAAGCAAAGGG - Intronic
949551573 3:5116239-5116261 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
949728885 3:7084059-7084081 AGATGGGAACCGTAGGGGCAGGG + Intronic
950108822 3:10405523-10405545 AGAAGAGAATAGGAAGGGGAGGG + Intronic
950125122 3:10505914-10505936 AGGAGGGAATGTCAAGGGCACGG + Intronic
950327149 3:12121633-12121655 AGAAAGGGAAGGTAAGGGGAAGG + Intronic
950757256 3:15185538-15185560 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
950770277 3:15305685-15305707 AGAGGGGAATGGGAACAGCATGG + Intronic
951038076 3:17955622-17955644 GGAAGGGAAGGGAAAGGGAAAGG - Intronic
951103589 3:18717563-18717585 AGAAGGAAAAGGGAAGGGAAGGG - Intergenic
951534118 3:23726066-23726088 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
951771324 3:26260602-26260624 AGAAATGGCTGGTAAGGGCAGGG + Intergenic
951930131 3:27955915-27955937 AGAAAGGAAAGGAAAGGGAAGGG - Intergenic
952089243 3:29864837-29864859 GGAAGGGAAGGGAAAGGGAAGGG + Intronic
952089245 3:29864842-29864864 GGAAGGGAAAGGGAAGGGGAAGG + Intronic
952121198 3:30246383-30246405 AGGAAGGAATGGGAAGGGAAGGG - Intergenic
952285376 3:31963252-31963274 AGAAGGGGATGGGAAAGGGAGGG - Intronic
952344863 3:32473909-32473931 CGAAGGGCATGGTAAAGGGAGGG - Intronic
952484290 3:33794473-33794495 AAAAGGCAATGGTAAGGGACAGG - Intergenic
953351790 3:42221540-42221562 AGGAGGGAATGGGAAGGAAAAGG - Intronic
953581234 3:44158592-44158614 ACAGGAGAATGGTAAGGGGAAGG + Intergenic
953837839 3:46362522-46362544 AGCAAGCAAGGGTAAGGGCATGG + Intergenic
954038363 3:47865756-47865778 GGAAGGGAGCGGTGAGGGCAGGG + Intronic
954101119 3:48373346-48373368 GTAAGGGAAGGGAAAGGGCAAGG + Intronic
955086664 3:55709480-55709502 AGAAGGGAAGGGTAAAGCAAAGG + Intronic
955099262 3:55831357-55831379 AGAAGGGGAGGGGAAGGGAAGGG + Intronic
955409826 3:58648373-58648395 AGAAGGAAATGGAGAGGGCCTGG + Intronic
955478888 3:59369067-59369089 AGAGGAGAAAGGTCAGGGCAAGG - Intergenic
955949624 3:64229339-64229361 AGAAGGGAAGGGTAAGTGACAGG + Intronic
956097712 3:65734841-65734863 AGAAGGAAATGGTGGGGGGAGGG + Intronic
956230143 3:67005637-67005659 AGAAGGGAAGGGGAAGGGGGAGG - Intronic
956337890 3:68185239-68185261 AGAAGGGAAAGAGAAGGGAAAGG + Intronic
956530384 3:70211651-70211673 GGAAGGGAAAGGGAAGGGAAGGG - Intergenic
956752085 3:72351488-72351510 AAAAGAGAAAGGTATGGGCAAGG + Intergenic
956795982 3:72719229-72719251 AGGAAGGAAGGGTAAGGGTAGGG + Intergenic
956924688 3:73971015-73971037 AGCAGAGGATGGTAAGAGCAAGG + Intergenic
957672941 3:83328649-83328671 GGAAGGGAAAGGGAAGGGGAAGG + Intergenic
957771622 3:84700446-84700468 AGAAAGGAAAGGGAAGGGAAGGG + Intergenic
958933869 3:100237174-100237196 AGAATAGAATGTTCAGGGCACGG - Intergenic
959368082 3:105488662-105488684 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
959732416 3:109619135-109619157 GGAAGGGAAGGGTAAGGAGAGGG - Intergenic
959732419 3:109619146-109619168 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
959946720 3:112133148-112133170 AGAAGGAAGTGGTAAAGGGACGG - Exonic
960111961 3:113853908-113853930 GGAAGGGAAGGGAAAGCGCAGGG + Intronic
960385208 3:117014417-117014439 AGAAGGGAATAGACACGGCAAGG + Intronic
962557162 3:136565150-136565172 AGAAGGGAAAGGGAAAGGAAAGG + Intronic
963105174 3:141641004-141641026 AGAAGGGAATAGGCTGGGCATGG + Intergenic
963512401 3:146264088-146264110 AGAAGGAAAGAGGAAGGGCAAGG + Intergenic
963755484 3:149231303-149231325 AAAAGGGAAAGGAAAGGGAAGGG + Intergenic
964107596 3:153055882-153055904 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
964146503 3:153470421-153470443 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
964406871 3:156358359-156358381 AGAAGGGAAGGAGAAGGGGAAGG + Intronic
965368171 3:167825059-167825081 AGAAAGGAAAGGAAAGGGAAAGG + Intronic
966140560 3:176752068-176752090 AGAAGGGAAGGGAAGGGGAAGGG + Intergenic
