ID: 1003123936

View in Genome Browser
Species Human (GRCh38)
Location 6:3340156-3340178
Sequence AAGGGCAGGGGCTTTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003123931_1003123936 -5 Left 1003123931 6:3340138-3340160 CCTGGAGAAGGGAATGGTAAGGG 0: 1
1: 0
2: 2
3: 28
4: 368
Right 1003123936 6:3340156-3340178 AAGGGCAGGGGCTTTGAAATTGG 0: 1
1: 0
2: 2
3: 43
4: 365
1003123926_1003123936 8 Left 1003123926 6:3340125-3340147 CCAGGAGGGATGGCCTGGAGAAG 0: 1
1: 0
2: 2
3: 41
4: 321
Right 1003123936 6:3340156-3340178 AAGGGCAGGGGCTTTGAAATTGG 0: 1
1: 0
2: 2
3: 43
4: 365
1003123919_1003123936 27 Left 1003123919 6:3340106-3340128 CCCACAAAAGCGGTATTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1003123936 6:3340156-3340178 AAGGGCAGGGGCTTTGAAATTGG 0: 1
1: 0
2: 2
3: 43
4: 365
1003123920_1003123936 26 Left 1003123920 6:3340107-3340129 CCACAAAAGCGGTATTATCCAGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1003123936 6:3340156-3340178 AAGGGCAGGGGCTTTGAAATTGG 0: 1
1: 0
2: 2
3: 43
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003123936 Original CRISPR AAGGGCAGGGGCTTTGAAAT TGG Intronic
900013591 1:135097-135119 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
900043660 1:491080-491102 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
900065098 1:726083-726105 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
900853084 1:5159067-5159089 GAGGGCAGGGCCTTTGTGATAGG - Intergenic
902764709 1:18606664-18606686 AATGACAGGGGGTTTGAAGTTGG - Intergenic
903175829 1:21579862-21579884 AAGTACAGGAGCTTTGGAATAGG - Intergenic
903801170 1:25969451-25969473 AAGGGCATGGGCCTTGGAATTGG + Intronic
904093492 1:27960608-27960630 AGGCGCATGGGCTTTGAAGTCGG + Intronic
905257912 1:36696893-36696915 AGGAGCAAGGGCTTTGGAATGGG + Intergenic
905628991 1:39508419-39508441 AAGGGCAGGGGCCGTGGGATAGG - Intronic
906167434 1:43697335-43697357 AATGGCAGGGCCCTTGGAATGGG + Intronic
906267853 1:44447872-44447894 GAAGGCAGGGACTTAGAAATAGG - Intronic
906378821 1:45318472-45318494 AAGGGGTGAGGCTTTGAACTGGG - Intergenic
906774037 1:48512539-48512561 AAGGGCATGGGCTCTGGAGTTGG + Intergenic
906938881 1:50238341-50238363 AAGAGCAGGGGCTTGAGAATCGG - Intergenic
907459640 1:54597766-54597788 AAAGGCAGGGGCTGGGAAAGTGG - Intronic
908064305 1:60385986-60386008 AAAAGTAGGGGCTTTGGAATGGG - Intergenic
908251526 1:62269675-62269697 TAGGGCAGGGACTTTGGTATAGG - Intronic
909556868 1:76963817-76963839 AAGGTTAGGGGCCTTGAGATGGG + Intronic
911374357 1:97032946-97032968 AAGGCCATGGCCTCTGAAATGGG + Intergenic
913974788 1:143446615-143446637 AAGTGCAAAGGCTTGGAAATGGG - Intergenic
914069179 1:144272231-144272253 AAGTGCAAAGGCTTGGAAATGGG - Intergenic
914109976 1:144694123-144694145 AAGTGCAAAGGCTTGGAAATGGG + Intergenic
915195365 1:154185022-154185044 AAGTACAGTGGCATTGAAATTGG - Intronic
916637356 1:166687253-166687275 AAGGGCCGGTGGTTTGAAATTGG + Intergenic
917359204 1:174158415-174158437 GAGGGCAGGGGAATTGAAGTGGG + Intergenic
918175964 1:182045438-182045460 AAGGGGAGGGGGTGTAAAATAGG + Intergenic
918525416 1:185459149-185459171 AAGGGCACGGCCTGTGTAATGGG - Intergenic
918699258 1:187587006-187587028 AACGGCAGGGACTTTGGAATTGG + Intergenic
920870397 1:209789482-209789504 AAAGGCAGGGTCCTTAAAATGGG - Intronic
921308826 1:213823027-213823049 ACGGGCAGGGCCTGGGAAATAGG - Intergenic
921545840 1:216474020-216474042 AAGAGCAAGGGCTTTGCAATAGG + Intergenic
922100001 1:222472098-222472120 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
922262030 1:223951586-223951608 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
922964781 1:229679819-229679841 AAGAGCACGGGCTTTGGAATTGG + Intergenic
1063344992 10:5303347-5303369 AAGGGCAGGGGAAATGAAATTGG - Intergenic
1063377902 10:5565012-5565034 AAGGGCGTGGACTTTGAAGTTGG + Intergenic
