ID: 1003127988

View in Genome Browser
Species Human (GRCh38)
Location 6:3371284-3371306
Sequence CTCTAGCAGCAGATGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003127988_1003127992 19 Left 1003127988 6:3371284-3371306 CCACATGGCATCTGCTGCTAGAG 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1003127992 6:3371326-3371348 AATATAAGTGAAGGGTTGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 246
1003127988_1003127993 20 Left 1003127988 6:3371284-3371306 CCACATGGCATCTGCTGCTAGAG 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1003127993 6:3371327-3371349 ATATAAGTGAAGGGTTGCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 208
1003127988_1003127989 10 Left 1003127988 6:3371284-3371306 CCACATGGCATCTGCTGCTAGAG 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1003127989 6:3371317-3371339 ACCATAGAAAATATAAGTGAAGG No data
1003127988_1003127991 11 Left 1003127988 6:3371284-3371306 CCACATGGCATCTGCTGCTAGAG 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1003127991 6:3371318-3371340 CCATAGAAAATATAAGTGAAGGG 0: 1
1: 0
2: 2
3: 27
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003127988 Original CRISPR CTCTAGCAGCAGATGCCATG TGG (reversed) Intronic
901683983 1:10933525-10933547 ATCTAGCAGAAGTTGCCATGAGG + Intergenic
903007377 1:20307617-20307639 ATCTAGCAGCAGAGGAAATGTGG - Intronic
903444252 1:23411003-23411025 CTCTAGCAACAAATGAGATGTGG + Intronic
908224485 1:62042203-62042225 CTCTAACAGCATATGCTATGCGG + Intronic
909641672 1:77874970-77874992 ATCTTGAAGCAGATGCCCTGAGG + Exonic
910483810 1:87687854-87687876 ATCTATCTGCAGATGCCACGTGG - Intergenic
912901179 1:113651139-113651161 TTCGAGCAGCAGTTGTCATGAGG - Exonic
915056401 1:153134780-153134802 CTCCAGCAGCAGATTCCATTGGG + Intergenic
915328119 1:155091825-155091847 CCCTAGTTGTAGATGCCATGGGG + Intergenic
917720715 1:177784207-177784229 CTCTAGCTCCAGATGTCATGGGG - Intergenic
919927422 1:202199477-202199499 CTCTGGCAGCAGCGGGCATGGGG + Intronic
921258773 1:213366701-213366723 CTCTAGACCCAGATGCCAGGTGG - Intergenic
923146425 1:231201969-231201991 GGCCAGCAGTAGATGCCATGCGG + Intronic
1063097968 10:2924851-2924873 CTCTATCAGAAGCTGCCATCTGG - Intergenic
1063890524 10:10623545-10623567 CTGCAGCAGGAGCTGCCATGGGG + Intergenic
1067059810 10:43072466-43072488 CTGTAGGAGCTGAGGCCATGAGG - Intergenic
1067736164 10:48852626-48852648 CTCTAGAAACGGAAGCCATGAGG + Intronic
1070413630 10:76168420-76168442 CTCTGGAAACAGAAGCCATGAGG - Intronic
1071137167 10:82466275-82466297 CTCTAGAAGCAGATTCCACCAGG + Intronic
1071467195 10:85951836-85951858 CTCCAGCAGCATTGGCCATGGGG - Intronic
1074276170 10:112004610-112004632 AGATAGCGGCAGATGCCATGAGG - Intergenic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1076451430 10:130559715-130559737 CTCTGCCAGCAGATGCCCTTTGG + Intergenic
1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG + Intronic