966140562 3:176752073-176752095 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
966140629 3:176752378-176752400 AGAAGGGAAAGGGAAGGGAGGGG + Intergenic
966348324 3:179003159-179003181 AGAAGGGAATGGTAGGGAGAGGG - Intergenic
966535008 3:181022510-181022532 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
966694742 3:182778247-182778269 AGAAGGGACTTGGAAGGGGAGGG - Intergenic
966836132 3:184050861-184050883 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
967360485 3:188624728-188624750 GGAAGGGAAGGGAAAGGGAAAGG - Intronic
967554897 3:190845453-190845475 AGAAAGGAATGATAAGGTCTAGG + Intergenic
967854962 3:194110520-194110542 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
967997060 3:195174691-195174713 AGAAGAGAAAGGGAAGGGAAGGG - Intronic
968128463 3:196177398-196177420 GGAAGGGAATGATAAAGGCTAGG - Intergenic
968333209 3:197889606-197889628 AAAAGGCAAAGGTAAAGGCAAGG - Exonic
969397688 4:6933297-6933319 AAAAGGGAAGGGGAAGGGGAAGG - Intronic
969694929 4:8729154-8729176 AGAAGGGGATGGAAAGGGCTGGG + Intergenic
970903052 4:21182419-21182441 GGAAGGGAAAGGAAAGGACAGGG - Intronic
970904063 4:21194680-21194702 AGAAGGGAAGGCAAAGCGCATGG - Intronic
971196996 4:24479197-24479219 AGAAGGGGAAGGGAAGGGAATGG + Intergenic
971423428 4:26493906-26493928 AAAAGGGAAAGGGAAGGGAAGGG - Intergenic
971717928 4:30204753-30204775 AGAAGGGATTGGTCACTGCAAGG - Intergenic
972804435 4:42513685-42513707 AGCAGGGAATGGAAATGGAAAGG + Intronic
972902278 4:43700064-43700086 CCCAGGGAATGGTAAAGGCAGGG - Intergenic
973222994 4:47750494-47750516 AGAAGGAAAAGGTACAGGCAGGG + Intronic
973249633 4:48047605-48047627 AGAGGGTACTGGCAAGGGCAGGG + Intergenic
973604738 4:52575477-52575499 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
973858262 4:55035089-55035111 AGAAGGGAGTGGGGAGGGGAGGG - Intergenic
974135324 4:57809571-57809593 AGACAGCAATGGCAAGGGCAAGG + Intergenic
974833343 4:67216331-67216353 AGAAAGGAAAGGGAAGGGAAGGG + Intergenic
974880888 4:67756238-67756260 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
974880893 4:67756249-67756271 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
975423377 4:74196336-74196358 AGAAGTTAATGCTAAGGGCTTGG + Intronic
975867431 4:78738156-78738178 AGAAGGGAAGGAAAAGGGAAAGG + Intergenic
975892735 4:79048982-79049004 AGAAGGGAATGGTCAGAACACGG - Intergenic
976086584 4:81413072-81413094 CCAAGGGAATGGCAAGGGCAAGG + Intergenic
976749448 4:88439394-88439416 AAAAGGGAAGGGAAAGGGAAAGG + Intronic
976753783 4:88477348-88477370 AGAAGGGGAGGGGAAGGGAAAGG + Intronic
977146554 4:93448849-93448871 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
977146559 4:93448860-93448882 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
977146564 4:93448871-93448893 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
977146571 4:93448887-93448909 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
977146580 4:93448908-93448930 GGAAGGGAAGGGGAAGGGAAGGG - Intronic
977146591 4:93448931-93448953 GGAAGGGAAAGGGAAGGGGAAGG - Intronic
977929096 4:102732311-102732333 AGAAGGGAATTGTGCAGGCATGG + Intronic
978094853 4:104763503-104763525 AGAGGGGGGTGGTGAGGGCAGGG + Intergenic
978912772 4:114083846-114083868 AAAAGGGAATAGTAAGGACCTGG - Intergenic
979578481 4:122324515-122324537 TTAAGCGAATGGAAAGGGCAAGG + Exonic
980281323 4:130724763-130724785 AGGAGAGAATGGTAAGGGAGTGG - Intergenic
980377456 4:131968095-131968117 AGAAGGGGAGGGGAAGGGGACGG + Intergenic
980785547 4:137549734-137549756 AGAAGGGAGACGAAAGGGCATGG + Intergenic
981606537 4:146546459-146546481 TGAAGTGATTGGTAGGGGCAGGG + Intergenic
982221454 4:153129019-153129041 TTAAGGGAATGGCAAGGCCATGG - Intergenic
982492523 4:156046617-156046639 AGAAGGGAAGGGTAGGGGAAGGG - Intergenic
982804758 4:159749322-159749344 GGAAGGGAAGGGAAAGGGAAAGG - Intergenic