1063922870 10:10949255-10949277 AAGTGCAGGGGCTTTGGGAGTGG - Intergenic
1065303772 10:24349560-24349582 AAGGGCACAGGCTTGGAAACAGG - Intronic
1066733287 10:38451807-38451829 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1069889422 10:71643924-71643946 GTGGGGAGGGGCTTTGAAAAGGG + Intronic
1073219920 10:101862849-101862871 AAAGGCAGGGACTTTCAGATTGG + Intronic
1073930684 10:108570883-108570905 AAGAAAAGGAGCTTTGAAATTGG - Intergenic
1074134102 10:110612160-110612182 AAGGGCAGTGACTTTGAAGTGGG + Intergenic
1074894831 10:117766330-117766352 AAAGGCATGGGCTTTGAAAGTGG + Intergenic
1075646820 10:124102338-124102360 AAGGGCAGGGGGATTGCAAGTGG - Intergenic
1076149856 10:128153256-128153278 AAGGCCAGAGGCTATGAAAGAGG - Intergenic
1076969933 11:127311-127333 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1077694716 11:4383834-4383856 CAGGGCTGGGGCTTTGGGATGGG - Intergenic
1078874718 11:15381400-15381422 AAGAGTATGGGCTTTGGAATCGG - Intergenic
1078967403 11:16362103-16362125 AAGGGAAGGGGCTTTGTTTTAGG - Intronic
1079971483 11:27040895-27040917 TAGGGCAGAGGCATTGAGATGGG - Intronic
1080461196 11:32456328-32456350 TATGGCATGGGCTTTGAGATGGG + Intergenic
1083295614 11:61713929-61713951 ATGTGAAAGGGCTTTGAAATTGG - Intronic
1083328686 11:61886633-61886655 AAGGGTAGGGCCTTTGTACTCGG - Intronic
1083569198 11:63747918-63747940 AAGAGCAAGGGCTTTGGAGTTGG - Intronic
1083678184 11:64339634-64339656 AAGGGGAGGGGATTTGACCTCGG - Intergenic
1084127381 11:67108837-67108859 GAGGTCAGGGGTTTTGAGATCGG + Intergenic
1084302157 11:68258862-68258884 AATGGCAGGGGGTTTGGAATAGG + Intergenic
1085034549 11:73292200-73292222 AGGGGCAGTCGCTGTGAAATGGG + Intronic
1086101510 11:83104596-83104618 AAGGGTAAGGGATTTGAAATGGG + Intergenic
1086416241 11:86591376-86591398 AAAGGCAGTGGCATTAAAATGGG + Intronic
1086507809 11:87524220-87524242 CAGGGAAGGGGCTAGGAAATGGG - Intergenic
1087016147 11:93556108-93556130 AAGGACAGGGGCTTTGGGATGGG + Intergenic
1088979403 11:114848302-114848324 CAGGGCAGAGGCTGTGAAGTAGG + Intergenic
1089991579 11:122866200-122866222 AAGGGCAGGGCGATTGAAAAGGG - Intronic
1090416419 11:126543658-126543680 AAGGGCAGGGGCTGTCCTATCGG - Intronic
1090474717 11:127009546-127009568 AAGGGCAGAGCCTTACAAATAGG - Intergenic
1090597517 11:128335608-128335630 TAGGGAAGGGGCTTTGCAACTGG - Intergenic
1090734277 11:129597772-129597794 AAGAGCACGGGCTTTCAAGTTGG + Intergenic
1090875618 11:130786358-130786380 AAGGGGAGAAGCTTTGAAATGGG - Intergenic
1091777609 12:3194829-3194851 CAGGGCAGGGGCTAGGAGATTGG - Intronic
1093315130 12:17639945-17639967 ATTGGAAGGGGCTTTGAAATCGG - Intergenic
1093419082 12:18953787-18953809 AAGGAAAAGGGCTTTGAAACTGG + Intergenic
1097054621 12:56242211-56242233 TAGGGCTGTGGTTTTGAAATGGG + Exonic
1098189707 12:67935316-67935338 AAGGAGAGGGGCATTGAAAATGG + Intergenic
1099183058 12:79489570-79489592 AAGGGAAGGGGCATTGGAAATGG + Intergenic
1100057653 12:90532596-90532618 AAGGGAAGAAGCATTGAAATGGG + Intergenic
1100209306 12:92385122-92385144 AAGGGCTGGGGCTATAAAAATGG + Intergenic
1102320070 12:111925670-111925692 AAGGTTTGGGGGTTTGAAATGGG + Intergenic
1102390874 12:112547544-112547566 AGTGGCAGGGGCTCTGAACTTGG + Intergenic
1102810326 12:115818784-115818806 AAAGGTATGGGCTTTGGAATTGG + Intergenic
1103400490 12:120640442-120640464 GAGGGAAGGGGCTTGGCAATGGG - Intergenic
1103578133 12:121894067-121894089 CAGGGGAGGGGCTTTGCAATTGG - Intronic
1103739427 12:123081389-123081411 CTGGGCAGGGGCTGTAAAATTGG + Intronic
1104105949 12:125659426-125659448 TGGGGCAGGGGCTTTGTACTGGG + Exonic
1104231771 12:126891958-126891980 AAGGAGAGGGACTATGAAATGGG - Intergenic
1104841773 12:131829086-131829108 AAGGGCAGGGGCTACGGAGTGGG + Intronic
1106094224 13:26628746-26628768 CAGGGCTGGGGGTCTGAAATGGG - Intronic
1107149880 13:37098808-37098830 AAGGGCAAAGGCTCTGAAACAGG - Intergenic