1077452814 11:2661100-2661122 TCCGAGCAGCAGATGCCAGGTGG - Intronic
1078582692 11:12551058-12551080 CCCTGGCAGCAGATTCCATCAGG - Intergenic
1079091797 11:17485922-17485944 CTATAGGAGCAGAAGCTATGTGG - Intergenic
1079858093 11:25631091-25631113 CTCAAGCATCATATTCCATGAGG - Intergenic
1080278896 11:30533534-30533556 TTCTAGCAGCAGCTGCCAGGTGG - Intronic
1080403677 11:31959554-31959576 CCCTAGCAGCAGATGGGCTGGGG - Intronic
1081212541 11:40354601-40354623 CTGGAGCAGCAGTGGCCATGAGG - Intronic
1084217069 11:67653776-67653798 CTCCAGTGGCAGAAGCCATGCGG + Intergenic
1085205723 11:74730987-74731009 CTCTAGCAGCAGACCTCCTGGGG - Exonic
1090232675 11:125119870-125119892 CTGTATCAGCAGATGTCTTGAGG + Intergenic
1090560221 11:127924517-127924539 TTCTAGAAGCAGGTGCCTTGTGG + Intergenic
1092995183 12:13943008-13943030 CTTTAGCAGCAGGTGGTATGGGG + Intronic
1093998701 12:25671205-25671227 CTAGAGCTGCAGATGCCCTGTGG + Intergenic
1097735633 12:63178175-63178197 CTATAGGATTAGATGCCATGTGG + Intergenic
1097908654 12:64946359-64946381 GTCCAGCAGTAGATGCCAGGAGG - Intergenic
1102498991 12:113338384-113338406 CTCAAGCAGCAGATGACCTGGGG - Intronic
1102611130 12:114113393-114113415 CTCTAGAGGCACATGCCATGTGG + Intergenic
1102907502 12:116688077-116688099 CCCTAGGAGCAGAGGCCACGCGG - Intergenic
1105024983 12:132842193-132842215 CCCTGTCAGCAGATGCCACGGGG - Intronic
1108016818 13:46085440-46085462 CACTAGAAGCTGAGGCCATGTGG + Intronic
1108071467 13:46633595-46633617 CTCCAGCAGCTGCTACCATGAGG - Intronic
1108076549 13:46686069-46686091 CTATAACAGCACATCCCATGGGG - Intronic
1108685118 13:52812887-52812909 CACCAGCAGCATAAGCCATGGGG - Intergenic
1108829761 13:54462970-54462992 GGCTAGCAGGAGATGCCACGAGG + Intergenic
1110041111 13:70760676-70760698 ACCTAGCAGCAGATGCAAGGAGG + Intergenic
1110291560 13:73813622-73813644 CTCTGGCAGCAGAAGCAAGGAGG - Intronic
1111507598 13:89214611-89214633 CTCTCACAGCAGAGACCATGTGG - Intergenic
1111730423 13:92069513-92069535 CTCTATATGGAGATGCCATGAGG - Intronic
1113431696 13:110256143-110256165 CTCTAGCCGGAGATTTCATGGGG - Intronic
1113591731 13:111506260-111506282 CCCAGGCAGCAGATGCCCTGAGG - Intergenic
1113636065 13:111919943-111919965 CTCTAGCGGCAGATGAGACGGGG - Intergenic
1118814819 14:69303331-69303353 CCCAAGCAGCAGATGCTATTGGG - Intronic
1121735179 14:96213424-96213446 CTCCAGCATCAGGAGCCATGTGG + Intronic
1121740722 14:96250491-96250513 ATCTAGCAGCAAGTGCCATATGG - Intronic
1123669040 15:22636163-22636185 CTCTATATGGAGATGCCATGAGG - Intergenic
1124525009 15:30442643-30442665 CTCTATATGGAGATGCCATGAGG - Intergenic
1124773644 15:32565070-32565092 CTCTATATGGAGATGCCATGAGG + Intergenic
1128454094 15:67823125-67823147 CTCTAGCTGGAGAGGCCAGGAGG - Intronic
1129544002 15:76375530-76375552 CTAGAGCAGCAGACTCCATGTGG + Intronic
1133738016 16:8630323-8630345 CCCTATCTGCAGAGGCCATGAGG - Intronic
1135330560 16:21556519-21556541 CTGAAGCAGCAGATCCCCTGAGG - Intergenic