982884940 4:160766478-160766500 AGAAGGGAAGGGAAGGGGGAAGG + Intergenic
983072978 4:163291788-163291810 AGAAGGGAAGGGAAGGGGAAGGG + Intergenic
984043914 4:174773773-174773795 AGAAGGGAAGGGAAAGAGAAAGG - Intronic
984241997 4:177228908-177228930 AAAAGGAAAAGGAAAGGGCAAGG - Intergenic
984418736 4:179492610-179492632 AGAAGGGAAGGGGAAGGGGAAGG - Intergenic
984682942 4:182631725-182631747 AGAAGGGAATTCTAAGGGAATGG - Intronic
984856703 4:184201537-184201559 AGAAGGGAGTGGTTAGAGTAGGG - Intronic
984858940 4:184219834-184219856 GGAAGGGAAGGGAAAGGGAAAGG + Intronic
984858979 4:184219971-184219993 GGAAGGGAAGGGAAAGGGTAAGG + Intronic
984859021 4:184220117-184220139 AGAAGGGAAAGGAAAGGGAAAGG + Intronic
984911283 4:184676532-184676554 GGAAGGGAAGGGAAAGGGAAGGG - Intronic
984911313 4:184676629-184676651 AGAAGGGAGGGGGAAGGGGAGGG - Intronic
984911465 4:184676999-184677021 AGAAGGGAAGGGAAGGGGGAAGG - Intronic
984911475 4:184677023-184677045 AGAAGGGAAGGGAAGGGGGAAGG - Intronic
985486857 5:156671-156693 ATGAGGGAATGGAAAGAGCAGGG + Intronic
985678845 5:1245719-1245741 GGATGGGAATGGAAAAGGCACGG - Intronic
986988969 5:13529553-13529575 GGAAGGGAACAGCAAGGGCAGGG + Intergenic
987048423 5:14128826-14128848 AGAAGTCAATGGTAAGGTGAAGG - Intergenic
987656243 5:20810434-20810456 AAGAGGGAATAGTAGGGGCAAGG - Intergenic
987943289 5:24570404-24570426 AGAAGTGGAAGGTAAGGGCCTGG + Intronic
988514752 5:31894878-31894900 GGAAGGGAAGGGAAAGGGAAAGG - Intronic
989069664 5:37497278-37497300 AGAAGGGAAGGGAAAAGGGAGGG - Intronic
989206688 5:38816385-38816407 GGAAAGGAATGGAAAGTGCAGGG - Intergenic
989272944 5:39554007-39554029 AGAAGGGAGAGGCAAGGGAAAGG + Intergenic
989806327 5:45611565-45611587 AGAATGTAATGGTAGGGGCCAGG - Intronic
990107653 5:52284336-52284358 GGAAGGGAAGGGAAAGGGAAAGG + Intergenic
990297259 5:54415347-54415369 AGAAGGGAAGGTTAAGGGCAGGG + Intergenic
990313494 5:54562383-54562405 AGAAAGGAATGGTAAGAAAAGGG + Intergenic
991252447 5:64578610-64578632 AGAATGGCATGGTAAGGGCTTGG - Intronic
991541502 5:67734540-67734562 AGAAGGGAAAGGTAAGCAAAGGG + Intergenic
991662880 5:68968430-68968452 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
991662884 5:68968441-68968463 GGAAGGGAAGGGAAAGGGGAAGG + Intergenic
992797298 5:80264609-80264631 AAAAGGGAAGGGGAAGGGGAAGG - Intergenic
994638090 5:102367540-102367562 AGGAGGGAAGGGGAAGGGGAAGG + Intergenic
995768174 5:115640965-115640987 AGAAGAGAATGAAAAAGGCAGGG - Intergenic
995882454 5:116858282-116858304 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
995958548 5:117810798-117810820 AGAAGGGAAGGGAGAGGGAAGGG - Intergenic
995958556 5:117810825-117810847 GGAAGGGAAGGGCAAGGGAAGGG - Intergenic
996296153 5:121919787-121919809 AGTGGGGAGAGGTAAGGGCATGG - Intergenic
996568734 5:124909702-124909724 AGAAGGGAATGGAAGGGGAAAGG - Intergenic
996933036 5:128914029-128914051 AGAAGGCAATGGTAAGTTCAAGG - Intronic
997828958 5:137132599-137132621 AGCTGGGAATGGTAGGGCCAGGG - Intronic
998026959 5:138825662-138825684 AGAAAGAAAAGGTAAAGGCAAGG - Intronic
998166986 5:139849756-139849778 AGAAGGGAATGGGTAGGACTTGG - Intronic
998415914 5:141945901-141945923 AGGAGGGAAGGGAAATGGCAGGG + Intronic
999044705 5:148454595-148454617 AGAAGGGAAAGGCAAAGTCAGGG - Intronic
999091497 5:148940235-148940257 TGAAAGGAATGGTCAGGGAAGGG + Intronic
999236201 5:150097292-150097314 AGAAGGGAAGGGAAAGGGAAAGG + Intronic
999273103 5:150309500-150309522 AGGAGGGAATGGGAAGGGCAGGG - Intronic
1001038763 5:168316876-168316898 AGAAGGGAAGAGAAAGGGAATGG - Intronic
1003005267 6:2375451-2375473 ACAAGGGAATGGTGAGGGAGTGG + Intergenic
1003040332 6:2682038-2682060 AAAAGTGAATGGGAAAGGCAAGG + Intronic
1003123934 6:3340143-3340165 AGAAGGGAATGGTAAGGGCAGGG + Intronic
1003397586 6:5766294-5766316 AGAAAGGAAGGGTAAGAGCATGG - Intronic
1005223861 6:23619803-23619825 AGAAGGGAAGGGGAAGGAGAAGG + Intergenic
