ID: 1003129943

View in Genome Browser
Species Human (GRCh38)
Location 6:3386820-3386842
Sequence TTGTTCCCCATGTTGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003129943_1003129960 28 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129960 6:3386871-3386893 AGGGCGGGGCAGGCACCCCAGGG 0: 1
1: 0
2: 1
3: 44
4: 335
1003129943_1003129951 12 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129951 6:3386855-3386877 ACAGGGCCGGCACCCCAGGGCGG No data
1003129943_1003129946 -5 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129946 6:3386838-3386860 AACAAGGACTTGCTTCCACAGGG No data
1003129943_1003129948 8 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129948 6:3386851-3386873 TTCCACAGGGCCGGCACCCCAGG 0: 1
1: 0
2: 1
3: 7
4: 152
1003129943_1003129959 27 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129959 6:3386870-3386892 CAGGGCGGGGCAGGCACCCCAGG No data
1003129943_1003129953 14 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129953 6:3386857-3386879 AGGGCCGGCACCCCAGGGCGGGG No data
1003129943_1003129949 9 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129949 6:3386852-3386874 TCCACAGGGCCGGCACCCCAGGG No data
1003129943_1003129945 -6 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129945 6:3386837-3386859 GAACAAGGACTTGCTTCCACAGG No data
1003129943_1003129952 13 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129952 6:3386856-3386878 CAGGGCCGGCACCCCAGGGCGGG No data
1003129943_1003129947 -1 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129947 6:3386842-3386864 AGGACTTGCTTCCACAGGGCCGG 0: 1
1: 0
2: 2
3: 19
4: 211
1003129943_1003129955 18 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129955 6:3386861-3386883 CCGGCACCCCAGGGCGGGGCAGG 0: 1
1: 1
2: 5
3: 43
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003129943 Original CRISPR TTGTTCCCCATGTTGCTGCC AGG (reversed) Intronic
900379001 1:2374377-2374399 GTGTTTCCCATATGGCTGCCCGG + Intronic
901733798 1:11299257-11299279 GTGAACCCCAAGTTGCTGCCCGG - Intergenic
901785334 1:11620915-11620937 ATGCTCCCCATCTTCCTGCCAGG + Intergenic
902296364 1:15469897-15469919 CAGGTCCCCAGGTTGCTGCCAGG - Intronic
905341432 1:37280689-37280711 TCTTTCCCCACCTTGCTGCCTGG + Intergenic
905645250 1:39620768-39620790 TTGTCTCCCATGTAACTGCCTGG - Intergenic
905858393 1:41330095-41330117 TTGTTCCCCATGAGCCAGCCTGG - Intergenic
905870041 1:41398204-41398226 TTGGTTCCCATGTGGCTCCCTGG + Intergenic
905883066 1:41476958-41476980 GTTTTCCTCATGCTGCTGCCAGG + Intergenic
908693533 1:66810280-66810302 TTGTTCCCCAAATGGCTGGCAGG + Intergenic
913614772 1:120547309-120547331 TTCTTCCCCACTTTTCTGCCTGG + Intergenic
913676071 1:121141762-121141784 TTTTTCTCCATAGTGCTGCCAGG + Intergenic
914027964 1:143929706-143929728 TTTTTCTCCATAGTGCTGCCAGG + Intergenic
914575499 1:148963598-148963620 TTCTTCCCCACTTTTCTGCCTGG - Intronic