1137609891 16:49811206-49811228 CGCTATCAGCAGAGGCAATGAGG + Intronic
1138273514 16:55713291-55713313 CTCTAGCACCACCTGCTATGGGG - Intergenic
1138460867 16:57146881-57146903 CCCTAGCAGCAGGGTCCATGAGG + Intronic
1139026827 16:62828407-62828429 CTCTTGCAGCAGACCCCAGGAGG - Intergenic
1140036032 16:71371980-71372002 CTCTAGGTGCAAATGCCCTGAGG + Intronic
1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG + Intronic
1149481045 17:57003347-57003369 TTCTAGCAGTAGAGGGCATGGGG + Intronic
1149775075 17:59350947-59350969 CTCTAGCAGCATTTGGCCTGGGG + Intronic
1151303924 17:73250805-73250827 GTCTAGCAGGAGATGCCAACAGG + Intronic
1151562757 17:74879448-74879470 CTCGATCATCAGCTGCCATGTGG - Exonic
1152037208 17:77880750-77880772 CTCTAGCAGCACCTGCCCTGTGG - Intergenic
1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG + Intergenic
1152263227 17:79278411-79278433 CTCTGGGAGCAGGTGCCATGTGG - Intronic
1152385498 17:79971851-79971873 CTCTCGGAGCAGGTGGCATGGGG + Intronic
1152451769 17:80386102-80386124 CTCTATCAGCATATGAGATGGGG + Intronic
1153228334 18:2914290-2914312 CTCCAGCTGCAGATGACATGGGG - Exonic
1154198150 18:12280953-12280975 CTCCAGCAGCAGAGGCCATGGGG + Intergenic
1154251281 18:12747146-12747168 TTCTAGCAGCACAGGCCACGGGG - Intergenic
1154411603 18:14144934-14144956 CTCACCCAGCAGATGCCATGTGG - Intergenic
1155356599 18:24959602-24959624 CTAAAGCAGCAGGTGCCATGAGG - Intergenic
1156648956 18:39201596-39201618 CTCAAGCAGCAGAACACATGCGG - Intergenic
1157007815 18:43606921-43606943 TTCTAGCAGCAGCTGCAGTGTGG + Intergenic
1160523894 18:79524436-79524458 CTCTGTCAGCTGCTGCCATGGGG + Intronic
1161566393 19:5005180-5005202 CTGTAGCCTCAGATGTCATGGGG - Intronic
1162460803 19:10812876-10812898 CTCTAGGAGCTGGTCCCATGGGG - Intronic
1164534626 19:29076050-29076072 CTCTGGCAGCAGCTGGCCTGTGG + Intergenic
1164846329 19:31436244-31436266 TTCTGGCTTCAGATGCCATGGGG - Intergenic
1166445632 19:42855614-42855636 CACAAGCAGCAGAGACCATGGGG - Intronic
1166485059 19:43205531-43205553 CACAAGCAGCAGAGACCATGGGG - Exonic
1167711357 19:51113316-51113338 GACTAGGAGCAGAGGCCATGGGG - Intergenic
925276438 2:2651531-2651553 TTGCAGCAGCAGGTGCCATGAGG + Intergenic
925841780 2:7998808-7998830 TACTAGCAGCAGATGTCATCAGG + Intergenic
926307161 2:11646672-11646694 CGCAAGCAGCAGACACCATGTGG + Intergenic
927895443 2:26778634-26778656 CTGTGGCAGCAGCTGCCCTGGGG - Exonic
928115381 2:28542328-28542350 CTCTAACAGCACATTTCATGGGG - Intronic
928647172 2:33366785-33366807 CCCTGGAAGCAGATGCCACGGGG + Intronic
929368867 2:41196644-41196666 CCTCAGAAGCAGATGCCATGAGG - Intergenic
929997308 2:46836696-46836718 CTGTAGCAGCGGAGGCCAAGTGG - Intronic
930889888 2:56372522-56372544 CTCTAGCAACAGAAGTCATCTGG - Intronic
932137858 2:69246235-69246257 CTCTAGCTGCTGATGGCCTGTGG - Exonic
936256940 2:110924363-110924385 CTGTAGCATCTGATGCCATTTGG + Intronic
937809571 2:126184560-126184582 CTCTAACAGGAGATGAGATGTGG + Intergenic