1005827407 6:29642403-29642425 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1006400035 6:33812485-33812507 AGAAGAGGATGGCATGGGCATGG - Intergenic
1006567633 6:34973898-34973920 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567641 6:34973915-34973937 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567649 6:34973932-34973954 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567667 6:34973972-34973994 ACAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567715 6:34974096-34974118 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567738 6:34974148-34974170 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567759 6:34974195-34974217 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567792 6:34974276-34974298 GGAAGGGAAGGGGAAGGGGAAGG - Intronic
1006567800 6:34974293-34974315 GGAAGGGAAAGGGAAGGGGAAGG - Intronic
1006858259 6:37151376-37151398 AGAAGGGAAAGGGAAGGGAAGGG - Intergenic
1007270799 6:40635499-40635521 AGATGGGCATGGTGAGTGCAGGG - Intergenic
1007289462 6:40774232-40774254 AGAAGGGAATGGCAGGGGGCAGG + Intergenic
1007334875 6:41148716-41148738 AAAAGGGAATGGTAAGGGAATGG - Intergenic
1007594247 6:43041692-43041714 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1007594251 6:43041703-43041725 GGAAGGGAAGGGAAAGGGAAGGG + Intronic
1007594253 6:43041708-43041730 GGAAGGGAAAGGGAAGGGAAGGG + Intronic
1007600483 6:43077723-43077745 AGGTGGCAATGGGAAGGGCATGG + Intronic
1007825671 6:44598924-44598946 AGGAGGGAAGGGCAAGAGCAAGG + Intergenic
1007927839 6:45663944-45663966 AGAAGGGCATGTGAAGGGCCAGG - Intronic
1007953992 6:45899812-45899834 AGAAGGGAATGCTGAGGACAGGG + Exonic
1008070119 6:47091084-47091106 AGATGGGAATGGTGAGGTGAAGG - Intergenic
1008514641 6:52307474-52307496 AGAAGGGGAGGGGAGGGGCAGGG - Intergenic
1008931915 6:56949522-56949544 AGAAGGAACTGTCAAGGGCAGGG + Intronic
1009826720 6:68875273-68875295 GGAAAGGAAAGGTAAGGGGAGGG - Intronic
1010173867 6:73003301-73003323 AGAAGGAAATGGAAAGTGTATGG + Intronic
1010507248 6:76675622-76675644 GGAAGGGAAGGGGAAGGGAAAGG - Intergenic
1010507249 6:76675627-76675649 AGAAGGGAAGGGAAGGGGAAGGG - Intergenic
1011050940 6:83149138-83149160 AGTATGGAATGGAAAGGGGAGGG + Intronic
1011121480 6:83958495-83958517 AGAAGGGGATAGTACAGGCAGGG + Intronic
1012005178 6:93704942-93704964 AGAAGAGAAGGGAAGGGGCAGGG - Intergenic
1012111622 6:95242139-95242161 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1012449865 6:99343761-99343783 AGAAGGGTTAGGTGAGGGCATGG - Intronic
1014028513 6:116675705-116675727 AGGAGGCACTGGTAAGGGCAAGG + Intergenic
1014772835 6:125476383-125476405 AGGAGAGAATGGCAAGGGGAAGG + Intergenic
1015117818 6:129668674-129668696 AGAAGGGGACGGTACAGGCAAGG - Intronic
1016084387 6:139894823-139894845 GGAGGGGAATGGTGAGGGGACGG + Intergenic
1016103976 6:140138867-140138889 CCCTGGGAATGGTAAGGGCAAGG + Intergenic
1016562618 6:145413991-145414013 AGAGAGGGATGGTAAAGGCAGGG + Intergenic
1016622365 6:146127200-146127222 GGAAAGAAATGGTGAGGGCATGG + Intronic
1017199576 6:151737876-151737898 ATAAGGGAATTATAAGGGAAGGG + Intronic
1017293272 6:152765673-152765695 GGAAGGGAAGGGAAAGGGAAAGG - Intergenic
1017849886 6:158296190-158296212 AAAAAGGAATGGGAAGGGAAAGG - Intronic
1018304359 6:162439321-162439343 AGAAGGGAGGGGTAAAGGAAGGG - Intronic
1018777730 6:167033397-167033419 AGAAAGGAATCGACAGGGCATGG - Intronic
1019266826 7:121727-121749 AGAGGGGCAGGGGAAGGGCAGGG + Intergenic
1019696420 7:2448754-2448776 GGAAGGGAAAGGGAAGGGAAGGG - Intergenic
1019696422 7:2448759-2448781 GGAAGGGAAGGGAAAGGGAAGGG - Intergenic
1019767727 7:2863850-2863872 AGCAGAGATTGGAAAGGGCAGGG - Intergenic
1019832763 7:3349534-3349556 AGAAGCGAAGGATATGGGCAAGG + Intronic
1019934219 7:4243814-4243836 AGAGGGGAAGGGTCTGGGCAGGG + Intronic