1107166976 13:37293830-37293852 AGGGTCAGGGGCTTAGAATTAGG + Intergenic
1107429818 13:40330285-40330307 GAGGGCAGGGGCTGGAAAATTGG - Intergenic
1107561563 13:41561674-41561696 AAGGGCAAGGCCTTTGAAATTGG - Intergenic
1111484469 13:88878519-88878541 AAGGGTATGGACTTTGAGATGGG - Intergenic
1111690706 13:91559748-91559770 AGGAGCAGGGGCTTTGAAAATGG + Intronic
1113416847 13:110135302-110135324 AAACGCATGGGCTTTGAAACTGG - Intergenic
1114585986 14:23814232-23814254 AAGAACATGGGCTTTGGAATTGG - Intergenic
1118382317 14:65227522-65227544 AAGGGCAGGCCCTGAGAAATTGG - Intergenic
1118433679 14:65748946-65748968 AAGAACAAGGGGTTTGAAATCGG + Intergenic
1118816879 14:69320117-69320139 AAGAGCATGGGCTTTGGAGTCGG + Intronic
1121132176 14:91458464-91458486 CAGGGCAGGGGTTTTGTAAGTGG - Exonic
1121505846 14:94475852-94475874 AAGGGGAGGAGTATTGAAATAGG - Intronic
1123129808 14:105975825-105975847 AACAGCAGGGGCTTTTTAATAGG - Intergenic
1123579999 15:21706351-21706373 AACAGCAGGGGCTTTTTAATAGG - Intergenic
1123616647 15:22148973-22148995 AACAGCAGGGGCTTTTTAATAGG - Intergenic
1125812420 15:42552823-42552845 AAGAGCAGAGGCTCTCAAATGGG - Intronic
1128321345 15:66696855-66696877 AAGTGCAAGGGCCCTGAAATAGG - Intergenic
1128340885 15:66821791-66821813 AAGGCCAGGGGCTTTTACAGGGG + Intergenic
1129186064 15:73907409-73907431 ACGGGCATAGACTTTGAAATTGG + Intergenic
1129333797 15:74840752-74840774 ATGAGCAGAGGCTTGGAAATAGG - Intronic
1129504743 15:76071849-76071871 AGGGGGAGGAGCTTTGAACTGGG + Intronic
1131003511 15:88956982-88957004 CAGGGCAGGGACTTTGGACTGGG + Intergenic
1132114469 15:99125422-99125444 AAGGGCTGGGGCTCTGGACTCGG + Intronic
1202988869 15_KI270727v1_random:440596-440618 AACAGCAGGGGCTTTTTAATAGG - Intergenic
1133109212 16:3535773-3535795 AAGGACAGGGGCTTGGAGAGAGG - Intronic
1133540642 16:6749565-6749587 AAGAGAAGGAGCTTTGAAATCGG - Intronic
1135116046 16:19724248-19724270 GAAAGAAGGGGCTTTGAAATTGG - Intronic
1139333385 16:66211736-66211758 ATGGGAAGGGGCTTTGGAAAGGG + Intergenic
1139691383 16:68644232-68644254 AAACGCAGAGGTTTTGAAATTGG - Intronic
1140641929 16:76984899-76984921 AAGGGAAGGGGGTATGAAATTGG + Intergenic
1141033622 16:80610267-80610289 AAGGGCAGGTGCTTTTACACTGG - Intronic
1141781571 16:86165510-86165532 AATGGCAGGGGCTTTCAAGAGGG - Intergenic
1141910325 16:87054118-87054140 GAGGCCATGGGCTTTGGAATGGG - Intergenic
1142456819 17:61870-61892 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1143876174 17:9992280-9992302 AAGAGCCGCGGCTTTGACATGGG + Intronic
1145270453 17:21401904-21401926 AAGGGGTGGGGCTTGGAAAGGGG + Intronic
1145275486 17:21426879-21426901 AAAGGCAGGGGCTTTTGATTTGG - Intergenic
1145308663 17:21689301-21689323 AAGGGGTGGGGCTTGGAAAGGGG + Intergenic
1145313338 17:21712773-21712795 AAAGGCAGGGGCTTTTGATTTGG - Intergenic
1145879439 17:28342688-28342710 AAGGACTGGGTCTTTGAAGTTGG + Intronic
1147056139 17:37836576-37836598 AAGGGCTGCGGCTTTAAAAGGGG - Intergenic
1148019283 17:44542712-44542734 ACTTGCAGGGGCTATGAAATTGG - Intergenic
1148475277 17:47924606-47924628 CAGGGCACTGACTTTGAAATGGG + Intronic
1148679545 17:49465875-49465897 AAGGGCTGGGGCGGAGAAATGGG - Intronic
1149284286 17:55144778-55144800 AAGAGCATGGGCTTTGGACTTGG + Intronic
1149432656 17:56606715-56606737 AAAAGCAGGGACTTTGAAGTTGG + Intergenic
1149793104 17:59496184-59496206 AAGGGCTGGGGCTGTGGAAGAGG + Intergenic
1151206110 17:72508435-72508457 TAGAGCAGGGACTTTGGAATTGG - Intergenic
1152102874 17:78313265-78313287 AAGGGCAGGGGCTGTGTCACGGG - Intergenic
1152916310 17:83038103-83038125 AAGTGCTGGGTATTTGAAATGGG - Intronic
1155583026 18:27333161-27333183 AAAGCCAGGGGTTTTGAATTTGG + Intergenic
1155913567 18:31533618-31533640 AAAGGCAGAGTCTTAGAAATAGG - Intronic
1156505240 18:37586557-37586579 CAGGGCAAAGGGTTTGAAATAGG - Intergenic