915211503 1:154313013-154313035 TTCTTCACCATGTTTCTGGCTGG + Intergenic
915212636 1:154321990-154322012 TTCTTCACCATGTTTCTGGCTGG + Exonic
915310801 1:155005042-155005064 TTCTTCCCCATGGTGCCCCCTGG + Intronic
918104484 1:181404814-181404836 CTCTTCCCCATCTGGCTGCCAGG - Intergenic
918754363 1:188318563-188318585 ATGTTCCCCATGTTGCTAAAAGG - Intergenic
919895449 1:202007183-202007205 TAGGTCCCCATGTTGAGGCCAGG - Intergenic
920086974 1:203424504-203424526 TTTTTCCCCTTCTTGCTCCCTGG - Intergenic
920495882 1:206454575-206454597 TTCTACCCCATGCTGCTTCCTGG - Intronic
924449348 1:244163643-244163665 ATCTTCCCCATGCTGCTCCCTGG + Intergenic
924733629 1:246734727-246734749 TTGTTCCATCTTTTGCTGCCAGG + Intronic
1066747026 10:38610940-38610962 ATGATCCCCATGGTTCTGCCTGG - Intergenic
1067693140 10:48517408-48517430 GTGTTCCCCATTTTGGTTCCAGG + Intronic
1070006274 10:72427209-72427231 TTGTTCCCCAGGGGGCTGCAGGG + Intronic
1070248605 10:74754057-74754079 TTTGTCCGCATGCTGCTGCCAGG + Intergenic
1075240849 10:120777079-120777101 CTGCTCCCCATGAAGCTGCCTGG - Intergenic
1078115072 11:8439964-8439986 TTGTCCTTCACGTTGCTGCCAGG - Intronic
1079140799 11:17808150-17808172 CTGTCCTCCAAGTTGCTGCCTGG + Intronic
1080746137 11:35110327-35110349 TTCTTCCTCTTGTTCCTGCCTGG - Intergenic
1083788596 11:64969513-64969535 TTGTTTCCCACATTGCAGCCAGG - Intronic
1084286366 11:68133787-68133809 TTGTGCCCCATATCGATGCCAGG - Intergenic
1086768541 11:90730507-90730529 TTGTCCTCCATAATGCTGCCAGG + Intergenic
1086974124 11:93113616-93113638 TTGTTCACCATATATCTGCCAGG + Intergenic
1089254236 11:117185916-117185938 TTTTTGCTCATGTTGCTCCCTGG - Intronic
1089451974 11:118605231-118605253 CTTTTCCCCAAGTTGCTGCAGGG + Intergenic
1091631543 12:2164535-2164557 CTGCTCCCCATATTGCAGCCTGG + Intronic
1092660403 12:10732601-10732623 CTGTTCCCTCTGGTGCTGCCTGG + Intergenic
1094011800 12:25817491-25817513 TTGGTCTCCTTGTTGCAGCCAGG - Intergenic
1094053724 12:26247318-26247340 TTTTTCCCCATATTGTTGGCTGG - Intronic
1098779543 12:74668846-74668868 TTGTTTCTCAGGTTGCTTCCTGG - Intergenic
1099576700 12:84392174-84392196 TTTTTCCCCATATTGCAGCATGG + Intergenic
1101193237 12:102356333-102356355 TTCTCCCCCATTTTGCTGCTGGG + Intergenic
1101958961 12:109233862-109233884 CTGCTCCCCAGGTTGCTCCCTGG - Intronic
1103915618 12:124374227-124374249 CTGTTCCCCATGCTGGTCCCGGG - Intronic
1104264587 12:127219745-127219767 TTGATCCCCATGTTGCTCACAGG + Intergenic
1106600861 13:31185478-31185500 TTGCTCACCATGTGACTGCCTGG - Intergenic
1106833938 13:33613901-33613923 CTGCTCCCACTGTTGCTGCCTGG - Intergenic
1107263041 13:38518561-38518583 TTGTTCCCCCAGCTGCTGCTGGG + Intergenic
1111794249 13:92897475-92897497 CTCTACCCCATGTTGCTTCCTGG - Intergenic
1111882256 13:93972145-93972167 GTGTTTACCATTTTGCTGCCAGG - Intronic
1117244924 14:53875136-53875158 TTGGTCCCCATGTTGATCACTGG + Intergenic
1119483243 14:74973074-74973096 TGGTCGCTCATGTTGCTGCCTGG + Intergenic