938369695 2:130761501-130761523 CTCTATCTACAGATGCCATCAGG - Intronic
938607520 2:132911077-132911099 CTCTAGCAACAAATGAGATGTGG - Intronic
939830956 2:147070002-147070024 GTGTAGCAACAGATACCATGTGG + Intergenic
949022579 2:241749813-241749835 CACCAGCATCAGATGCCAGGAGG - Intronic
1174878917 20:54255833-54255855 CATTAGAAGCAGATGCCATGAGG - Intergenic
1175171087 20:57082032-57082054 CTCTGCCAGCAGCTGCCAGGAGG + Intergenic
1175234280 20:57499106-57499128 CTATAGCAGCTGATGCCAGCTGG - Intronic
1176091324 20:63319820-63319842 CTCCTGCAGCAGGTGCCATTTGG + Intronic
1179896989 21:44368765-44368787 CACCAGCAGCAGATGGCAGGTGG + Intronic
1182024219 22:27105104-27105126 TTCTAGCATGAGATACCATGTGG - Intergenic
1184451532 22:44585635-44585657 CTCCAGCAGCAGGAGCCAGGGGG + Intergenic
1184852035 22:47126517-47126539 CTCAGGGAGCAGATGACATGTGG - Intronic
1185254008 22:49821947-49821969 CACTTGCTGCAGATGCCCTGAGG - Intronic
949397945 3:3635009-3635031 CTCTGGAAGCAGATGCCAGATGG - Intergenic
950137419 3:10591414-10591436 CTCTGGCCTCAGAGGCCATGGGG - Intronic
953508682 3:43512523-43512545 CGCTAGCAGTAGAGGTCATGAGG + Intronic
953668040 3:44940125-44940147 CTCTGGCACCATCTGCCATGAGG + Intronic
955060543 3:55488653-55488675 CTCTTTCAGCAGATGCCGCGGGG - Intronic
956518962 3:70082777-70082799 CTATAGCAGCATTTGCCATTGGG - Intergenic
956695795 3:71918377-71918399 CTCTACCAGTAGATGCCAAGAGG + Intergenic
957004324 3:74926661-74926683 CTCTAGAATCAGATGAAATGAGG + Intergenic
957436901 3:80188964-80188986 CTTTAGCAGCTGATCCCATTTGG - Intergenic
960952748 3:123010207-123010229 CACCAACAGCAGAGGCCATGTGG + Intronic
961755769 3:129126552-129126574 TTCTAGCAGCAGATGGGGTGAGG - Intronic
967237183 3:187396860-187396882 CCCTAGCATGAGATGCCATGTGG + Intergenic
968198801 3:196734098-196734120 CTCAAGCATCAGATGCCATAAGG + Intronic
968282190 3:197485367-197485389 CTGGAACAGCAGATGCCTTGGGG + Intergenic
968964085 4:3760711-3760733 CCCTAGCAGGAGAAGCCAGGTGG + Intergenic
969242315 4:5907891-5907913 CTCTATGAGAAGGTGCCATGAGG + Intronic
970540864 4:17077458-17077480 CTCTAGAAGCAGATGCTGGGAGG - Intergenic
971420729 4:26471894-26471916 CTCTAGCAGAATAGCCCATGTGG + Intergenic
976709394 4:88053053-88053075 CTCAGGCAGCAGCTGCCATTCGG + Intronic
980330728 4:131408224-131408246 CTCTAGCAGGGCATGCGATGGGG + Intergenic
982303250 4:153901471-153901493 CTCTTGCAGGAGATGCTATGTGG + Intergenic
983855015 4:172633073-172633095 CCCTAGCAGAAGCTCCCATGAGG - Intronic
987246472 5:16054195-16054217 CTGGTGCAGCAGATGCAATGAGG + Intergenic
990112862 5:52349526-52349548 CTTTAGCTGATGATGCCATGGGG - Intergenic
993339704 5:86708369-86708391 CTCTGGCACCAGATGACATAAGG + Intergenic
996463668 5:123774890-123774912 CCCCAGCAGCAGAAACCATGGGG + Intergenic
999294195 5:150448016-150448038 ATCTAGCAGCAGATGCCTGAAGG + Intronic
999708085 5:154292279-154292301 CTCTAGAAGCAGAAGCTCTGGGG - Intronic
1003127988 6:3371284-3371306 CTCTAGCAGCAGATGCCATGTGG - Intronic
