ID: 1003128507

View in Genome Browser
Species Human (GRCh38)
Location 6:3375496-3375518
Sequence CCACTGGCCCACATTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003128507_1003128514 7 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128514 6:3375526-3375548 CTGAGGCCATCACTGTGGGCAGG No data
1003128507_1003128519 23 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128519 6:3375542-3375564 GGGCAGGGATATGAGTTCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 230
1003128507_1003128517 21 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128517 6:3375540-3375562 GTGGGCAGGGATATGAGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 243
1003128507_1003128513 3 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128513 6:3375522-3375544 AGTGCTGAGGCCATCACTGTGGG No data
1003128507_1003128518 22 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128518 6:3375541-3375563 TGGGCAGGGATATGAGTTCTGGG 0: 1
1: 0
2: 3
3: 11
4: 204
1003128507_1003128515 8 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128515 6:3375527-3375549 TGAGGCCATCACTGTGGGCAGGG 0: 1
1: 0
2: 2
3: 43
4: 431
1003128507_1003128512 2 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128512 6:3375521-3375543 TAGTGCTGAGGCCATCACTGTGG No data
1003128507_1003128510 -10 Left 1003128507 6:3375496-3375518 CCAGAATCAATGTGGGCCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1003128510 6:3375509-3375531 GGGCCAGTGGGCTAGTGCTGAGG 0: 1
1: 0
2: 2
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003128507 Original CRISPR CCACTGGCCCACATTGATTC TGG (reversed) Intronic
902828772 1:18996086-18996108 CCACTGGCCACCATTGATTGAGG + Intergenic
910806227 1:91192000-91192022 CCACTGTCACACATTGGTCCAGG + Intergenic
911304575 1:96217267-96217289 TCAGTGGCCCAGATTGATTCAGG + Intergenic
917637974 1:176955503-176955525 CCACTGGACCACGTGGCTTCTGG - Intronic
922721643 1:227902930-227902952 CCACTGCCCCACACTGTCTCGGG - Intergenic
1065684261 10:28268186-28268208 TCCCTGCCCCACAGTGATTCAGG - Intronic
1070874438 10:79789482-79789504 CACCTGGCCCTCTTTGATTCAGG - Intergenic
1071563643 10:86660680-86660702 CCACTTCCCCCCATTGACTCTGG - Intronic
1071641362 10:87311640-87311662 CACCTGGCCCTCTTTGATTCAGG - Intergenic
1071964582 10:90839328-90839350 CAACTGGACCAGATTGATTATGG + Intronic
1074487286 10:113897723-113897745 ACACTGGCACACATATATTCTGG - Intronic
1074777954 10:116779873-116779895 CCATGGGCCCACATGGAGTCGGG - Intergenic
1075044171 10:119133114-119133136 CCACTGGGCCACATGGACGCTGG - Intronic
1078536444 11:12178945-12178967 CCACTGTCCCACTTTGGTTCAGG + Intronic
1083311668 11:61786881-61786903 CCACTGGCCCCTACTGGTTCAGG - Exonic
1084122405 11:67077420-67077442 GCCCTAGCCCACATTGATCCGGG + Intergenic
1084356246 11:68640722-68640744 CCACTGGGCCTCTTTCATTCTGG + Intergenic
1085355770 11:75835393-75835415 CCACTGTGTCACATTGCTTCGGG - Intronic
1088670733 11:112137892-112137914 CCAATGGCCCACCTAAATTCAGG - Intronic
1090161679 11:124501887-124501909 CTCCTGGCCCAATTTGATTCTGG - Intergenic
1095718892 12:45378651-45378673 CCACCGCCCCACATTGATGCTGG - Intronic
1096504663 12:52085182-52085204 CCACAGGCCCAGCATGATTCAGG + Intergenic
1108704918 13:52976231-52976253 CCACCTGCCCACATCGACTCTGG - Intergenic
1113968284 13:114167097-114167119 CCTCAGCCCCACATTGTTTCAGG - Intergenic
1118311424 14:64696389-64696411 CCACTGGGCCACAGGGATGCAGG + Intergenic
1121906745 14:97753026-97753048 CCACTGGCCCAAGGTGTTTCTGG - Intronic
1133312957 16:4862777-4862799 CCACAGCCCAACATTGTTTCCGG - Intronic
1135117005 16:19732396-19732418 CCACTGGCCGACTTTTCTTCAGG + Intronic
1138845818 16:60564476-60564498 CCACTGGGCCACATTGTCTCTGG + Intergenic
1139331551 16:66196160-66196182 CCACTGGCCCACATCCATCAGGG + Intergenic
1141019542 16:80482186-80482208 TGACTGCCCCACATTGATTTGGG - Intergenic
1144263436 17:13545533-13545555 CCACTGGGCCACAGAGATTTTGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1146473907 17:33146389-33146411 CCACTCTGCCACCTTGATTCTGG - Intronic