1119662545 14:76462321-76462343 TGTTTCCCCAAGTAGCTGCCTGG + Intronic
1120257546 14:82139825-82139847 TTGTTTGGCAAGTTGCTGCCTGG + Intergenic
1120962244 14:90136032-90136054 TTGTCCACCATACTGCTGCCCGG - Intronic
1121853777 14:97247756-97247778 TGGTTCCCCATTTTACAGCCAGG + Intergenic
1125470579 15:39998888-39998910 TTTTTCCCCACGTTGTTCCCAGG - Intronic
1129525398 15:76210515-76210537 TGCTTCCCTATGTTGCAGCCTGG - Intronic
1134250546 16:12570931-12570953 ATGGTCCCCATGTGGCTCCCAGG - Exonic
1136736041 16:32468705-32468727 ATGATCCCCATGTTTCTGCCTGG + Intergenic
1137800889 16:51261093-51261115 TAGTTCTCCATGTTGTTGCCAGG + Intergenic
1138004918 16:53324329-53324351 ATGTTCCCCATGCTGCTGTCAGG + Exonic
1142191133 16:88718421-88718443 CTGTTGCCCGTGATGCTGCCAGG - Intronic
1203017033 16_KI270728v1_random:360869-360891 ATGATCCCCATGGTTCTGCCTGG - Intergenic
1203035368 16_KI270728v1_random:634027-634049 ATGATCCCCATGGTTCTGCCTGG - Intergenic
1147414450 17:40278469-40278491 TTGTTCCTCATGTGGCTAGCAGG - Exonic
1147769342 17:42856834-42856856 TGGTTCCCTTTGTTGCTGTCTGG + Exonic
1148773711 17:50081376-50081398 TTGTTCTCCATGTTGATGGTGGG - Exonic
1152203930 17:78963572-78963594 TTGCTCCCCATGGTGTTGGCTGG - Intergenic
1154940983 18:21112167-21112189 TTGTTCTCCTTGTTGCTGTTAGG + Intergenic
1157608267 18:48939808-48939830 CTGCTCCCCACCTTGCTGCCAGG + Intronic
1158535354 18:58303564-58303586 TAGTTCACTATGTGGCTGCCAGG - Intronic
1167367823 19:49064194-49064216 TGGTTCCCCAAGCTGCTTCCTGG + Intronic
1168415221 19:56163455-56163477 CTGTTCCTCATGGTGCTGCTTGG + Intergenic
925985497 2:9211747-9211769 TGGTTCCCACTGTTGCTGCTAGG - Intronic
930152735 2:48075175-48075197 TTGTTCTACCTGGTGCTGCCTGG + Intergenic
932903891 2:75729481-75729503 TGATTCCCCATGTTGCGGGCAGG + Intergenic
934187206 2:89757817-89757839 ATGATCCCCATGGTTCTGCCTGG + Intergenic
934309428 2:91850107-91850129 ATGATCCCCATGATTCTGCCTGG - Intergenic
936502973 2:113081102-113081124 TTGTTCCCCAATTACCTGCCTGG + Intergenic
936510705 2:113143303-113143325 TTGTTCTCCAAGTTGTTGCATGG + Intergenic
936961488 2:118079502-118079524 TTGTTGCATATGTTTCTGCCTGG - Intergenic
937385720 2:121430271-121430293 TTGCTCCCCATGTAGTTGGCTGG - Intronic
937916042 2:127099183-127099205 TTGTTGCACATGTGGCTGCATGG - Intronic
941627114 2:167842260-167842282 CAGTTACCCATGCTGCTGCCTGG + Intergenic
942071868 2:172323590-172323612 CTGTTCCCCATGCTGCCCCCAGG + Intergenic
943132637 2:183873636-183873658 TTGTATCCAATGTTTCTGCCTGG + Intergenic
944836532 2:203585664-203585686 CTGTTTTCCATGTGGCTGCCTGG + Intergenic
947024901 2:225726363-225726385 TTATTCCCTATGTTGCTTCTTGG + Intergenic
947620261 2:231585526-231585548 TTGTCCCCCAGGTTGCGGGCTGG - Intergenic
948705919 2:239792412-239792434 CTGTCCCCCATGCTCCTGCCTGG + Intronic
1170370536 20:15643229-15643251 TTGTTCCCCATGCTGTAGCCTGG + Intronic
1171127550 20:22616574-22616596 TTGTTCCTCCTGTTCCTGCCTGG + Intergenic
1173257483 20:41405170-41405192 ATGCTGCCCATGATGCTGCCAGG - Exonic