1020341760 7:7118502-7118524 AGAATGGGAAGGTAAGGGCCTGG + Intergenic
1020660592 7:10976319-10976341 AGAAGGGAAGGGGAAGGGAAAGG + Intronic
1021204057 7:17758182-17758204 AGCAGGGAAGGATAAGAGCATGG - Intergenic
1021582787 7:22174798-22174820 ATAAGGGAAGGATAAGGGGAGGG + Intronic
1022057333 7:26751915-26751937 AGAAAGGAAGGGTAAGGAAAGGG + Intronic
1022522457 7:31016907-31016929 TGAAGGGACTGGTGTGGGCAGGG + Intergenic
1022689339 7:32631642-32631664 AGAAAGAAAAGGTAAGGGTAAGG - Intergenic
1022799317 7:33760778-33760800 AAAAGGGAGTGGTAAGAGCTTGG - Intergenic
1022916919 7:34965998-34966020 AGAAAGAAAAGGTAAGGGTAAGG - Intronic
1022982308 7:35615726-35615748 AGGAGGGATTGGGAAGGGGATGG - Intergenic
1023003774 7:35840240-35840262 AAAAGGGAAGGGGAAGGGGAAGG - Intronic
1023218655 7:37894873-37894895 AGAAAGGAAAGGAAAGGGAAGGG - Intronic
1023811883 7:43918300-43918322 AGAAGGGAAAGGAAAGGGAAAGG - Intronic
1023890701 7:44389841-44389863 AGGAGGGAAGGGGAGGGGCAAGG + Intronic
1023911134 7:44557661-44557683 AAAAGGGAAGGGGAAGGGAAAGG + Intergenic
1024158010 7:46646298-46646320 AGGAAGGAATGGAAAAGGCAGGG - Intergenic
1024577080 7:50773381-50773403 GGAAGGGAAGGGGAAGGGAAGGG + Intronic
1024577085 7:50773392-50773414 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1024737776 7:52323616-52323638 GGAAGGGAAGGGAAAGGGGAAGG - Intergenic
1024737790 7:52323651-52323673 GGAAGGGAAGGGAAAGGGAAAGG - Intergenic
1024765688 7:52655609-52655631 GGAAGGGAATGATAGGGTCATGG + Intergenic
1025231636 7:57206793-57206815 AGAAGGGAAGGGGAAGGAAAGGG - Intergenic
1026040616 7:66865532-66865554 GGAAGGGAAAGGGAAGGGAAGGG - Intergenic
1026040618 7:66865537-66865559 AAAAGGGAAGGGAAAGGGAAGGG - Intergenic
1026040663 7:66865670-66865692 AAAAGGGAAAGGGAAGGGAAGGG - Intergenic
1026040678 7:66865719-66865741 AGAAGGGAAGGGGAAAGGAAGGG - Intergenic
1026253501 7:68691055-68691077 AGGGGGGAATGGGAAGGGGAAGG + Intergenic
1026676831 7:72435269-72435291 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1026762623 7:73137906-73137928 GGAAGGGAAGGGGAAGGGGAGGG + Intergenic
1026762633 7:73137928-73137950 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1026762638 7:73137939-73137961 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1026803669 7:73416068-73416090 AGAAGGGGAAGGGAAGGGAAGGG + Intergenic
1026803673 7:73416079-73416101 GGAAGGGAAGGGGAAGGGAAAGG + Intergenic
1026803677 7:73416090-73416112 GGAAGGGAAAGGGAAGGGAATGG + Intergenic
1026826766 7:73587336-73587358 AGAAGGGAATGGCTAAGGAAGGG + Intergenic
1027039095 7:74947704-74947726 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1027039100 7:74947715-74947737 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1027039105 7:74947726-74947748 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1027084539 7:75254651-75254673 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1027084544 7:75254662-75254684 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1027250382 7:76395211-76395233 AGGCGGGAATGGTAGGGGTATGG - Intronic
1027397030 7:77767089-77767111 AGAAAGGAAGGGAAAGGGAAAGG - Intronic
1028584595 7:92440266-92440288 AGAAAGGAAAGGGAAGGGAAGGG + Intergenic
1028757614 7:94455958-94455980 GGAAGGTAAGGGTAAGGGAAAGG + Intergenic
1028924719 7:96345518-96345540 AGGAAGGAATGGGAAGGGAAGGG + Intergenic
1029025131 7:97408559-97408581 ACAAGGGAAAAGTAAGGGGAAGG + Intergenic
1029274832 7:99397850-99397872 GGAAAGGAAAGGTAAGGGCTGGG - Exonic
1029382608 7:100223429-100223451 AGAACGGGATGCAAAGGGCAAGG - Intronic
1029392120 7:100282467-100282489 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1029392125 7:100282478-100282500 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1029392130 7:100282489-100282511 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1029392135 7:100282500-100282522 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1029392145 7:100282522-100282544 AGAAGGGGAGGGGAAGGGGAGGG - Intergenic