1158121554 18:54054148-54054170 AAGGGGACAGGCTTTGAAGTTGG - Intergenic
1160173956 18:76578423-76578445 AGAGGCAGGGGCTGGGAAATTGG + Intergenic
1160304031 18:77714997-77715019 AAGCGCAGATGCTTTGAAGTGGG - Intergenic
1160646735 19:197229-197251 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1162022429 19:7873979-7874001 AGGGGCAGGGGCGTGGAGATCGG - Intronic
1164164933 19:22663398-22663420 AATGGCAGGGGCTTTTACACTGG - Intronic
1165138623 19:33686183-33686205 AAAGGCAGGGTCTTTGAAAGGGG + Intronic
1167452443 19:49580028-49580050 AAGGGAAGGGGCTGTCAAAAAGG + Intronic
1167647503 19:50713663-50713685 ATGGAAAGGGGCTTTGAACTGGG + Intronic
925293170 2:2761898-2761920 AGGGGCAGAGGCTTAGGAATAGG - Intergenic
925569893 2:5297959-5297981 AAGGGCAAGTGCTTTGAAAGGGG + Intergenic
926144110 2:10386460-10386482 CTGGGCAGGGGCTTTGATGTGGG + Intronic
927166797 2:20331176-20331198 AAGGGTAGGGGATGAGAAATGGG + Intronic
927716879 2:25358798-25358820 AAGGGCAGGGGCTTCGCATTGGG + Intergenic
928032227 2:27790455-27790477 AAGGGCAGAGGCTTTAAATTTGG - Intronic
928221546 2:29407536-29407558 AAGAGCAGTGGTTTTGAAGTTGG - Intronic
929768947 2:44875270-44875292 AAGAAGATGGGCTTTGAAATAGG + Intergenic
930016474 2:46974244-46974266 AAAAGCAGGGGCTTTTAAAGGGG + Intronic
930818560 2:55622673-55622695 AAACCCAGGGGATTTGAAATAGG - Intergenic
931140269 2:59449925-59449947 TATGGAAGTGGCTTTGAAATTGG + Intergenic
931464617 2:62475427-62475449 AAGGCCAGGGGGCTGGAAATGGG - Intergenic
932740645 2:74288338-74288360 GAGGGCAGGGGTTGTGAATTTGG - Intronic
932880411 2:75496001-75496023 AAGGGAATAGGCTTTGAAACTGG - Intronic
934179487 2:89607583-89607605 AAGTGCAAAGGCTTGGAAATGGG - Intergenic
934289779 2:91681851-91681873 AAGTGCAAAGGCTTGGAAATGGG - Intergenic
935365445 2:102284788-102284810 AATGTCTGGGGCTTTGAGATGGG - Intergenic
935447333 2:103170528-103170550 ATGGGCAGGGGCTATGATACTGG - Intergenic
936264543 2:110992675-110992697 AAAGGAAGTGGCTTTGAAAGGGG + Intronic
936625412 2:114143092-114143114 CAGGGCAGGAACTTTGAAACAGG - Intergenic
937895299 2:126973239-126973261 AAGGCAAGGGGCTTAGGAATGGG - Intergenic
938144408 2:128821754-128821776 AAGGGGAGGGACCTGGAAATGGG - Intergenic
939593441 2:144095069-144095091 AGGGGCTGGGGCTTTTAAAAAGG - Intronic
940687546 2:156872691-156872713 AAGAGCAGGGACACTGAAATAGG + Intergenic
941105894 2:161352395-161352417 CTGGGGAGGCGCTTTGAAATAGG + Intronic
941185309 2:162315022-162315044 ACGGGCAGGGGCTAGGAAATGGG + Intronic
941968010 2:171319313-171319335 AGGAGCAGAGGCTTTGAAAGAGG + Exonic
942499036 2:176568877-176568899 AAGGGGAGGGTGTTTAAAATAGG - Intergenic
944053318 2:195496075-195496097 AGGGGCAGAGGATTTGAAGTAGG - Intergenic
944201340 2:197110511-197110533 CAGAGCATGAGCTTTGAAATTGG - Intronic
945143233 2:206709634-206709656 TAGGGCAGTGGTTTTCAAATTGG - Intronic
945653034 2:212588694-212588716 ATTGGCAGTGGCTTTGATATAGG - Intergenic
945760238 2:213904713-213904735 AAGGGAAGGGGCCTTGTCATTGG + Intronic
946052695 2:216877372-216877394 AAGAGCAGGATGTTTGAAATTGG + Intergenic
948558472 2:238834765-238834787 CAGGGCAGGGGCTTTATAAGGGG + Intergenic
948967546 2:241395141-241395163 AAGGGCAGAGGCTTTGGAGTAGG - Intronic
1168838935 20:896483-896505 AAGTGCAGAGGCCTTGAAGTGGG + Intronic
1168889150 20:1282888-1282910 AAGAGCAGGGGCTTTGTCCTAGG - Intronic
1169008867 20:2233000-2233022 TAGGACAGTGGCTTTGTAATAGG + Intergenic
1169056552 20:2626686-2626708 AAGGTCAGTGTCTTGGAAATAGG - Intronic
1171448073 20:25218639-25218661 GAGGGCAGAGGCTGTGAAAGTGG - Intronic
1171854642 20:30333366-30333388 AAGGGGAGGGGCTTTGAGCAGGG - Intergenic
1173359271 20:42325905-42325927 GAGAGCAAGGGCCTTGAAATGGG - Intronic
1173574993 20:44107184-44107206 ATGGGTTGGGGCTTTGGAATTGG - Intergenic
1175780759 20:61680517-61680539 ATGGGCAGGGGCTCTAAAAATGG + Intronic