1006415424 6:33900871-33900893 CTGTTGCTGCAGATGCCACGAGG + Intergenic
1008110957 6:47494234-47494256 CTCTAGCTGTAGGTGCCAGGGGG + Intronic
1009807136 6:68614344-68614366 CTCTAGATGCATATGCCATGTGG - Intergenic
1010784473 6:79984419-79984441 CAACAGCAGCAGAGGCCATGAGG - Intergenic
1011002985 6:82611968-82611990 CTCTAAGAACAGATGACATGAGG - Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1012556321 6:100517055-100517077 TACCAGCAGCAGATGGCATGGGG - Intronic
1013517591 6:110902322-110902344 CTCTGGCCCCAGATGCCATTTGG - Intergenic
1018060860 6:160088559-160088581 CCCTGGCACCAGATGCAATGTGG - Intronic
1018203881 6:161418765-161418787 CTCTAGAAGCAAATACTATGTGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1023164512 7:37330063-37330085 CTCTCCCATCAGAAGCCATGTGG - Intronic
1025941079 7:66076466-66076488 CTCTAGCAGGAGAAGGGATGTGG - Intronic
1026859814 7:73778494-73778516 CTCTAGCATCAGAAGAGATGAGG + Intergenic
1030026208 7:105327123-105327145 ATTTAGCAGCATATTCCATGAGG + Intronic
1031721801 7:125186593-125186615 ATCTACCGGCAGAGGCCATGTGG + Intergenic
1032543567 7:132724217-132724239 CTCTTGCAGCAGATCACATGAGG - Intronic
1032803541 7:135335331-135335353 CTCCAGGAGCAGGTGCCACGGGG + Intergenic
1034948818 7:155282925-155282947 CGCTGGCATCAGATGCCCTGGGG - Intergenic
1038437317 8:27545263-27545285 AAATAGCAGCAGCTGCCATGAGG + Exonic
1040531835 8:48272239-48272261 GTCTAGCAGCAGATTCAGTGGGG - Intergenic
1041260553 8:56017682-56017704 TTCTAGCAGCAGATCCTCTGAGG + Intergenic
1043439907 8:80267799-80267821 CCCTAGCTGCAGATGCCAAAGGG - Intergenic
1045272107 8:100670826-100670848 CTCTGCCAGCAGAGGCCAGGAGG - Intergenic
1047337294 8:123948988-123949010 CACTAGCACCAGGAGCCATGTGG + Intronic
1048161089 8:132022763-132022785 TACTTGCAGCAAATGCCATGGGG + Intergenic
1052993597 9:34537339-34537361 CTCTATCACCTGCTGCCATGGGG - Intergenic
1055240172 9:74174534-74174556 CTCAATCAGCTGTTGCCATGTGG - Intergenic
1059417472 9:114170818-114170840 CTCTGGCACCAGGTGCCTTGGGG + Intronic
1062390837 9:136333261-136333283 CACACCCAGCAGATGCCATGGGG - Intronic
1186612034 X:11146739-11146761 CTCTAGCAGCAGAGGCAGTTAGG + Intronic
1188606827 X:32041416-32041438 CTCAAGCCACAGATGCCATATGG - Intronic
1188882955 X:35513030-35513052 CTCTAGCCCCAGATGCACTGAGG + Intergenic
1188976149 X:36677943-36677965 CTCTACCAGCAGATGGCCTTGGG - Intergenic
1189280512 X:39817523-39817545 CTCTGGCTGCAGAGGGCATGAGG + Intergenic
1192858615 X:75040748-75040770 CTGCAGCAGCAGGGGCCATGTGG - Intergenic
1195954296 X:110312922-110312944 CTATCGCAGATGATGCCATGAGG - Intronic
1196148593 X:112346615-112346637 CTGAAGCAGCAGATACCATTTGG + Intergenic
1196897886 X:120355539-120355561 CTGTAGCAACAGAAGCCATTTGG - Intergenic
1197438019 X:126456313-126456335 CACTACCACCAGAGGCCATGAGG - Intergenic
1200251404 X:154556153-154556175 CTCTGCCACCAGATGCCATCCGG + Exonic
1200266363 X:154648263-154648285 CTCTGCCACCAGATGCCATCCGG - Intergenic