1029533793 7:101143620-101143642 GGAAGGGAAAGGAAAGGGAAAGG + Intergenic
1029610044 7:101622042-101622064 AGCAGGGAATGGCAGGGGGACGG - Intronic
1029875044 7:103741669-103741691 AGAAGGGAAGGGAAAAGACAGGG + Intronic
1030365525 7:108641552-108641574 AGAAGGGAAGGGAAAGAGGAAGG - Intergenic
1030495767 7:110297939-110297961 AGAAGGGCAGGAGAAGGGCAGGG - Intergenic
1030773727 7:113507551-113507573 AGATGGGGAAGGTAAGGGAAAGG + Intergenic
1031697398 7:124874852-124874874 AGAGAGGAATGGGAAGGGAAAGG + Intronic
1032474482 7:132202841-132202863 AGAGGGGAAGGGCAAGGACAAGG + Intronic
1033643019 7:143280748-143280770 TGAAGGGAAGTGGAAGGGCAAGG - Intronic
1034345251 7:150381861-150381883 AGAGGGGAAGGGTCAGGGCTGGG + Intronic
1034451406 7:151139089-151139111 ACAAGGGCATGGAAAGCGCAAGG - Intronic
1034889438 7:154827327-154827349 AGAAGGGAAGGGAAGGGGAAGGG - Intronic
1034975476 7:155446849-155446871 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1035435875 7:158858875-158858897 AGAAGGGAGGGGAAAGGGGAGGG - Intronic
1035441736 7:158907581-158907603 AAAAGGGAAAGGAAAGGGAACGG - Intronic
1035539134 8:418292-418314 AGAAAGGAAAGGAAAGGGAAAGG - Intronic
1035856943 8:2985935-2985957 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1035950093 8:4010510-4010532 TGATGGGAATGGTGATGGCATGG - Intronic
1035992743 8:4510703-4510725 GGAAGGGAAGGGAAAGGGGAAGG - Intronic
1035992767 8:4510787-4510809 GGAAGGGAAGGGAAAGGGGAAGG - Intronic
1036058030 8:5281566-5281588 AGAAAGAAATGGTGAGGGGAGGG + Intergenic
1036576585 8:10033035-10033057 TGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1036917383 8:12817380-12817402 ATAAGGGAATAGTAGGGCCATGG + Intergenic
1037701044 8:21273984-21274006 ACAAGGCACTGGGAAGGGCAGGG + Intergenic
1037829609 8:22179840-22179862 AGAAGGGATGGGTGAGGGCGTGG + Intronic
1038191390 8:25324227-25324249 AGCAGTGAATGGTAAGGGGTCGG + Intronic
1038511959 8:28146067-28146089 AAAAGGTAATGGGTAGGGCAGGG - Intronic
1038675100 8:29616155-29616177 AGGAGGGAAGGGGAAGGGAAAGG + Intergenic
1039195659 8:35028520-35028542 AGCAGGGAATGGGAAGAGGAGGG + Intergenic
1039658769 8:39439491-39439513 GGAAGGGAAGGGAAAGGGAAAGG - Intergenic
1039762180 8:40589878-40589900 AGAAGGGAAGGGAAGGGGAAGGG - Intronic
1040540349 8:48347985-48348007 AGGAGTGATTGCTAAGGGCAGGG - Intergenic
1040899720 8:52405841-52405863 AGAAAGGAATGGTGAGGGGTGGG + Intronic
1041118869 8:54566496-54566518 AGAAGGAAATGGGAGGGGCGGGG - Intergenic
1041191686 8:55361587-55361609 AGAAGGGAAGGAAGAGGGCACGG - Intronic
1041192689 8:55369344-55369366 AGAAAGGAAAGGGAAGGGAAGGG + Intronic
1042105838 8:65325672-65325694 AGAAGAGAAGGGAAAGGACAGGG - Intergenic
1042255836 8:66802692-66802714 AGAAGGGGATGGGGAGGGAAGGG + Intronic
1042324243 8:67512230-67512252 AAAAGAAAGTGGTAAGGGCATGG - Intronic
1042480561 8:69297604-69297626 AAAAGGGAAGGGGAAGGGAAAGG + Intergenic
1042803987 8:72752062-72752084 AGAAGTGAATGGTGAGGTCTGGG + Intronic
1043058159 8:75466678-75466700 AGAAGAGAAAGGGAAGGGAAGGG - Intronic
1043431790 8:80202062-80202084 GGAAGGGAAGGGAAAGGGGAGGG + Intronic
1043529320 8:81132607-81132629 ACAAGGGAAGGGAAAGGGAAAGG - Intergenic
1044926625 8:97214713-97214735 TGGAGGAAATGGTAAGAGCATGG + Intergenic
1045030247 8:98128137-98128159 AGAAGAGGATGGAAAGGGCCTGG - Intronic
1045290166 8:100826145-100826167 AGGAGAGAAGGGTAATGGCAAGG - Intergenic
1045555433 8:103210158-103210180 AGGTGGGAATGGGAAGAGCAGGG + Intronic
1045636764 8:104200072-104200094 ATATAGGAATGGTCAGGGCAGGG + Intronic
1046060144 8:109129070-109129092 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1046605430 8:116366138-116366160 AGGAAGGAATGGGAAGGGAAGGG + Intergenic
1046936182 8:119887487-119887509 AGAAGGGAAGGGGAAGGGAAGGG - Intronic