1148736231 17:49866530-49866552 CCACTGGCCCAGCTCCATTCTGG - Intergenic
1156885246 18:42128065-42128087 TCACAGGCCCACCTTGATTCTGG - Intergenic
1160416569 18:78716170-78716192 CCACTTGCCCACATTTGATCCGG - Intergenic
1164886288 19:31781570-31781592 CCACTGGCACACAAAGCTTCAGG - Intergenic
1166730357 19:45055895-45055917 CCACTGTCCCACAGCGAGTCAGG + Intronic
1166759841 19:45217767-45217789 CCACTCGCCCACATCCACTCCGG + Intronic
1168262652 19:55205218-55205240 CCTCTGGGCCACATTGAGCCAGG - Intronic
925967716 2:9081441-9081463 TCACTGGCTCTCATTGATCCAGG - Intergenic
926341342 2:11907145-11907167 CCATTGGCCCCCATAGTTTCTGG + Intergenic
927179266 2:20432876-20432898 CCACTGGCACAGATTGCTTATGG + Intergenic
933553316 2:83802694-83802716 CCACTGGCCCAGAAGGATTGAGG - Intergenic
944679141 2:202061013-202061035 CCAGTGTCCCACATTGCTTTGGG + Intergenic
945148084 2:206759782-206759804 CCACTGGCCTCTATTGTTTCAGG - Intronic
1168866914 20:1094686-1094708 CCACTGGCCCCCACTGAGCCTGG + Intergenic
1171003857 20:21443795-21443817 CCAATGGGCCTCATTTATTCTGG + Intergenic
1173676091 20:44836919-44836941 CAACTAGCCCTCATTGATGCAGG - Intergenic
1174044492 20:47723945-47723967 GCACTGGCCCACAACCATTCTGG - Intronic
1181687622 22:24540551-24540573 CAACTGTCCCACATGGCTTCAGG + Intronic
951117253 3:18879303-18879325 CCACTGGCCCAAACTGATAATGG - Intergenic
960625709 3:119680066-119680088 CCACTGTCCCTCCTTGCTTCAGG + Intergenic
962436153 3:135368620-135368642 CCTCTGGCCCACGTTCCTTCTGG - Intergenic
966116905 3:176474889-176474911 CCAATGGCCCAGCTTGAATCCGG - Intergenic
966361676 3:179137076-179137098 CCATTTCCCCACATTGATTGGGG - Intergenic
976065320 4:81180657-81180679 CAAGTGTCCCACATTGATTCTGG + Intronic
980077576 4:128309882-128309904 CCACTCACCCAGATTGATCCAGG + Intergenic
981747301 4:148063968-148063990 CCACTGGCCCAGATCCACTCCGG - Intronic
986228300 5:5838006-5838028 CTTCTGGCCCACATTGCTCCTGG - Intergenic
993085398 5:83357608-83357630 CCTTTGGCCAACATTGCTTCTGG - Intergenic
993428504 5:87800374-87800396 CCAGGTTCCCACATTGATTCTGG + Intergenic
996629087 5:125606341-125606363 CCACTGACTCACATTCATGCAGG - Intergenic
997529822 5:134575101-134575123 CCACATCCCCACATTGGTTCTGG + Intronic
1001659525 5:173380401-173380423 CCACTGGTACAGCTTGATTCGGG - Intergenic
1003128507 6:3375496-3375518 CCACTGGCCCACATTGATTCTGG - Intronic
1003166999 6:3688415-3688437 CCACTGGACCAAATTGACTCAGG - Intergenic
1003432417 6:6052325-6052347 CCACTGGCCTTTAATGATTCAGG - Intergenic
1005462987 6:26086750-26086772 CCACTGGCCCACCTAAATTCAGG - Intergenic
1007879244 6:45143973-45143995 CAACTGTCCCAGATTGAATCAGG + Intronic
1014640024 6:123898152-123898174 CCACTGGCGGACACTGATACAGG + Intronic
1015102988 6:129503252-129503274 CCACTGGCCATCATTGATTTTGG - Exonic
1028595141 7:92540230-92540252 CCAATAGCCCATATAGATTCAGG - Intergenic
1029249678 7:99226868-99226890 CCCCTGCCCCACAGTGATTTTGG - Intergenic
1033366188 7:140673761-140673783 CCACTGGCCCAGTTTGATGTAGG - Exonic
1039807233 8:41010766-41010788 CCAATGGCACACCCTGATTCAGG + Intergenic
1045604824 8:103760657-103760679 CCTCTGGCCCACATTGTGTTTGG - Intronic
1047755896 8:127918158-127918180 CCACTGGCCCAACTGAATTCCGG - Intergenic
1049454045 8:142678038-142678060 CCACTGTCTCACCTTGAGTCTGG - Intronic
1056667154 9:88589940-88589962 CCACTGCCTTGCATTGATTCTGG - Intergenic
1062500864 9:136851454-136851476 CCACAGGCTCACGTTGACTCTGG + Intronic
1187397111 X:18928349-18928371 CCACTGGCTCATTTTGCTTCGGG - Intronic
1194315537 X:92372094-92372116 TCACTGTCCTACATGGATTCTGG - Intronic
1194821229 X:98509710-98509732 CCACTGGGCCACACTGACCCAGG + Intergenic
1195870613 X:109481281-109481303 CTACTGGCCCACAGTTGTTCTGG + Intronic
1196318956 X:114266259-114266281 CCTCTGGCCCCAATTGATTCTGG - Intergenic
1200623585 Y:5483633-5483655 TCACTGTCCTACATGGATTCTGG - Intronic
1201296967 Y:12472076-12472098 CCACTGAACCAAATTGGTTCTGG - Intergenic