1176278770 20:64288997-64289019 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1176908784 21:14537211-14537233 AAGTGCAAAGGCCTTGAAATGGG - Intronic
1177034072 21:16019902-16019924 GAGGGAAGAGGCTTTAAAATTGG - Intergenic
1180121072 21:45748570-45748592 AAGGGCAGAGGCTGGGAAACAGG - Intronic
1181029377 22:20142565-20142587 AGGGGCAGGGGCTCTGCAACAGG - Intronic
1181365549 22:22374262-22374284 AAGGGCAGGGGCTGTGAGTTGGG + Intergenic
1181778147 22:25174601-25174623 GAGGGCACTGTCTTTGAAATGGG + Intronic
1182784912 22:32899361-32899383 CAGTGCAGTGGTTTTGAAATGGG + Intronic
1183273927 22:36879409-36879431 TAGGGCAAGGGCTCTGCAATAGG + Intergenic
1183436417 22:37798156-37798178 AAGGACAGGGGCTATGAGAGGGG + Intergenic
1183993789 22:41618031-41618053 AAGGGTAGTGACTTTGAAAGTGG - Intronic
1184109671 22:42387509-42387531 AGGGGCCGGGGCTTTGAACAGGG - Intronic
1184251429 22:43262575-43262597 AAGGGCAGGGCCTGTGGAAGGGG - Intronic
1184451307 22:44584346-44584368 TAGAGCAGGGGGTTGGAAATGGG - Intergenic
949451718 3:4192719-4192741 AAGGGTTGGGGCTTTGAGTTAGG + Intronic
949578424 3:5361576-5361598 AAAAGGAGGAGCTTTGAAATTGG + Intergenic
949719259 3:6969744-6969766 AAGGGCTGGGCCTTAGATATGGG - Intronic
951519957 3:23602191-23602213 GAGAGCATGGGCTTTGGAATCGG + Intergenic
953353541 3:42234281-42234303 CAGGGCAGGGGTTTTGAAAGAGG - Intergenic
953662200 3:44899472-44899494 AAGGGGAGGGCCTCTGAAGTGGG - Intronic
954648222 3:52144252-52144274 AAGGGCTGGGGCTTGGGGATGGG - Intronic
955558055 3:60159124-60159146 GAGGGGAGGGGGTTTGAAAGAGG + Intronic
956267810 3:67417338-67417360 AAGGCCAAGGGTTTTGAAATGGG + Intronic
958492226 3:94791511-94791533 AAGGGCAGTGACTCTGAAAAAGG + Intergenic
958700142 3:97578514-97578536 AACGACAGGGGTTTTGAAACTGG + Intronic
958965466 3:100553268-100553290 AGGGGAAGGGGCTTTGAATTTGG - Intronic
959510795 3:107209394-107209416 ATGGGCACGGGCTTTCACATGGG - Intergenic
959569687 3:107869473-107869495 CAGAGCAGGGGCCTTGAAGTGGG - Intergenic
960440924 3:117687514-117687536 AAAGGCAAGGGATTTGAAATAGG - Intergenic
960942395 3:122943384-122943406 AAGTGCAGGGGCTTGGAGCTGGG - Intronic
960948923 3:122986250-122986272 AAGGACAGGTGCTTTGATAATGG + Intronic
962370290 3:134815868-134815890 AGGGGCAGGGGCTGTGGCATGGG - Intronic
962407204 3:135110464-135110486 AGGGGCAGGGGTTTTGAGTTTGG + Intronic
962856236 3:139347656-139347678 AAGAGAATGGGCTTTGAAGTTGG + Intronic
962857158 3:139358077-139358099 CAGAGCAGGGGCTTTGAAATGGG - Intronic
967321299 3:188197754-188197776 AAGGGCAGGGCTTATGACATTGG + Intronic
968370946 3:198222293-198222315 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
969090394 4:4689743-4689765 AAGGGCAGGGGCTTACACAACGG - Intergenic
969141038 4:5072109-5072131 TAGGGCAGAGGTTTTCAAATAGG + Intronic
969197308 4:5573250-5573272 AAGGTCAGGGGCCTTGAGATAGG + Intronic
969829794 4:9786035-9786057 AAGTGCAAAGGCTTGGAAATGGG + Intronic
969997170 4:11324812-11324834 AAGGACAGGAGATTTGAAAGGGG + Intergenic
972407032 4:38756718-38756740 GAGGGTAGAGGCTTCGAAATAGG + Intergenic
973975548 4:56259137-56259159 AAAAGCAGGGGCTTTTAAAGTGG + Intronic
974481328 4:62447517-62447539 AATGGTAGTGGCTTTGAAACTGG + Intergenic
974794158 4:66727416-66727438 AAAGGCATGGGCTTTGGAATTGG - Intergenic
974839985 4:67288387-67288409 AAGGGCAAAGGCCTTGAGATAGG - Intergenic
975317584 4:72972489-72972511 AAGGGGGTGGGCTTTGAAAGGGG + Intergenic
975639938 4:76490372-76490394 AAAGGCAGGGGGTTTGCAAAGGG + Intronic
976890807 4:90045219-90045241 AAGGGCAGAAGGTTTGAGATTGG - Intergenic
977232596 4:94469448-94469470 AAGTGCAGGGGCCTTGAGACAGG + Intronic
977555943 4:98487468-98487490 AATGCCAAGGGCTTTGCAATAGG - Intronic
978318472 4:107466262-107466284 AGGGGCAAGGGCTATGAATTAGG + Intergenic
978431553 4:108638417-108638439 AAAAGCATGGGCTTTGAAATTGG + Intergenic