1047187505 8:122647177-122647199 GGAAGGGAAGGGAAAGAGCAGGG + Intergenic
1048417611 8:134243888-134243910 AGAAGAGAAGGGGAAGGGGAGGG + Intergenic
1048516552 8:135116735-135116757 AGAAGAGGAAGGGAAGGGCAGGG - Intergenic
1048788309 8:138075827-138075849 AGAAAGGAAGGGAAAAGGCAAGG - Intergenic
1049136786 8:140909171-140909193 GGAAGGGAAGGGGAAGGGGAAGG + Intronic
1049672297 8:143875339-143875361 AGAAGGGAAGGGAGAGGGCCAGG - Intronic
1050308912 9:4333271-4333293 GAAGGGGAATGGTAGGGGCAGGG + Intronic
1050435986 9:5611380-5611402 GGAAGAGAATGCAAAGGGCATGG - Intergenic
1050546985 9:6717412-6717434 AGAAGGGAAAGGAAAGGAGAGGG + Intergenic
1050567146 9:6897339-6897361 AGAGGAGAATGGTAAGGCCTGGG - Intronic
1051026806 9:12622993-12623015 AGAAGGTAATGGAAAGGGTGGGG + Intergenic
1051411745 9:16796601-16796623 GGAAGGGAAGGGAAAGGGAAAGG + Intronic
1051894050 9:21970198-21970220 AAAAAGGAAAGGCAAGGGCAAGG + Intronic
1053250622 9:36571548-36571570 AGAAGGGGAAGGGAAGGGGAAGG - Intergenic
1053642451 9:40098469-40098491 AGAAGGGGAAGGGAAGGGGAAGG + Intergenic
1053642454 9:40098475-40098497 GGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1053692069 9:40591412-40591434 ACCAGGGAATGGTCAGGGCCAGG + Intergenic
1053692348 9:40592806-40592828 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1053763677 9:41366985-41367007 AGAAGGGGAGGGGAAGGGGAGGG - Intergenic
1053763696 9:41367034-41367056 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1053790437 9:41682820-41682842 AGAAGTGAGTGGAAAGGGCACGG - Intergenic
1054272449 9:63044679-63044701 AGAAGGCCATGGTAGGGCCAAGG + Intergenic
1054303609 9:63393772-63393794 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1054402387 9:64720282-64720304 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1054435990 9:65204597-65204619 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1054494402 9:65817090-65817112 AGAAGGCCATGGTAGGGCCAAGG + Intergenic
1054542295 9:66278153-66278175 AGAAGGGGAAGGGAAGGGGAGGG - Intergenic
1054542312 9:66278202-66278224 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1055008084 9:71532095-71532117 AGAAGGGAATAGAAAATGCATGG + Intergenic
1055447302 9:76395622-76395644 GGAAGGGAAAGGAAAGGGGAAGG + Intergenic
1056040504 9:82660649-82660671 AGAAGGGAAGGGGGAGGGAAGGG + Intergenic
1056431759 9:86535145-86535167 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1057018858 9:91680243-91680265 AGAAGGGAATGGTAAGCCACCGG + Intronic
1057857308 9:98611373-98611395 AGTAGGAAATAGTTAGGGCAGGG - Intronic
1058105421 9:100964678-100964700 AGAAGGGAATGGGAAACACAAGG - Intergenic
1058407982 9:104698900-104698922 AGAAAGGAAAGGAAAGGGGAGGG + Intergenic
1059352949 9:113678507-113678529 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1060105106 9:120868742-120868764 AGGAGGGAATAGTAAGGCCTCGG - Intronic
1060273933 9:122167976-122167998 AGAGGGAAATAGTAAGGTCAGGG - Intronic
1060399759 9:123341537-123341559 ATAGGGGAGTGTTAAGGGCAGGG + Intergenic
1060574955 9:124683214-124683236 AGAAAGGAAGGGAAAGGGAAAGG + Intronic
1061270287 9:129536449-129536471 AGAAGGGCAGGGAAAGGTCAGGG + Intergenic
1061885663 9:133590055-133590077 GGAAGGGAAGGGGAAGGGAAGGG - Intergenic
1061885671 9:133590072-133590094 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1061885679 9:133590089-133590111 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1061885713 9:133590155-133590177 AGAAGGGGAGGGGAAGGGGAGGG - Intergenic
1062039727 9:134398742-134398764 AGATGGGAATTTTAAGGCCATGG - Intronic
1062536258 9:137022311-137022333 AGAAGGGAGTGGCCAGGGCTGGG + Intronic
1062652386 9:137584691-137584713 AAAAGGGAAGGGGAAGGGGAAGG - Intronic
1062738054 9:138149565-138149587 AGAAAGGAAGGGGAAGGGGAAGG - Intergenic
1202790227 9_KI270719v1_random:81499-81521 AGAAGGGGAGGGGAAGGGGAGGG + Intergenic