1174634307 20:51985926-51985948 CTTTTCTCCATCTTGCTGCCTGG - Intergenic
1174665788 20:52256636-52256658 TAGTTCCTCATGTTGCTGCTAGG + Intergenic
1174873020 20:54201055-54201077 TTGTACCCCATGCTTCTCCCCGG + Intergenic
1174992244 20:55523277-55523299 TCTTTCCCCATGTGGCTCCCAGG - Intergenic
1175637252 20:60596147-60596169 CTGTCCCCTATGTTGGTGCCTGG + Intergenic
1175836304 20:61997501-61997523 ATGTTCCCCATGTTTCCCCCAGG + Intronic
1178247178 21:30964628-30964650 TTGTTCCCAAGGATGCTGCTGGG - Intergenic
1180536519 22:16397244-16397266 ATGATCCCCATGGTTCTGCCTGG - Intergenic
1182700444 22:32232925-32232947 ATGTTCCTCATGGTGATGCCGGG - Exonic
1183640392 22:39089081-39089103 TGGTTCCCCATGTGGGTGGCAGG - Intergenic
955923745 3:63985562-63985584 GTGTTTCCCAAGTTGCTGCCAGG + Intronic
956528456 3:70190337-70190359 TTGTCCTGCATGCTGCTGCCTGG + Intergenic
956731374 3:72199733-72199755 TTATTCCCCTTGTTGCTGTGGGG - Intergenic
958093253 3:88904642-88904664 TTTTTCCCAGTGTTTCTGCCAGG + Intergenic
959568794 3:107859925-107859947 CTGTTCCCCAAGTTGCTGAGTGG - Intergenic
960477349 3:118145376-118145398 TGGTTCCCCATGTGGCTCTCAGG + Intergenic
967095449 3:186173869-186173891 TCATCCCCCATGTTCCTGCCTGG + Intronic
972052718 4:34759246-34759268 TAGTTTCTCATGTTACTGCCTGG - Intergenic
974622069 4:64369017-64369039 TTGTTCCCCATGGTTCTTTCTGG + Intronic
975594298 4:76033306-76033328 TTGTTTCTCCTGCTGCTGCCAGG + Intronic
976464616 4:85353285-85353307 TTTCTCTCCATGTTGCTGCATGG + Intergenic
977138829 4:93340823-93340845 TCTTTCCCCATGTTGCTGCCAGG - Intronic
977530450 4:98194658-98194680 TTTTTTCCCATATTGTTGCCAGG - Intergenic
978419260 4:108512602-108512624 TTTTCCCCCATGTTTTTGCCTGG + Intergenic
980292762 4:130866326-130866348 TTGTTCATCATATAGCTGCCTGG + Intergenic
981018297 4:139998876-139998898 TTGTTACCCCTGTTTCTGCATGG + Intronic
981113221 4:140959263-140959285 TTGACCCCCATCTAGCTGCCTGG + Intronic
985646643 5:1088095-1088117 TTCTTCCCCATTTTGCTGCGTGG - Intronic
987773498 5:22335992-22336014 TTATTGTCCATGTTGCTGTCAGG - Intronic
997019833 5:129986488-129986510 TTTTTCATCATGTTTCTGCCAGG + Intronic
997834457 5:137180987-137181009 TTATTCCCCATCTTTCTGCCTGG - Intronic
997936561 5:138117170-138117192 TTGTTCCCCATGCTGGAGTCTGG - Intronic
998676839 5:144418674-144418696 TGGTTCCCTGTGTTTCTGCCAGG - Intronic
998715326 5:144877110-144877132 TTGTTCTGCTTGTTGGTGCCTGG + Intergenic
999951509 5:156656790-156656812 TTTTTCCCCATAATGCTACCAGG + Intronic
999954706 5:156687808-156687830 CTGATCACCATGTTGCTGGCTGG + Intronic
1000849950 5:166327943-166327965 GTATTCCCCAAGTTGCTTCCTGG + Intergenic
1001058848 5:168471225-168471247 TTCTTCCCCCTGTGGCTTCCAGG + Intronic
1002187589 5:177461673-177461695 ATGCTCCCAATGTTGCTGCCTGG + Intronic
1003129943 6:3386820-3386842 TTGTTCCCCATGTTGCTGCCAGG - Intronic
1003542721 6:7032346-7032368 TTCCTGCCCCTGTTGCTGCCGGG - Intergenic
1004206999 6:13600871-13600893 TTGCCCCCCAGGTGGCTGCCAGG + Exonic