979259632 4:118634781-118634803 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
979328741 4:119405843-119405865 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
981028222 4:140097512-140097534 AAAAGATGGGGCTTTGAAATGGG + Intronic
981981452 4:150797286-150797308 AAGGTCAAAGGTTTTGAAATGGG + Intronic
982001052 4:151021470-151021492 AAGGGTAGAGACTTTGAAAAGGG + Intergenic
982437680 4:155397525-155397547 ACGGGCATGGGTTTTGAAAGTGG + Intergenic
982540113 4:156658294-156658316 AATGGCAAGGGCTTGGAAATTGG - Intergenic
983266201 4:165510756-165510778 AAGGTCATGGGCTTTGGAGTGGG + Intergenic
983874523 4:172861374-172861396 CAGGGTAGATGCTTTGAAATGGG - Intronic
985014286 4:185617105-185617127 AATGGCAGGGGATGTGAAGTAGG - Intronic
985790843 5:1926260-1926282 AGGGGCAGGGGCTGTGGCATTGG - Intergenic
987361818 5:17114127-17114149 AAAGGAAGGGACTTTGGAATGGG - Intronic
987830314 5:23087044-23087066 AAGGGCATGGTCTTTCTAATGGG + Intergenic
988908704 5:35817438-35817460 AAGAGCATGGGCTTTGGCATTGG - Intergenic
990485232 5:56251553-56251575 AAGCCCAGGGGCTTGGAAAGGGG + Intergenic
991027434 5:62045325-62045347 GTGGGCAGGGGCTTAGGAATGGG + Intergenic
991389076 5:66123077-66123099 AAGAGCAGGAGGTTTGATATAGG + Intergenic
992428649 5:76685657-76685679 AAGGGCAGAGGCTGGGTAATGGG - Intronic
993876935 5:93318578-93318600 AAGAGCAGAGGCTCTTAAATGGG - Intergenic
994774420 5:104025434-104025456 AACGGCAGGGGCCTAGAGATAGG - Intergenic
995131533 5:108635868-108635890 AGTGGCAGGGGCTTCCAAATGGG + Intergenic
995231298 5:109767239-109767261 AATGGCAGTGGCTTTATAATAGG + Intronic
995714424 5:115068290-115068312 AAGGGCATAGGTTTTGAAGTTGG - Intergenic
996644331 5:125795952-125795974 AAGGCCAGGGCCTTAGAACTAGG + Intergenic
999174381 5:149621667-149621689 AAGGGCAGGGGCTGTGAGAAGGG - Intronic
999199492 5:149805862-149805884 ATGGCCCTGGGCTTTGAAATGGG - Intronic
999306881 5:150525339-150525361 CAGGGTCGGGACTTTGAAATGGG + Intronic
999373763 5:151072265-151072287 AAAGGCAGGGGCTAGGAACTTGG - Intronic
1000001837 5:157145978-157146000 AAGAGCAGGGGAGATGAAATGGG + Intronic
1000383359 5:160648801-160648823 AAGAACAGGGACTTTGGAATTGG - Intronic
1001654450 5:173338745-173338767 AAGGGTAGGGGCTTGGAGCTAGG + Intergenic
1002730183 5:181327849-181327871 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1002754349 6:146250-146272 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1003076574 6:2988372-2988394 AGGGGCAGTGGCCTTCAAATTGG + Intronic
1003123936 6:3340156-3340178 AAGGGCAGGGGCTTTGAAATTGG + Intronic
1003361434 6:5429842-5429864 AAGAGCAGGGGTTTTGGAGTTGG + Intronic
1004024609 6:11806572-11806594 AGGGTGAGGGGCTTTGAAGTGGG - Intronic
1005489247 6:26331806-26331828 AAGGTCAGTCGCTTTGGAATGGG + Intergenic
1006267326 6:32936168-32936190 AAGTGCAGGGGCTGTGGAGTGGG - Intronic
1006304256 6:33209403-33209425 AAGAGTAGGAGCTTTGGAATAGG - Intronic
1006458958 6:34146911-34146933 AAGGGCAGGAGCATGGAAAAGGG - Intronic
1006691911 6:35895685-35895707 AAGGTATGGGGCTCTGAAATGGG - Intronic
1006912081 6:37570079-37570101 AGGAGCAGGGGCTGTGGAATGGG - Intergenic
1007119499 6:39368415-39368437 AAGAGCACCAGCTTTGAAATCGG - Intronic
1009614311 6:65985646-65985668 ATGTTCAGGGGCTTTGAACTGGG - Intergenic
1010389107 6:75316933-75316955 AAGGGCAAGGAATTTGAAAATGG - Intronic
1010950532 6:82031765-82031787 AAGGGCACCAGCTTTGAAATAGG + Intergenic
1011908819 6:92409433-92409455 AAGGCCAGGGGCATTGCAAAGGG - Intergenic
1013805445 6:113991508-113991530 AAGGAGATGGCCTTTGAAATGGG + Intronic
1014241986 6:119027988-119028010 AAGGGCAGGACATTTGAAGTGGG - Intronic
1015192469 6:130486720-130486742 GAGGGAAGGGGCTTTCAAAAGGG + Intergenic
1015336604 6:132046481-132046503 AAGGGCAGGGGCTGTGGAAAAGG - Intergenic
1016937026 6:149455148-149455170 AAGGGCTGGGGCTTTGGAGAGGG - Intronic
1017956680 6:159184138-159184160 CAGTGCACAGGCTTTGAAATGGG + Intronic