1203623014 Un_KI270749v1:138943-138965 AGAAGGCCATGGTAGGGCCAAGG - Intergenic
1203626682 Un_KI270750v1:32237-32259 AGAAGGGAAAGAGAATGGCAAGG - Intergenic
1185640674 X:1588196-1588218 AGAAGGGAAGGGAAGGGGCGGGG - Intergenic
1185867544 X:3637036-3637058 AGAAGGGAAGGGAAAGGGAAGGG + Intronic
1186240864 X:7564617-7564639 AGAAGAGAATGGAAAGTACAAGG - Intergenic
1186322015 X:8437857-8437879 AGAAGGAAATGGTAGCTGCATGG + Intergenic
1186587026 X:10885953-10885975 AGAAGGGATTTGGAAGGGAAGGG + Intergenic
1186736362 X:12469216-12469238 AGAAGAGAAGGGGAAGGGAAGGG - Intronic
1186779067 X:12894762-12894784 AGAAGGGAATGGTTAGTGGTTGG - Intergenic
1186855515 X:13622472-13622494 AGAAAGGAATGGTAAGGAAAGGG - Intronic
1187353112 X:18540676-18540698 AGAAGGGAAGGGGAAGGGGAAGG - Intronic
1187389417 X:18876027-18876049 AGAAGGAAAAGGGAAGGGAAGGG - Intergenic
1187569085 X:20482845-20482867 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1187576201 X:20559091-20559113 AGAAGGGAAGGGGAAGGAGAAGG - Intergenic
1187576207 X:20559108-20559130 AGAAGGGAAGGGGAAGGAGAAGG - Intergenic
1187707768 X:22024913-22024935 AGAAAGGAATGGGCAAGGCAGGG - Intergenic
1187752747 X:22485584-22485606 AGAAGGAAGTGGTAAGGGGAAGG - Intergenic
1188033341 X:25289164-25289186 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1188306577 X:28566722-28566744 AGAAGGGAATGGCAGTTGCAGGG + Intergenic
1188353988 X:29167299-29167321 AGAAGGGAAGGGAAGGGGAAGGG - Intronic
1188517058 X:30999082-30999104 GGAAGGGAAGGGGAAGGGGAAGG - Intergenic
1188637502 X:32452394-32452416 GGAAGGGAAAGGAAAGGGAAAGG + Intronic
1188741194 X:33784705-33784727 GGAAGGGAAGGGAAAGGGAAGGG - Intergenic
1188741198 X:33784716-33784738 GGAAGGGAAAGGGAAGGGAAGGG - Intergenic
1188741211 X:33784767-33784789 GGAAGGGAAGGGAAAGGGAAGGG - Intergenic
1189351594 X:40279769-40279791 AGAAGGGCGTGGTAGGGGGAGGG - Intergenic
1189463648 X:41262227-41262249 GGAAGGGAAAGGAAAGGGAAAGG - Intergenic
1190203195 X:48381486-48381508 AGAAGGGAAGGGAAAGGAGAAGG - Intergenic
1190207341 X:48413918-48413940 AGAAGGGAAGGGAAAGGAGAAGG + Intergenic
1190417973 X:50199800-50199822 GGGAGGGAATGGAAAGGGGAGGG - Intronic
1190561935 X:51694937-51694959 AGAGGGGAAGGGGAAGGGGAAGG + Intergenic
1190722460 X:53161393-53161415 AGAAGTTAATTGTAAGGGCCAGG + Intergenic
1190741544 X:53292065-53292087 AGAAGAGAATAGCAAGTGCAAGG + Intronic
1191103394 X:56757678-56757700 AGAAGGGAAAGAGAAGGGAACGG + Intergenic
1191716114 X:64194636-64194658 AGAGGGGAAGGGGAAGGGGAGGG + Intronic
1192197620 X:69039566-69039588 AGATGGGAATGCAAAGGGCCAGG - Intergenic
1192549016 X:72039038-72039060 AGAAGGGAAGGAAAAGGGAAGGG - Intergenic
1193721231 X:84990064-84990086 GGAAGGGAAGGGGAAGGGGAAGG + Intergenic
1194490693 X:94544868-94544890 AGAAGGGAAGGGGAAGGGAAGGG + Intergenic
1195082527 X:101385093-101385115 AGGAGGAAATGGAAAGGGAAAGG + Intronic
1195234948 X:102887901-102887923 GGAAGGGAAGGGAAAGGGAAAGG - Intergenic
1195892742 X:109713082-109713104 AGAAGGGAAGGGGAAGGGAAAGG + Intronic
1196569518 X:117249083-117249105 AGAGGGGAAGGGCAAGGGCAAGG - Intergenic
1197195745 X:123699301-123699323 AGAAGGGAAAGTCAAGGGCCAGG - Intronic
1197616024 X:128692472-128692494 AGAAGGGAATATTAGGAGCAGGG - Intergenic
1197868035 X:131039043-131039065 AGAAGGGAAAGTTATGGGCATGG - Intergenic
1198229184 X:134673318-134673340 AGGAGGGAAGGGGAAGGGAAGGG + Intronic
1199315219 X:146368941-146368963 AGAAGAGAAAGAGAAGGGCACGG + Intergenic
1199812582 X:151365346-151365368 GGAAGGGAAGGGAAAGGGGAAGG - Intergenic
1201066866 Y:10105409-10105431 AGAAGGGAAGGAGGAGGGCAGGG + Intergenic
1201274983 Y:12288104-12288126 GGAAGGGAATGGTCTGGTCAGGG + Intergenic
1201421699 Y:13806584-13806606 AGGAGGGAAAGGAAAGGGAAGGG - Intergenic
1201721749 Y:17105970-17105992 AGAAGGGAAGGGAAAGGAAAAGG - Intergenic
1201918298 Y:19206273-19206295 AGAAGTGAAGGGGAAGGGAAGGG - Intergenic