1005637561 6:27766347-27766369 TTGACCCCCATTCTGCTGCCAGG - Intergenic
1009707143 6:67266422-67266444 TTTTTTCCCCTGCTGCTGCCAGG - Intergenic
1009732855 6:67633179-67633201 ATGTTCCCCATGCTGCTCTCAGG + Intergenic
1018687641 6:166316307-166316329 TTTCTCCCCATATTGCTGCGTGG - Intergenic
1020358955 7:7306454-7306476 TTCTTCCTCATGCAGCTGCCTGG - Intergenic
1026512759 7:71040658-71040680 TTCTTCCCTATGATGCTGCTTGG - Intergenic
1026899943 7:74031238-74031260 TTTCTCCCCATTTTGCAGCCAGG - Intronic
1028966822 7:96811261-96811283 CTGTTCTCCATTTTGTTGCCTGG - Intergenic
1029197356 7:98814860-98814882 TTGTCCCCCATGTTCCTGGCTGG - Intergenic
1030523325 7:110624984-110625006 TTGTTCTTAATGTTGCTGCATGG + Intergenic
1030678916 7:112413710-112413732 TGCTTCTCCATGCTGCTGCCTGG + Intergenic
1031389657 7:121198518-121198540 TTGTTCCCTGTGTTTTTGCCCGG + Intronic
1032028068 7:128459231-128459253 TTGGTCCCCTTGTGGCTGGCAGG + Intergenic
1033557689 7:142503020-142503042 TTGTTCCCCATTTTATTGTCAGG + Intergenic
1034086760 7:148329049-148329071 GTGTTCTCCATGCTGCTGCCTGG + Intronic
1034442116 7:151091084-151091106 ATGGTCCCCATGTTTGTGCCAGG + Intronic
1036596366 8:10216348-10216370 TTTTTCTTCATGTTGCTGCTAGG - Intronic
1038193003 8:25340994-25341016 GAGTTACCCATGATGCTGCCAGG - Intronic
1038576882 8:28712168-28712190 TTCTTCCCCAGGCTTCTGCCTGG - Intronic
1041415897 8:57608796-57608818 TTCTGCCCCATGTTGCTTTCTGG - Intergenic
1043035719 8:75196262-75196284 CTGTTTCCCATGTTTCTTCCTGG + Intergenic
1043255628 8:78133432-78133454 TTGCTCCCCATTCTGCTGCTAGG - Intergenic
1046684528 8:117210292-117210314 TTATTGCCCATCTTGCTGCTTGG - Intergenic
1048971934 8:139650004-139650026 TCTTTCCCCAGGTAGCTGCCTGG - Intronic
1050115087 9:2255286-2255308 TCGTTCTCCACATTGCTGCCAGG + Intergenic
1054851776 9:69853895-69853917 TTGTTTTCCTTCTTGCTGCCTGG - Intronic
1055020811 9:71667702-71667724 TAATTCCCCATGTAGCTGACTGG - Intergenic
1055649425 9:78392753-78392775 TTCTTACCTATGTTGCTGTCAGG - Intergenic
1058363913 9:104184868-104184890 CTGTTTCACATGCTGCTGCCTGG - Intergenic
1058424700 9:104866298-104866320 TTCTCCCCTATGTTGCTGGCAGG + Intronic
1058629918 9:106975759-106975781 TCTTTTCCCATATTGCTGCCTGG + Intronic
1060681186 9:125566523-125566545 CTGTTGCCCATGCTGCTGCAGGG - Intronic
1061793093 9:133068824-133068846 TTGTTGCCCTTGTTGATGGCAGG - Exonic
1061795696 9:133084608-133084630 TTGTTGCCCTTGTTGATGGCAGG - Intronic
1062702197 9:137913158-137913180 TTCTTCTCCTTGTTTCTGCCAGG + Exonic
1186024800 X:5297559-5297581 TTGATCCCCATGTTGCAGGTGGG + Intergenic
1186455374 X:9706585-9706607 TTGTTCCCATTGTTGTTCCCTGG - Intronic
1194876040 X:99188696-99188718 TTGTTCCTCATGTGCCTGTCAGG - Intergenic
1195479797 X:105331278-105331300 TTTTTCCCCAAGTTGGTTCCTGG + Intronic
1199249455 X:145643250-145643272 TTTTTCCCCATGTTTCTTCTAGG - Intergenic
1200112683 X:153750061-153750083 ATGATCCCCATGGTTCTGCCTGG - Intergenic