1018719932 6:166564864-166564886 AAGCACAGGGCCCTTGAAATGGG - Intronic
1020527463 7:9280789-9280811 AAGGGCAAGGCCCTTGAAATTGG + Intergenic
1022974741 7:35546823-35546845 AGGGGCAGGGGCTTTAACAGTGG - Intergenic
1023401355 7:39794399-39794421 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1024197162 7:47070656-47070678 AAGAGCAACGGCTTTGAAATGGG - Intergenic
1024648258 7:51386280-51386302 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1024648786 7:51388353-51388375 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1025052111 7:55740749-55740771 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1025129070 7:56366432-56366454 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1025177458 7:56809321-56809343 AAAGGCAGGAGCTTTGGACTGGG + Intergenic
1025694334 7:63767067-63767089 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1027531259 7:79336316-79336338 AAGAGCTTGGGCTTTGAAGTTGG - Intronic
1028166233 7:87541073-87541095 AAAGGCAGGGACTTCAAAATGGG - Intronic
1028601291 7:92603140-92603162 AAGAGAAGGGGCTGTGAAAAAGG - Intergenic
1029482067 7:100819468-100819490 AGAGGCAGGGGCTGTGAAGTTGG - Intronic
1030545850 7:110894155-110894177 GAAGGCAGGGGCTTTTAAAGGGG - Intronic
1031311291 7:120200798-120200820 AAGATCAGGGGCTATGAAAGTGG - Intergenic
1031704509 7:124963513-124963535 ATGTGAAGGGGCTTTGAACTGGG + Intergenic
1032610371 7:133406235-133406257 AATGGCATGGGATTTGGAATTGG - Intronic
1034470140 7:151250480-151250502 GGGGGCAGGGGCTAAGAAATGGG - Intronic
1037419887 8:18690797-18690819 AAGGGAAGGGGCTCTGAAGCTGG - Intronic
1037455635 8:19060844-19060866 AAGGGCACGAGCTTTAAAACTGG + Intronic
1037499227 8:19469589-19469611 AAGGGCAGAGGTTCTGAAGTGGG - Intronic
1037633589 8:20679965-20679987 AAGAGAAGGGGCTTAGAAATAGG + Intergenic
1038165045 8:25077722-25077744 ATGGGTAGGGGCTTGGAAAGTGG + Intergenic
1038395873 8:27244995-27245017 AAAGGCAAGGGGTTTGAAGTGGG - Intronic
1038510069 8:28125437-28125459 AAGGACAGAGGTTTTGAAAGAGG + Intronic
1038516414 8:28191294-28191316 AATGGCAGTGGCTTTGTTATGGG + Intergenic
1039050505 8:33488336-33488358 TGGGGCAGAGGATTTGAAATGGG + Intronic
1039305321 8:36255616-36255638 GTGGGCAGGGGCTAGGAAATGGG - Intergenic
1039364412 8:36915303-36915325 AAGGGTATGGGCTTTGAAGTTGG + Intronic
1039396098 8:37226515-37226537 AAGAGCAGAGGCTTAGATATCGG + Intergenic
1039607971 8:38898661-38898683 AAGGGAGTGGGCTTTGAAATGGG - Intergenic
1040858738 8:51977227-51977249 AAAGGTATGGGTTTTGAAATTGG + Intergenic
1041042028 8:53856774-53856796 AAGGGCATTGACTTTGGAATGGG - Intronic
1041180810 8:55246105-55246127 AAAGGCAGAGGCTATGAAAGGGG - Intronic
1041756194 8:61315586-61315608 AAGGGCAGGGACATTGACAAGGG + Intronic
1042020118 8:64363897-64363919 AAGGGCAAGGGCTTTCACAAAGG + Intergenic
1042584768 8:70323955-70323977 AAGGGCTGGGCCTGGGAAATGGG - Intronic
1043057087 8:75452795-75452817 AAGAGCATAGGCTTTAAAATAGG - Intronic
1043576736 8:81667506-81667528 AACAGAAGCGGCTTTGAAATGGG + Intronic
1045692139 8:104770788-104770810 GTGGGCAGGGGCTAGGAAATGGG + Intronic
1046012151 8:108562150-108562172 AAGGACAGAAGATTTGAAATTGG - Intergenic
1046023566 8:108695625-108695647 TAGGGCATGGGCTTTGTAATGGG - Intronic
1047406636 8:124590808-124590830 AAGAAGAGGGGCTGTGAAATTGG - Intronic
1047597579 8:126394488-126394510 AGGCCCAGGGGCTGTGAAATCGG + Intergenic
1048088740 8:131214585-131214607 AAGGTGAGGGGCTATGTAATGGG + Intergenic
1048260781 8:132943504-132943526 GAGGGCAGGGGCATTGTACTTGG - Intronic
1048294018 8:133201017-133201039 AAGGGCATGGGGTTGGGAATAGG - Intronic
1048650249 8:136468145-136468167 AAAGGCATGGGCTTTGGAACCGG - Intergenic
1051054908 9:12973379-12973401 AATGGCTGTGGCTTTGAAGTTGG + Intergenic
1051224870 9:14888299-14888321 AAGGGCAAGGGTTTTGGAGTTGG - Intronic
1051555409 9:18377130-18377152 AAGACCATGGGCTCTGAAATTGG + Intergenic
1052500947 9:29289272-29289294 TAGGTCAGTGGCTCTGAAATGGG - Intergenic
1052823832 9:33161164-33161186 AAGGCCAGGGGCTATATAATTGG - Intronic
1053266166 9:36715004-36715026 AAGGGCTGGGGCAGTGAATTGGG + Intergenic
1053419630 9:37969241-37969263 TAGGGCAGGGGCTCTGGAGTTGG + Intronic
1053792463 9:41696646-41696668 AAGGGGAGGGGCTTTGAGCAGGG - Intergenic
1054152709 9:61618174-61618196 AAGGGGAGGGGCTTTGAGCAGGG + Intergenic
1054180873 9:61908666-61908688 AAGGGGAGGGGCTTTGAGCAGGG - Intergenic
1054656718 9:67672476-67672498 AAGGGGAGGGGCTTTGAGCAGGG + Intergenic
1054714936 9:68547610-68547632 ATGGGCAGGGACTTGTAAATAGG + Intergenic
1054813345 9:69452060-69452082 CTGGGCAGGGGCTTGGAAAGTGG - Intronic
1054924976 9:70579966-70579988 CAGGGAAGGGGCGTTGAAATGGG - Intronic
1055401929 9:75933135-75933157 AAGTGGAGCAGCTTTGAAATGGG + Intronic
1055932586 9:81574732-81574754 AAGGGCACAGGCTTTGGCATAGG + Intergenic
1056108636 9:83372643-83372665 CTGAGCAGGGGCTTTGGAATTGG - Intronic
1056215234 9:84400217-84400239 ATGAGCAGGGGCTTGGGAATGGG - Intergenic
1057533302 9:95874537-95874559 AAGGGCAGAGACCTGGAAATGGG + Intergenic
1058300268 9:103362895-103362917 AAGGTCATGGACTTTAAAATGGG + Intergenic
1058335953 9:103829117-103829139 AAGGGCATGGACCTTGAGATTGG - Intergenic
1058457112 9:105147866-105147888 AAGAGCATGGGCTTTGGAGTCGG - Intergenic
1058627250 9:106947752-106947774 AAGGGCACAGGCTCTGGAATTGG - Intronic
1058907456 9:109493530-109493552 TAGGACAGAGGATTTGAAATTGG - Intronic
1060676174 9:125517121-125517143 AAGAGCACAGGCTTTGGAATTGG - Intronic
1062443421 9:136583589-136583611 AAAGGCAGGGGCTGGGCAATGGG - Intergenic
1062754595 9:138280363-138280385 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1203578501 Un_KI270745v1:24523-24545 AAAGGCAGGAGCTTTGGACTGGG - Intergenic
1185774875 X:2794170-2794192 AAGGGCAGGGGATTTGGAGATGG + Intronic
1186173589 X:6902586-6902608 GAGGGCAGGGGCTTTTAAAGAGG + Intergenic
1186491866 X:9980030-9980052 AAGGGCTGCTGCTGTGAAATGGG - Intergenic
1186753669 X:12647676-12647698 AAGGGCAAGGGCTCAGAAAATGG - Intronic
1186993795 X:15097892-15097914 AAGGGCCTGGTCTTTGAAGTTGG - Intergenic
1188424526 X:30031232-30031254 AAGGGGGGGGGCTTCGATATTGG - Intergenic
1188735994 X:33716949-33716971 AAGGGAAGGGTATTTCAAATAGG + Intergenic
1189790205 X:44596552-44596574 AAGGTCATGGACTTTGAGATGGG - Intergenic
1190264845 X:48822139-48822161 CAGGGCAGGGGCTTTTGTATGGG + Intronic
1190381317 X:49841986-49842008 AAGGGTTGGGGCTTTGGGATGGG - Intergenic
1190473331 X:50804548-50804570 AAGAGCATGGGATTTGAAGTTGG + Intronic
1190915295 X:54807800-54807822 AAGGTGAGGGGCGTTGATATTGG + Exonic
1193901843 X:87189274-87189296 AAGGAAAGGTGCTTTGAAAAGGG - Intergenic
1193921045 X:87426345-87426367 AAAGGCATGGGGTTTGAAAAGGG - Intergenic
1193992802 X:88329073-88329095 TAAGGCAGGGACTCTGAAATTGG + Intergenic
1193995737 X:88364623-88364645 AATGGCATGGGCTATGAATTGGG + Intergenic
1193996406 X:88370332-88370354 AATGTCAGGTGCTTTGGAATGGG - Intergenic
1194983163 X:100461030-100461052 AAGGAAAAGGGATTTGAAATGGG - Intergenic
1195164828 X:102208988-102209010 GAGGGCAGGGGCTGTGCATTTGG - Intergenic
1195194030 X:102478103-102478125 GAGGGCAGGGGCTGTGCATTTGG + Intergenic
1195285664 X:103380653-103380675 TTTGGCAGGGGCTTTGAAAGAGG - Intergenic
1195289120 X:103414485-103414507 TAGCGCAGGGGCTATGACATGGG + Intergenic
1196871657 X:120118134-120118156 GAAGGCAGGAGCTTTGAAAGTGG + Intergenic
1198802322 X:140460405-140460427 CAGGGCAAAGGCCTTGAAATAGG + Intergenic
1198805373 X:140488952-140488974 AAGAGCACAGGCTTTGCAATTGG - Intergenic
1199116749 X:144001236-144001258 CATGGAACGGGCTTTGAAATTGG - Intergenic
1199116755 X:144001280-144001302 AGTGGAACGGGCTTTGAAATTGG - Intergenic
1200064883 X:153499590-153499612 AACGGCAGGGGCTTGGAATGTGG + Intronic