ID: 1003123935

View in Genome Browser
Species Human (GRCh38)
Location 6:3340144-3340166
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123919_1003123935 15 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123935 6:3340144-3340166 GAAGGGAATGGTAAGGGCAGGGG No data
1003123916_1003123935 28 Left 1003123916 6:3340093-3340115 CCCAGAGAGCGCTCCCACAAAAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1003123935 6:3340144-3340166 GAAGGGAATGGTAAGGGCAGGGG No data
1003123920_1003123935 14 Left 1003123920 6:3340107-3340129 CCACAAAAGCGGTATTATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1003123935 6:3340144-3340166 GAAGGGAATGGTAAGGGCAGGGG No data
1003123926_1003123935 -4 Left 1003123926 6:3340125-3340147 CCAGGAGGGATGGCCTGGAGAAG 0: 1
1: 0
2: 2
3: 41
4: 321
Right 1003123935 6:3340144-3340166 GAAGGGAATGGTAAGGGCAGGGG No data
1003123917_1003123935 27 Left 1003123917 6:3340094-3340116 CCAGAGAGCGCTCCCACAAAAGC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1003123935 6:3340144-3340166 GAAGGGAATGGTAAGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr